Skip to content

Commit

Permalink
update
Browse files Browse the repository at this point in the history
  • Loading branch information
Heng Li committed Jul 15, 2010
1 parent 07dc1c6 commit b351164
Showing 1 changed file with 190 additions and 30 deletions.
220 changes: 190 additions & 30 deletions SAMv1.tex
View file
Original file line number Diff line number Diff line change
@@ -1,25 +1,69 @@
\documentclass[10pt]{article}
\usepackage{framed}
\usepackage{enumitem}

\addtolength{\textwidth}{3.2cm}
\addtolength{\hoffset}{-1.6cm}
\addtolength{\textwidth}{3.4cm}
\addtolength{\hoffset}{-1.7cm}
\addtolength{\textheight}{4cm}
\addtolength{\voffset}{-2cm}

\makeindex

\title{The SAM Format Specification (v1.3 draft)}

\author{The SAM Format Specification Working Group}
\begin{document}

\maketitle

\section{Terminologies and Concepts}

\section{The SAM Format Specification}
SAM stands for Sequence Alignment/Map format. It is a TAB-delimited text
format consisting of a header section, which is optional, and an
alignment section. Header lines start with `{\tt @}', while alignment
lines do not. Each alignment line has 11 mandatory fields for essential
alignment information such as mapping position, and variable number of
optional fields for flexible or aligner specific information.

\subsection{An example}
Suppose we have the following alignment with bases in lower cases
clipped from the alignment. Read {\tt r001/1} and {\tt r001/2}
constitute a read pair; {\tt r003} is a chimeric read; {\tt r004}
represents a split alignment.

\begin{framed}\small
\begin{verbatim}
Coor 12345678901234 5678901234567890123456789012345
ref AGCATGTTAGATAA**GATAGCTGTGCTAGTAGGCAGTCAGCGCCAT
+r001/1 TTAGATAAAGGATA*CTG
+r002 aaaAGATAA*GGATA
+r003 gcctaAGCTAA
+r004 ATAGCT..............TCAGC
-r003 ttagctTAGGC
-r001/2 CAGCGCCAT
\end{verbatim}
\end{framed}
The corresponding SAM format is:
\begin{framed}\small
\begin{verbatim}
@HD VN:1.3 SO:coordinate
@SQ SN:ref LN:45
r001 163 ref 7 30 8M2I4M1D3M = 37 39 TTAGATAAAGGATACTA *
r002 0 ref 9 30 3S6M1P1I4M * 0 0 AAAAGATAAGGATA *
r003 0 ref 9 30 5H6M * 0 0 AGCTAA * NM:i:1
r004 0 ref 16 30 6M14N5M * 0 0 ATAGCTTCAGC *
r003 16 ref 29 30 6H5M * 0 0 TAGGC * NM:i:0
r001 83 ref 37 30 9M = 7 -39 CAGCGCCAT *
\end{verbatim}
\end{framed}

\subsection{Terminologies and Concepts}

\begin{description}
\item[Template] A DNA/RNA sequence part of which is sequenced on a
sequencing machine.
\item[Fragment] A (sub)sequence on a template which is
sequenced. Fragments on a template are said to be \emph{ordered} if
sequencing machine or assembled from raw sequences.
\item[Fragment] A (sub)sequence on a template which is sequenced or
assembled. Fragments on a template are said to be \emph{ordered} if
the their relative positions on the template are known. In this case,
the template is also said to be ordered.
\item[Read] A raw sequence that comes off a sequencing machine. A read
Expand All @@ -34,12 +78,21 @@ \section{Terminologies and Concepts}
specified by a half-close-half-open interval. For example, the region
between the 3rd and the 7th bases inclusive is $[2,7)$. The BED,
Wiggle and PSL formats are using the 0-based coordinate system.
\item[Phred scale] Given a probability $0<p\le 1$, the phred scale of $p$
equals $-10\log_{10}p$, rounded to the closest integer.
\end{description}

\section{The SAM Format Specification}
\subsection{The header}
The header section can be absent.
\subsection{The header section}
Each header line begins with character `{\tt @}' followed by a
two-letter record type code. In the header, each line is TAB-delimited
and each data field has an explicit field tag, which is represented
using two letters, as is described below. The field tag defines the
content and format of the data in the field.

The following table give the defined record types and tags. Tags with
`*' are required when the record type is present.
\begin{center}
\small
\begin{tabular}{|l|l|p{13.5cm}|}
\hline
\multicolumn{2}{|l|}{\bf Tag} & {\bf Description} \\
Expand Down Expand Up @@ -68,7 +121,7 @@ \subsection{The header}
{\tt ILLUMINA}, {\tt SOLID}, {\tt LS454}, {\tt HELICOS} and {\tt PACBIO}.\\\cline{2-3}
& {\tt PU} & Platform unit (e.g. lane for Illumina or slide for SOLiD). Unique identifier.\\\cline{2-3}
& {\tt SM} & Sample. Use pool name where a pool is being sequenced.\\\hline
\multicolumn{2}{|l}{\tt @PG} & Program. \\\cline{2-3}
\multicolumn{2}{|l}{\tt @PG} & Program. [TODO: the chaining PG] \\\cline{2-3}
& {\tt ID}* & Program name \\\cline{2-3}
& {\tt VN} & Program version \\\cline{2-3}
& {\tt CL} & Command line \\\hline
Expand All @@ -77,16 +130,20 @@ \subsection{The header}
\end{tabular}
\end{center}

\subsection{The mandatory fields}
The following table gives an overview of the mandatory fields in
the SAM format:
\subsection{The alignment section: mandatory fields}
Each alignment line has 11 mandatory fields. These fields always appear
in the same order and must be present, but their values can be `0' or
`*' (depending on the field) if the corresponding information is
unavailable. The following table gives an overview of the mandatory
fields in the SAM format:
\begin{center}
\small
\begin{tabular}{rllll}
\hline
{\bf Col} & {\bf Field} & {\bf Type} & {\bf Regexp/Range} & {\bf Brief description} \\
\hline
1 & {\sf QNAME} & String & {\tt [!-?A-\char126]+} & Query template NAME\\
2 & {\sf FLAG} & Int/Chr & {\tt [0,2$^{16}$-1]}/{\tt [*pPuUrR12sfd]} & bitwise FLAG \\
2 & {\sf FLAG} & Int/Str & {\tt [0,2$^{16}$-1]}/{\tt [*pPuUrR12sfd]+} & bitwise FLAG \\
3 & {\sf RNAME} & String & {\tt [!-\char126]+} & Reference sequence NAME\\
4 & {\sf POS} & Int & {\tt [0,2$^{29}$-1]} & 1-based leftmost mapping POSition \\
5 & {\sf MAPQ} & Int & {\tt [0,2$^8$-1]} & MAPping Quality \\
Expand All @@ -104,7 +161,7 @@ \subsection{The mandatory fields}
\item {\sf QNAME}: Query template NAME. Each template has a unique name.
\item {\sf FLAG}: bitwise FLAG. Each bit is explained in the following
table:
\begin{center}
\begin{center}\small
\begin{tabular}{rcl}
\hline
Bit & Char & Description\\
Expand Down Expand Up @@ -132,11 +189,11 @@ \subsection{The mandatory fields}
is lost in data processing.
\item Bit 0x100 marks the alignment not to be used in certain analyses
when the tools in use are aware of this bit.
\item \emph{Implicit rules}: if 0x1 is unset, 0x2, 0x8, 0x20, 0x40,
0x80 are all regarded to be unset; if 0x4 or 0x8 is set, 0x2 is
regarded to be unset.
\item Bits 0x10 and 0x20 only indicate the strand of the
fragment. Unmapped reads may have these two bits set.
\item \emph{Implicit rule}: if 0x1 is unset, 0x2, 0x8, 0x20, 0x40,
0x80 are all regarded to be unset; if 0x4 or 0x8 is set, 0x2 is
regarded to be unset.
\end{itemize}
\item {\sf RNAME}: Reference sequence NAME of the alignment. An unmapped
fragment without coordinate has a `*' at this field. However, an
Expand All @@ -145,14 +202,20 @@ \subsection{The mandatory fields}
\item {\sf POS}: 1-based leftmost mapping POSition of the first matching
base. The first base in a reference sequence has coordinate 1. {\sf
POS} is set as 0 for an unmapped read without
coordinate. \emph{Implicit rules}: if {\sf RNAME} is `*', {\sf POS} is
regarded to be 0, and vice versa.
coordinate.
\begin{itemize}
\item \emph{Implicit rule}: if {\sf POS} plus the sum of lengths
of I/N/M/=/X operations in {\sf CIGAR} exceeds the length of {\sf
RNAME}, the alignment is considered to be unmapped.
\item \emph{Implicit rule}: if {\sf RNAME} is `*', {\sf POS} is
regarded to be 0, and vice versa.
\end{itemize}
\item {\sf MAPQ}: MAPping Quality. It equals
$-10\log_{10}\Pr\{\mbox{mapping position is wrong}\}$, rounded to the
nearest integer.
\item {\sf CIGAR}: CIGAR string. The CIGAR operations are given in the
following table:
\begin{center}
\begin{center}\small
\begin{tabular}{cl}
\hline
Op & Description\\
Expand All @@ -174,10 +237,14 @@ \subsection{The mandatory fields}
\end{itemize}
\item {\sf RNEXT}: Reference sequence name of the NEXT fragment in the
template. This field is set as `*' when the information is
unavailable.
unavailable, and set as `=' if {\sf RNEXT} is identical {\sf
RNAME}. If not `=' and all fragments in the template have one
primary mapping, this field is identical to {\sf RNAME} of the next
fragment.
\item {\sf PNEXT}: Position of the NEXT fragment in the template. Set as
0 when the information is unavailable. \emph{Implicit rules}: if {\sf
RNEXT} is `*', {\sf PNEXT} is regarded to be 0, and vice versa.
0 when the information is unavailable. \emph{Implicit rule}: if {\sf
RNEXT} is `*', {\sf PNEXT} is regarded to be 0, and vice versa. This
field equals {\sf POS} of the next fragment.
\item {\sf TLEN}: observed Template LENgth. It is set as 0 for
single-fragment template or when the information is unavailable.
\item {\sf SEQ}: fragment SEQuence. This field can be a `*' when the
Expand All @@ -189,17 +256,110 @@ \subsection{The mandatory fields}
the length of the quality string must equal the length of {\sf SEQ}.
\end{enumerate}

\subsection{Optional fields}
All optional fields can be absent.
\begin{center}
\begin{tabular}{ll}
\subsection{The alignment section: optional fields}
All optional fields are presented in the {\tt TAG:TYPE:VALUE} format
where {\tt TAG} is a two-character string that matches {\tt
/[A-Z][A-Z0-9]/}, {\tt TYPE} is a casesensitive single letter which
defines the format of {\tt VALUE}:
\begin{center}\small
\begin{tabular}{cll}
\hline
{\bf Tag} & {\bf Description} \\
{\bf Type} & {\bf Regexp matching {\tt VALUE}} & {\bf Descrption} \\
\hline
A & {\tt [!-\char126]} & Printable character \\
i & {\tt [-+]?[0-9]+} & Singed 32-bit integer \\
f & {\tt [-+]?[0-9]*\char92.?[0-9]+([eE][-+]?[0-9]+)?} & Single-precision floating number \\
Z & {\tt [\,\,\,!-\char126]+} & Printable string, including space\\
H & {\tt [0-9A-F]+} & Hex string, high nybble first \\
\hline
\end{tabular}
\end{center}

{\flushleft Predefined tags are shown in the following table. You can
freely add new tags, and if a new tag may be of general interest, you
can email {\tt [email protected]} to add the new tag
to the specification. Note that tags started with `{\tt X}', `{\tt Y}'
and `{\tt Z}' are reserved for local use and will not be formally
defined in any future version of this specification.}
\begin{center}\small
\begin{tabular}{ccp{12.5cm}}
\hline
{\bf Tag} & {\bf Type} & {\bf Description} \\
\hline
{\tt X?} & ? & Reserved fields for end users (together with {\tt Y?} and {\tt Z?}) \\
{\tt AM} & i & The smallest template-independent mapping quality of fragments in the \\
{\tt AS} & i & ALignment score generated by aligner \\
{\tt CM} & i & Edit distance between the color sequence and the color reference (see also {\tt NM})\\
{\tt CQ} & Z & Color read quality on the original strand of the read. Same encoding as {\sf QUAL}.\\
{\tt CS} & Z & Color read sequence on the original strand of the read. Of the same length as {\tt CQ}. \\
{\tt E2} & Z & The 2nd most likely base calls. Of the same length as {\sf SEQ}. \\
{\tt FI} & i & The index of fragment in the template.\\
{\tt FS} & Z & Fragment suffix.\\
{\tt LB} & Z & Library. Value to be consistent with the header {\tt RG-LB} tag if {\tt @RG} is present.\\
{\tt H0} & i & Number of perfect hits\\
{\tt H1} & i & Number of 1-difference hits (see also {\tt NM})\\
{\tt H2} & i & Number of 2-difference hits \\
{\tt HI} & i & Query hit index, indicating the alignment record is the i-th one stored in SAM\\
{\tt IH} & i & Number of stored alignments in SAM that contains the query in the current record\\
{\tt MD} & Z & String for mismatching positions \\
{\tt MQ} & i & Mapping quality of the mate/next fragment \\
{\tt NH} & i & Number of reported alignments that contains the query in the current record\\
{\tt NM} & i & Edit distance to the reference, including ambiguous bases but excluding clipping \\
{\tt OQ} & i & Original base quality (usually before recalibration). Same encoding as {\sf QUAL}.\\
{\tt OP} & i & Original mapping position (usually before realignment) \\
{\tt OC} & Z & Original CIGAR (usually before realignment) \\
{\tt PG} & Z & Program. Value matches the header {\tt PG-ID} tag if {\tt @PG} is present. \\
{\tt PQ} & i & Phred likelihood of the template, conditional on both the mapping being correct \\
{\tt PU} & Z & Platform unit. Value to be consistent with the header {\tt RG-PU} tag if {\tt @RG} is present.\\
{\tt Q2} & Z & Phred quality of the mate/next fragment. Same encoding as {\sf QUAL}.\\
{\tt R2} & Z & Sequence of the mate/next fragment in the template. \\
{\tt RG} & Z & Read group. Value matches the header {\tt RG-ID} tag if {\tt @RG} is present in the header. \\
{\tt SM} & i & Template-independent mapping quality \\
{\tt TC} & i & The number of fragments in the template.\\
{\tt U2} & Z & Phred prob. of the 2nd call being wrong conditional on the best being wrong \\
{\tt UQ} & i & Phred likelihood of the fragment, conditional on the mapping being correct \\
\hline
\end{tabular}
\end{center}
The {\tt GS}, {\tt GC}, {\tt GQ}, {\tt S2} and {\tt SQ} are reserved for
backward compatibility.
\pagebreak
\section{The SAM Format Standards}

\begin{enumerate}
\item No implicit rules need to be applied.
\item The header section
\begin{enumerate}[label*=\arabic*]
\item The {\tt @HD} line is present with the {\tt SO} tag specified.
\item The {\tt @SQ} lines are present if reads have been mapped.
\item The corresponding {\tt @RG} lines are defined if {\tt RG} tags
appear in the alignment lines.
\item The corresponding {\tt @PG} lines are defined if {\tt PG} tags
appear in the alignment lines.
\end{enumerate}
\item Adjacent CIGAR operations are different.
\item Unmapped reads
\begin{enumerate}[label*=\arabic*]
\item For a unmapped paired-end or mate-pair read whose mate is
mapped, the unmapped read has {\sf RNAME} and {\sf POS} identical to
its mate.
\item If all fragments in a template are unmapped, their {\sf RNAME}
is set as `*' and {\sf POS} as 0.
\end{enumerate}
\item Multiple mapping
\begin{enumerate}[label*=\arabic*]
\item At most one primary alignment for each fragment (controlled
by the 0x100 bit). {\sf RNEXT} and {\sf PNEXT} point to the primary
alignment of the next fragment.
\item {\sf SEQ} and {\sf QUAL} of secondary alignments are set to `*'.
\end{enumerate}
\item Chimeric alignment
\begin{enumerate}[label*=\arabic*]
\item There is no overlap between fragments of a read (few/no existing
aligners follow this standard).
\item {\sf RNEXT} and {\sf PNEXT} describes the relationship between
chimera, where appropriate.
\end{enumerate}
\end{enumerate}

\end{document}

0 comments on commit b351164

Please sign in to comment.