Merge pull request #456 from nschcolnicov/issue_366

Removed unused protocol argument and updated docs

conf/protocol_cats.config

@@ -3,5 +3,4 @@ params{
     clip_r1 = 3
     three_prime_clip_r1 = 0
     three_prime_adapter = "AAAAAAAA"
-    protocol = 'cats'
 }

conf/protocol_illumina.config

@@ -3,5 +3,4 @@ params{
     clip_r1 = 0
     three_prime_clip_r1 = 0
     three_prime_adapter = "TGGAATTCTCGGGTGCCAAGG"
-    protocol = 'illumina'
 }

conf/protocol_nextflex.config

@@ -3,5 +3,4 @@ params{
     clip_r1 = 4
     three_prime_clip_r1 = 4
     three_prime_adapter = "TGGAATTCTCGGGTGCCAAGG"
-    protocol = 'nextflex'
 }

conf/protocol_qiaseq.config

@@ -3,5 +3,4 @@ params{
     clip_r1 = 0
     three_prime_clip_r1 = 0
     three_prime_adapter = "AACTGTAGGCACCATCAAT"
-    protocol = 'qiaseq'
 }

conf/test_full_filter_contamination.config

@@ -18,12 +18,13 @@ params {
     genome               = 'GRCh37'
     input                = 'https://github.com/nf-core/test-datasets/raw/smrnaseq/samplesheet/v2.0/samplesheet-full.csv'
     mirtrace_species     = 'hsa'
-    protocol             = 'qiaseq'
     three_prime_adapter  = 'auto-detect'
     filter_contamination = true
     cdna                 = "https://huggingface.co/datasets/nf-core/smrnaseq/resolve/main/GRCh37/Homo_sapiens.GRCh37.cdna.all.fa"
     ncrna                = "https://huggingface.co/datasets/nf-core/smrnaseq/resolve/main/GRCh37/Homo_sapiens.GRCh37.ncrna.fa"
     trna                 = "https://huggingface.co/datasets/nf-core/smrnaseq/resolve/main/GRCh37/hg19-tRNAs.fa"
 }
 
+includeConfig 'protocol_qiaseq.config'
+
 

conf/test_skipfastp.config

@@ -31,5 +31,3 @@ params {
     skip_fastp               = true
     save_intermediates       = true
 }
-
-// Do not include any additional config so it defaults to protocol custom

docs/usage.md

@@ -10,10 +10,10 @@
 
 This option indicates the experimental protocol used for the sample preparation. Currently supporting:
 
-- 'illumina': adapter (`TGGAATTCTCGGGTGCCAAGG`)
-- 'nextflex': adapter (`TGGAATTCTCGGGTGCCAAGG`), clip_r1 (`4`), three_prime_clip_r1 (`4`)
-- 'qiaseq': adapter (`AACTGTAGGCACCATCAAT`)
-- 'cats': adapter (`GATCGGAAGAGCACACGTCTG`), clip_r1(`3)
+- 'illumina': three_prime_adapter (`TGGAATTCTCGGGTGCCAAGG`), clip_r1 (`0`), three_prime_clip_r1 (`0`)
+- 'nextflex': three_prime_adapter (`TGGAATTCTCGGGTGCCAAGG`), clip_r1 (`4`), three_prime_clip_r1 (`4`)
+- 'qiaseq': three_prime_adapter (`AACTGTAGGCACCATCAAT`), clip_r1 (`0`), three_prime_clip_r1 (`0`)
+- 'cats': three_prime_adapter (`AAAAAAAA`), clip_r1(`3`), three_prime_clip_r1 (`0`)
 
 This option is not chosen as a parameter but as an additional profile that sets the corresponding `three_prime_adapter`, `clip_r1` and `three_prime_clip_r1` parameters accordingly. You can choose to either use any of the provided profiles by running the pipeline with e.g. `illumina` to set the defaults as described above in a more convenient way.
 

nextflow.config

@@ -12,9 +12,6 @@ params {
     // Input options
     input                       = null
 
-    // Protocol default (override via config profile - NOT directly via parameter!)
-    protocol                    = "custom"
-
     // References
     genome                      = null
     igenomes_base               = 's3://ngi-igenomes/igenomes'
@@ -45,7 +42,7 @@ params {
     // Trimming options
     clip_r1                     = null
     three_prime_clip_r1         = null
-    three_prime_adapter         = 'AGATCGGAAGAGCACACGTCTGAACTCCAGTCA'
+    three_prime_adapter         = 'AGATCGGAAGAGCACACGTCTGAACTCCAGTCA' //is set to the Illumina TruSeq single index adapter sequence to ensure that the auto-detect functionality of FASTP is disabled.
     trim_fastq                  = true
     fastp_min_length            = 17
     fastp_known_mirna_adapters  = "$projectDir/assets/known_adapters.fa"

nextflow_schema.json

@@ -41,13 +41,6 @@
                     "description": "MultiQC report title. Printed as page header, used for filename if not otherwise specified.",
                     "fa_icon": "fas fa-file-signature"
                 },
-                "protocol": {
-                    "type": "string",
-                    "description": "Indicates the experimental protocol used for sample preparation, used by miRTrace",
-                    "default": "custom",
-                    "fa_icon": "fas fa-atom",
-                    "enum": ["custom", "illumina", "nextflex", "qiaseq", "cats"]
-                },
                 "save_intermediates": {
                     "type": "boolean",
                     "description": "Save all intermediate files (e.g. fastq, bams) to output directory",