Schema docs and changelog for --protocol custom

See also nf-core#41 and nf-core#42
ewels · Nov 7, 2020 · 6190c23 · 6190c23
1 parent b75c229
commit 6190c23
Show file tree

Hide file tree

Showing 2 changed files with 3 additions and 2 deletions.
diff --git a/CHANGELOG.md b/CHANGELOG.md
@@ -16,6 +16,7 @@ and this project adheres to [Semantic Versioning](https://semver.org/spec/v2.0.0
 * Move all parameter documentation into new `nextflow_schema.json` file.
 * Update with the latest `TEMPLATE` version for nf-core `v1.11`
 * Update conda environment with new packages and updates
+* Added `--protocol custom` to allow custom adapter trimming modes [[#41]](https://github.com/nf-core/smrnaseq/issues/41)]
 
 ### Packaged software updates
 

diff --git a/nextflow_schema.json b/nextflow_schema.json
@@ -25,7 +25,7 @@
                     "default": "illumina",
                     "fa_icon": "fas fa-vial",
                     "description": "Protocol for constructing smRNA-seq libraries.",
-                    "help_text": "Presets for trimming parameters and 3' adapter sequence with a specified protocol.\n\n| Protocol      | Library Prep Kit                        | Trimming Parameter                      | 3' Adapter Sequence   |\n| :------------ | :-------------------------------------- | :-------------------------------------- | :-------------------  |\n| illumina      | Illumina TruSeq Small RNA               | `clip_r1 = 0` `three_prime_clip_r1 = 0` | `TGGAATTCTCGGGTGCCAAGG` |\n| nextflex      | BIOO SCIENTIFIC  NEXTFLEX Small RNA-Seq | `clip_r1 = 4` `three_prime_clip_r1 = 4` | `TGGAATTCTCGGGTGCCAAGG` |\n| qiaseq        | QIAGEN QIAseq miRNA                     | `clip_r1 = 0` `three_prime_clip_r1 = 0` | `AACTGTAGGCACCATCAAT`   |\n| cats          | Diagenode CATS Small RNA-seq            | `clip_r1 = 3` `three_prime_clip_r1 = 0` | `AAAAAAAAAAA` + `GATCGGAAGAGCACACGTCTG` (only polyA is used for trimming) |",
+                    "help_text": "Presets for trimming parameters and 3' adapter sequence with a specified protocol.\n\n| Protocol      | Library Prep Kit                        | Trimming Parameter                      | 3' Adapter Sequence     |\n| :------------ | :-------------------------------------- | :-------------------------------------- | :---------------------  |\n| illumina      | Illumina TruSeq Small RNA               | `clip_r1 = 0` `three_prime_clip_r1 = 0` | `TGGAATTCTCGGGTGCCAAGG` |\n| nextflex      | BIOO SCIENTIFIC  NEXTFLEX Small RNA-Seq | `clip_r1 = 4` `three_prime_clip_r1 = 4` | `TGGAATTCTCGGGTGCCAAGG` |\n| qiaseq        | QIAGEN QIAseq miRNA                     | `clip_r1 = 0` `three_prime_clip_r1 = 0` | `AACTGTAGGCACCATCAAT`   |\n| cats          | Diagenode CATS Small RNA-seq            | `clip_r1 = 3` `three_prime_clip_r1 = 0` | `AAAAAAAAAAA` + `GATCGGAAGAGCACACGTCTG` (only polyA is used for trimming) |\n| custom        | user defined                            | user defined                            | user defined            |\n\n> NB: When running `--protocol custom` the user ***must define the 3' Adapter Sequence***.\n> If trimming parameters aren't provided the pipeline will deafult to `clip_R1 = 0` and `three_prime_clip_R1 = 0` (i.e. no extra clipping).",
                     "enum": [
                         "illumina",
                         "nextflex",
@@ -367,4 +367,4 @@
             "$ref": "#/definitions/institutional_config_options"
         }
     ]
-}
+}