Fixes #15 Handling 3-field fields in SAM header

betteridiot · Sep 6, 2018 · 91630a0 · 91630a0
1 parent 8cb9074
commit 91630a0
Show file tree

Hide file tree

Showing 5 changed files with 119 additions and 89 deletions.
diff --git a/README.rst b/README.rst
@@ -1,15 +1,15 @@
-`Build Status <https://travis-ci.org/betteridiot/bamnostic>`__
-`noarch <https://circleci.com/gh/conda-forge/bamnostic-feedstock>`__
-`Documentation
-Status <https://bamnostic.readthedocs.io/en/latest/?badge=latest>`__
-`Conda Version <https://anaconda.org/conda-forge/bamnostic>`__ `PyPI
-version <https://badge.fury.io/py/bamnostic>`__
-`Maintainability <https://codeclimate.com/github/betteridiot/bamnostic/maintainability>`__
-
-`status <http://joss.theoj.org/papers/9952b35bbb30ca6c01e6a27b80006bd8>`__
-`DOI <https://doi.org/10.5281/zenodo.1341959>`__
-`License <https://github.com/betteridiot/bamnostic/blob/master/LICENSE>`__
-`Conda Downloads <https://anaconda.org/conda-forge/bamnostic>`__
+|Build Status| |noarch| |Documentation Status| |Conda Version| |PyPI
+version| |Maintainability|
+
+|status| |DOI| |License|
+
++---------+---------------------+
+| Host    | Downloads           |
++=========+=====================+
+| PyPI    | |Downloads|         |
++---------+---------------------+
+| conda   | |Conda Downloads|   |
++---------+---------------------+
 
 BAMnostic
 =========
@@ -37,44 +37,44 @@ Through the ``conda`` package manager (`Anaconda Cloud <https://anaconda.org/con
 
 .. code:: bash
 
-   # first, add the conda-forge channel to your conda build
-   conda config --add channels conda-forge
+    # first, add the conda-forge channel to your conda build
+    conda config --add channels conda-forge
 
-   # now bamnostic is available for install
-   conda install bamnostic
+    # now bamnostic is available for install
+    conda install bamnostic
 
 Through the Python Package Index (`PyPI <https://pypi.org/>`__)
 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
 
 .. code:: bash
 
-   pip install bamnostic
+    pip install bamnostic
 
-   # or, if you don't have superuser access
-   pip install --user bamnostic
+    # or, if you don't have superuser access
+    pip install --user bamnostic
 
 Through pip+Github
 ~~~~~~~~~~~~~~~~~~
 
 .. code:: bash
 
-   # again, use --user if you don't have superuser access
-   pip install -e git+https://github.com/betteridiot/bamnostic.git
+    # again, use --user if you don't have superuser access
+    pip install -e git+https://github.com/betteridiot/bamnostic.git
 
-   # or, if you don't have superuser access
-   pip install --user -e git+https://github.com/betteridiot/bamnostic.git
+    # or, if you don't have superuser access
+    pip install --user -e git+https://github.com/betteridiot/bamnostic.git
 
 Traditional GitHub clone
 ~~~~~~~~~~~~~~~~~~~~~~~~
 
 .. code:: bash
 
-   git clone https://github.com/betteridiot/bamnostic.git
-   cd bamnostic
-   pip install -e .
+    git clone https://github.com/betteridiot/bamnostic.git
+    cd bamnostic
+    pip install -e .
 
-   # or, if you don't have superuser access
-   pip install --user -e .
+    # or, if you don't have superuser access
+    pip install --user -e .
 
 --------------
 
@@ -89,7 +89,7 @@ Importing
 
 .. code:: python
 
-   >>> import bamnostic as bs
+    >>> import bamnostic as bs
 
 Loading your BAM file (Note: CRAM and CSI formats are not supported at this time)
 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
@@ -103,7 +103,7 @@ within the package.
 
 .. code:: python
 
-   >>> bam = bs.AlignmentFile(bs.example_bam, 'rb')
+    >>> bam = bs.AlignmentFile(bs.example_bam, 'rb')
 
 Get the header
 ~~~~~~~~~~~~~~
@@ -115,65 +115,65 @@ length tuple values.
 
 .. code:: python
 
-   >>> bam.header
-   {0: ('chr1', 1575), 1: ('chr2', 1584)}
+    >>> bam.header
+    {0: ('chr1', 1575), 1: ('chr2', 1584)}
 
 Data validation through ``head()``
 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
 
 .. code:: python
 
-   >>>bam.head(n=2)
-   [EAS56_57:6:190:289:82  69  chr1    100 0   *   =   100 0   CTCAAGGTTGTTGCAAGGGGGTCTATGTGAACAAA <<<7<<<;<<<<<<<<8;;<7;4<;<;;;;;94<; MF:C:192,
-    EAS56_57:6:190:289:82  137 chr1    100 73  35M =   100 0   AGGGGTGCAGAGCCGAGTCACGGGGTTGCCAGCAC <<<<<<;<<<<<<<<<<;<<;<<<<;8<6;9;;2; MF:C:64 Aq:C:0  NM:C:0  UQ:C:0  H0:C:1  H1:C:0]
+    >>>bam.head(n=2)
+    [EAS56_57:6:190:289:82  69  chr1    100 0   *   =   100 0   CTCAAGGTTGTTGCAAGGGGGTCTATGTGAACAAA <<<7<<<;<<<<<<<<8;;<7;4<;<;;;;;94<; MF:C:192,
+     EAS56_57:6:190:289:82  137 chr1    100 73  35M =   100 0   AGGGGTGCAGAGCCGAGTCACGGGGTTGCCAGCAC <<<<<<;<<<<<<<<<<;<<;<<<<;8<6;9;;2; MF:C:64 Aq:C:0  NM:C:0  UQ:C:0  H0:C:1  H1:C:0]
 
 Getting the first read
 ~~~~~~~~~~~~~~~~~~~~~~
 
 .. code:: python
 
-   >>> first_read = next(bam)
-   >>> print(first_read)
-   EAS56_57:6:190:289:82   69  chr1    100 0   *   =   100 0   CTCAAGGTTGTTGCAAGGGGGTCTATGTGAACAAA <<<7<<<;<<<<<<<<8;;<7;4<;<;;;;;94<; MF:C:192
+    >>> first_read = next(bam)
+    >>> print(first_read)
+    EAS56_57:6:190:289:82   69  chr1    100 0   *   =   100 0   CTCAAGGTTGTTGCAAGGGGGTCTATGTGAACAAA <<<7<<<;<<<<<<<<8;;<7;4<;<;;;;;94<; MF:C:192
 
 Exploring the read
 ~~~~~~~~~~~~~~~~~~
 
 .. code:: python
 
-   # read name
-   >>> print(first_read.read_name)
-   EAS56_57:6:190:289:82
+    # read name
+    >>> print(first_read.read_name)
+    EAS56_57:6:190:289:82
 
-   # 0-based position
-   >>> print(first_read.pos)
-   99
+    # 0-based position
+    >>> print(first_read.pos)
+    99
 
-   # nucleotide sequence
-   >>> print(first_read.seq)
-   CTCAAGGTTGTTGCAAGGGGGTCTATGTGAACAAA
+    # nucleotide sequence
+    >>> print(first_read.seq)
+    CTCAAGGTTGTTGCAAGGGGGTCTATGTGAACAAA
 
-   # Read FLAG
-   >>> print(first_read.flag)
-   69
+    # Read FLAG
+    >>> print(first_read.flag)
+    69
 
-   # decoded FLAG
-   >>> bs.utils.flag_decode(first_read.flag)
-   [(1, 'read paired'), (4, 'read unmapped'), (64, 'first in pair')]
+    # decoded FLAG
+    >>> bs.utils.flag_decode(first_read.flag)
+    [(1, 'read paired'), (4, 'read unmapped'), (64, 'first in pair')]
 
 Random Access
 ~~~~~~~~~~~~~
 
 .. code:: python
 
-   >>> for i, read in enumerate(bam.fetch('chr2', 1, 100)):
-   ...    if i >= 3:
-   ...        break
-   ...    print(read)
+    >>> for i, read in enumerate(bam.fetch('chr2', 1, 100)):
+    ...    if i >= 3:
+    ...        break
+    ...    print(read)
 
-   B7_591:8:4:841:340  73  chr2    1   99  36M *   0   0   TTCAAATGAACTTCTGTAATTGAAAAATTCATTTAA    <<<<<<<<;<<<<<<<<;<<<<<;<;:<<<<<<<;;    MF:C:18 Aq:C:77 NM:C:0  UQ:C:0  H0:C:1  H1:C:0
-   EAS54_67:4:142:943:582  73  chr2    1   99  35M *   0   0   TTCAAATGAACTTCTGTAATTGAAAAATTCATTTA <<<<<<;<<<<<<:<<;<<<<;<<<;<<<:;<<<5 MF:C:18 Aq:C:41 NM:C:0  UQ:C:0  H0:C:1  H1:C:0
-   EAS54_67:6:43:859:229   153 chr2    1   66  35M *   0   0   TTCAAATGAACTTCTGTAATTGAAAAATTCATTTA +37<=<.;<<7.;77<5<<0<<<;<<<27<<<<<< MF:C:32 Aq:C:0  NM:C:0  UQ:C:0  H0:C:1  H1:C:0
+    B7_591:8:4:841:340  73  chr2    1   99  36M *   0   0   TTCAAATGAACTTCTGTAATTGAAAAATTCATTTAA    <<<<<<<<;<<<<<<<<;<<<<<;<;:<<<<<<<;;    MF:C:18 Aq:C:77 NM:C:0  UQ:C:0  H0:C:1  H1:C:0
+    EAS54_67:4:142:943:582  73  chr2    1   99  35M *   0   0   TTCAAATGAACTTCTGTAATTGAAAAATTCATTTA <<<<<<;<<<<<<:<<;<<<<;<<<;<<<:;<<<5 MF:C:18 Aq:C:41 NM:C:0  UQ:C:0  H0:C:1  H1:C:0
+    EAS54_67:6:43:859:229   153 chr2    1   66  35M *   0   0   TTCAAATGAACTTCTGTAATTGAAAAATTCATTTA +37<=<.;<<7.;77<5<<0<<<;<<<27<<<<<< MF:C:32 Aq:C:0  NM:C:0  UQ:C:0  H0:C:1  H1:C:0
 
 --------------
 
@@ -195,10 +195,10 @@ Format <https://en.wikipedia.org/wiki/FASTQ_format>`__):
 
 .. code:: bash
 
-   @SRR001666.1 071112_SLXA-EAS1_s_7:5:1:817:345 length=36
-   GGGTGATGGCCGCTGCCGATGGCGTCAAATCCCACC
-   +SRR001666.1 071112_SLXA-EAS1_s_7:5:1:817:345 length=36
-   IIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IG9IC
+    @SRR001666.1 071112_SLXA-EAS1_s_7:5:1:817:345 length=36
+    GGGTGATGGCCGCTGCCGATGGCGTCAAATCCCACC
+    +SRR001666.1 071112_SLXA-EAS1_s_7:5:1:817:345 length=36
+    IIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IG9IC
 
 Each entry details the read name, lenght, string representation, and
 quality of each aligned base along the read. ### SAM/BAM Format The data
@@ -214,18 +214,18 @@ format <https://samtools.github.io/hts-specs/SAMv1.pdf>`__):
 
 .. code:: bash
 
-   @HD VN:1.5 SO:coordinate
-   @SQ SN:ref LN:45
-   r001   99 ref  7 30 8M2I4M1D3M = 37  39 TTAGATAAAGGATACTG *
-   r002    0 ref  9 30 3S6M1P1I4M *  0   0 AAAAGATAAGGATA    *
-   r003    0 ref  9 30 5S6M       *  0   0 GCCTAAGCTAA       * SA:Z:ref,29,-,6H5M,17,0;
-   r004    0 ref 16 30 6M14N5M    *  0   0 ATAGCTTCAGC       *
-   r003 2064 ref 29 17 6H5M       *  0   0 TAGGC             * SA:Z:ref,9,+,5S6M,30,1;
-   r001  147 ref 37 30 9M         =  7 -39 CAGCGGCAT         * NM:i:1
+    @HD VN:1.5 SO:coordinate
+    @SQ SN:ref LN:45
+    r001   99 ref  7 30 8M2I4M1D3M = 37  39 TTAGATAAAGGATACTG *
+    r002    0 ref  9 30 3S6M1P1I4M *  0   0 AAAAGATAAGGATA    *
+    r003    0 ref  9 30 5S6M       *  0   0 GCCTAAGCTAA       * SA:Z:ref,29,-,6H5M,17,0;
+    r004    0 ref 16 30 6M14N5M    *  0   0 ATAGCTTCAGC       *
+    r003 2064 ref 29 17 6H5M       *  0   0 TAGGC             * SA:Z:ref,9,+,5S6M,30,1;
+    r001  147 ref 37 30 9M         =  7 -39 CAGCGGCAT         * NM:i:1
 
 There are many benefits to the SAM format: human-readable, each entry is
 contained to a single line (supporting simple stream analysis), concise
-description of the read’s quality and position, and a file header
+description of the read's quality and position, and a file header
 metadata that supports integrity and reproducibility. Additionally, a
 compressed form of the SAM format was designed in parallel. It is called
 the Binary Alignment Map
@@ -248,15 +248,15 @@ The BAI file, often produced via
 to be sorted prior to indexing. Using a modified R-tree binning
 strategy, each reference contig is divided into sequential,
 non-overlapping bins. That is a parent bin may contain numerous
-children, but none of the children bins overlap another’s assigned
+children, but none of the children bins overlap another's assigned
 interval. Each BAM entry is then assigned to the bin that fully contains
 it. A visual description of the binning strategy can be found
 `here <https://samtools.github.io/hts-specs/SAMv1.pdf>`__. Each bin is
 comprised of chunks, and each chunk contains its respective start and
 stop byte positions within the BAM file. In addition to the bin index, a
 linear index is produced as well. Again, the reference contig is divided
 into equally sized windows (covering ≈16Kbp/each). Along those windows,
-the start offset of the first read that **overlaps** that window is
+the start offset of the first read that ***overlaps*** that window is
 stored. Now, given a region of interest, the first bin that overlaps the
 region is looked up. The chunks in the bin are stored as *virtual
 offsets*. A virtual offset is a 64-bit unsigned integer that is
@@ -268,14 +268,14 @@ calculated by:
 
 .. code:: python
 
-   virtual_offset = coffset << 16 | uoffset
+    virtual_offset = coffset << 16 | uoffset
 
 Similarly, the complement of the above is as follows:
 
 .. code:: python
 
-   coffset = virtual_offset >> 16
-   uoffset = virtual_offset ^ (coffset << 16)
+    coffset = virtual_offset >> 16
+    uoffset = virtual_offset ^ (coffset << 16)
 
 A simple seek call against the BAM file will put the head at the start
 of your region of interest.
@@ -290,7 +290,7 @@ BAM files is to use the program known as
 `samtools <http://samtools.sourceforge.net/>`__. The maintainers of
 samtools have done a tremendous job of providing distributions that work
 on a multitude of operating systems. While samtools is powerful, as a
-command line interface, it is also limited in that it doesn’t really
+command line interface, it is also limited in that it doesn't really
 afford the ability to perform real-time dynamic processing of reads
 (without requiring many system calls to samtools). Due to its general
 nature and inherent readability, a package was written in Python called
@@ -301,10 +301,10 @@ However, the foundation of these tools is built on a C-API called
 compiled in a Windows environment. By extension, neither can pysam. In
 building a tool for genomic visualization, I wanted it to be platform
 agnostic. This is precisely when I found out that the tools I had
-planned to use as a backend did not work on Windows…the most prevalent
+planned to use as a backend did not work on Windows...the most prevalent
 operation system in the end-user world. So, I wrote **bamnostic**. As of
 this writing, bamnostic is OS-agnostic and written completely in Pure
-Python–requiring only the standard library (and ``pytest`` for the test
+Python--requiring only the standard library (and ``pytest`` for the test
 suite). Special care was taken to ensure that it would run on all
 versions of CPython 2.7 or greater. Additionally, it runs in both stable
 versions of PyPy. While it may perform slower than its C counterparts,
@@ -332,6 +332,31 @@ Community Guidelines:
 ---------------------
 
 Eagerly accepting PRs for improvements, optimizations, or features. For
-any questions or issues, please feel free to make a post to bamnostic’s
+any questions or issues, please feel free to make a post to bamnostic's
 `Issue tracker <https://github.com/betteridiot/bamnostic/issues>`__ on
-github.
+github or read over our
+`CONTRIBUTING <https://github.com/betteridiot/bamnostic/blob/master/CONTRIBUTING.md>`__
+documentation.
+
+.. |Build Status| image:: https://travis-ci.org/betteridiot/bamnostic.svg?branch=master
+   :target: https://travis-ci.org/betteridiot/bamnostic
+.. |noarch| image:: https://img.shields.io/circleci/project/github/conda-forge/bamnostic-feedstock/master.svg?label=noarch
+   :target: https://circleci.com/gh/conda-forge/bamnostic-feedstock
+.. |Documentation Status| image:: https://readthedocs.org/projects/bamnostic/badge/?version=latest
+   :target: https://bamnostic.readthedocs.io/en/latest/?badge=latest
+.. |Conda Version| image:: https://img.shields.io/conda/vn/conda-forge/bamnostic.svg
+   :target: https://anaconda.org/conda-forge/bamnostic
+.. |PyPI version| image:: https://badge.fury.io/py/bamnostic.svg
+   :target: https://badge.fury.io/py/bamnostic
+.. |Maintainability| image:: https://api.codeclimate.com/v1/badges/d7e36e72f109c598c86d/maintainability
+   :target: https://codeclimate.com/github/betteridiot/bamnostic/maintainability
+.. |status| image:: http://joss.theoj.org/papers/9952b35bbb30ca6c01e6a27b80006bd8/status.svg
+   :target: http://joss.theoj.org/papers/9952b35bbb30ca6c01e6a27b80006bd8
+.. |DOI| image:: https://zenodo.org/badge/DOI/10.5281/zenodo.1341959.svg
+   :target: https://doi.org/10.5281/zenodo.1341959
+.. |License| image:: https://img.shields.io/badge/License-BSD%203--Clause-blue.svg
+   :target: https://github.com/betteridiot/bamnostic/blob/master/LICENSE
+.. |Downloads| image:: http://pepy.tech/badge/bamnostic
+   :target: http://pepy.tech/project/bamnostic
+.. |Conda Downloads| image:: https://img.shields.io/conda/dn/conda-forge/bamnostic.svg
+   :target: https://anaconda.org/conda-forge/bamnostic
diff --git a/bamnostic/bgzf.py b/bamnostic/bgzf.py
@@ -308,7 +308,12 @@ def __init__(self, _io):
                     key = key[1:]
                     fields_dict = {}
                     for field in fields:
-                        tag, value = field.split(':')
+                        split_field = field.split(:)
+                        if len(split_field) > 2:
+                            tag = split_field[0]
+                            value = split_field[2]
+                        else:
+                            tag, value = split_field
                         try:
                             value = int(value)
                         except ValueError:

diff --git a/codemeta.json b/codemeta.json
@@ -37,8 +37,8 @@
   "description": "BAMnostic is a Pure Python OS, version, and runtime agnostic BAM file parser",
   "keywords": "BAM, pysam, genomics, genetics, htslib, samtools",
   "license": "https://github.com/betteridiot/bamnostic/blob/master/LICENSE",
-  "softwareVersion": "v0.8.11",
-  "version": "v0.8.2",
+  "softwareVersion": "v0.8.12",
+  "version": "v0.8.12",
   "readme": "https://github.com/betteridiot/bamnostic/blob/master/README.md",
   "buildInstructions": "https://github.com/betteridiot/bamnostic/blob/master/README.md",
   "issueTracker": "https://github.com/betteridiot/bamnostic/issues",

diff --git a/docs/paper/codemeta.json b/docs/paper/codemeta.json
@@ -37,8 +37,8 @@
   "description": "BAMnostic: an OS-agnostic toolkit for genomic sequence analysis",
   "keywords": "BAM, pysam, genomics, genetics, htslib, samtools",
   "license": "https://github.com/betteridiot/bamnostic/blob/master/LICENSE",
-  "softwareVersion": "v0.8.11",
-  "version": "v0.8.2",
+  "softwareVersion": "v0.8.12",
+  "version": "v0.8.12",
   "readme": "https://github.com/betteridiot/bamnostic/blob/master/README.md",
   "buildInstructions": "https://github.com/betteridiot/bamnostic/blob/master/README.md",
   "issueTracker": "https://github.com/betteridiot/bamnostic/issues",

diff --git a/setup.py b/setup.py
@@ -9,7 +9,7 @@ def readme():
 
 setup(
     name='bamnostic',
-    version='0.8.11',
+    version='0.8.12',
     description='Pure Python, OS-agnostic Binary Alignment Map (BAM) random access and parsing tool',
     long_description=readme(),
     url='https://github.com/betteridiot/bamnostic/',