Add the support of the LCS command

src/commands/cmd_string.cc

@@ -26,6 +26,7 @@
 #include "commands/command_parser.h"
 #include "error_constants.h"
 #include "server/redis_reply.h"
+#include "server/redis_request.h"
 #include "server/server.h"
 #include "storage/redis_db.h"
 #include "time_util.h"
@@ -620,6 +621,201 @@ class CommandCAD : public Commander {
   }
 };
 
+class CommandLCS : public Commander {
+ public:
+  Status Parse(const std::vector<std::string> &args) override {
+    CommandParser parser(args, 3);
+    while (parser.Good()) {
+      if (parser.EatEqICase("IDX")) {
+        get_idx_ = true;
+      } else if (parser.EatEqICase("LEN")) {
+        get_len_ = true;
+      } else if (parser.EatEqICase("WITHMATCHLEN")) {
+        with_match_len_ = true;
+      } else if (parser.EatEqICase("MINMATCHLEN")) {
+        min_match_len_ = GET_OR_RET(parser.TakeInt<int64_t>());
+        if (min_match_len_ < 0) {
+          min_match_len_ = 0;
+        }
+      } else {
+        return parser.InvalidSyntax();
+      }
+    }
+
+    // Complain if the user passed ambiguous parameters.
+    if (get_idx_ && get_len_) {
+      return {Status::RedisParseErr,
+              "If you want both the length and indexes, "
+              "please just use IDX."};
+    }
+
+    return Status::OK();
+  }
+
+  Status Execute(Server *srv, Connection *conn, std::string *output) override {
+    redis::String string_db(srv->storage, conn->GetNamespace());
+
+    std::string a;
+    std::string b;
+    auto s1 = string_db.Get(args_[1], &a);
+    auto s2 = string_db.Get(args_[2], &b);
+
+    if (!s1.ok() && !s1.IsNotFound()) {
+      return {Status::RedisExecErr, s1.ToString()};
+    }
+    if (!s2.ok() && !s2.IsNotFound()) {
+      return {Status::RedisExecErr, s2.ToString()};
+    }
+    if (s1.IsNotFound()) a = "";
+    if (s2.IsNotFound()) b = "";
+
+    // Detect string truncation or later overflows.
+    if (a.length() >= UINT32_MAX - 1 || b.length() >= UINT32_MAX - 1) {
+      return {Status::RedisExecErr, "String too long for LCS"};
+    }
+
+    // Compute the LCS using the vanilla dynamic programming technique of
+    // building a table of LCS(x, y) substrings.
+    auto alen = static_cast<uint32_t>(a.length());
+    auto blen = static_cast<uint32_t>(b.length());
+
+    // Allocate the LCS table.
+    uint64_t dp_size = (alen + 1) * (blen + 1);
+    uint64_t bulk_size = dp_size * sizeof(uint32_t);
+    if (bulk_size >= SIZE_MAX || bulk_size / dp_size != sizeof(uint32_t)) {
+      return {Status::RedisExecErr, "Insufficient memory, failed allocating transient memory for LCS"};
+    }
+    if (bulk_size > PROTO_BULK_MAX_SIZE) {
+      return {Status::RedisExecErr, "Insufficient memory, transient memory for LCS exceeds proto-max-bulk-len"};
+    }
+    std::vector<uint32_t> dp(dp_size, 0);
+    auto lcs = [&](const uint32_t i, const uint32_t j) -> uint32_t & { return dp[i * (blen + 1) + j]; };
+
+    // Start building the LCS table.
+    for (uint32_t i = 1; i <= alen; i++) {
+      for (uint32_t j = 1; j <= blen; j++) {
+        if (a[i - 1] == b[j - 1]) {
+          // The len LCS (and the LCS itself) of two
+          // sequences with the same final character, is the
+          // LCS of the two sequences without the last char
+          // plus that last char.
+          lcs(i, j) = lcs(i - 1, j - 1) + 1;
+        } else {
+          // If the last character is different, take the longest
+          // between the LCS of the first string and the second
+          // minus the last char, and the reverse.
+          lcs(i, j) = std::max(lcs(i - 1, j), lcs(i, j - 1));
+        }
+      }
+    }
+
+    // Store the actual LCS string if needed.
+    std::string result;
+    uint32_t idx = lcs(alen, blen);
+
+    // Allocate when we need to compute the actual LCS string.
+    bool compute_lcs = get_idx_ || !get_len_;
+    if (compute_lcs) result.resize(idx);
+
+    // Build a array if we have to emit the matched ranges.
+    std::string matches;
+    uint32_t matches_len = 0;
+
+    uint32_t i = alen;
+    uint32_t j = blen;
+    uint32_t arange_start = alen;  // alen signals that values are not set.
+    uint32_t arange_end = 0;
+    uint32_t brange_start = 0;
+    uint32_t brange_end = 0;
+    while (compute_lcs && i > 0 && j > 0) {
+      bool emit_range = false;
+      if (a[i - 1] == b[j - 1]) {
+        // If there is a match, store the character and reduce
+        // the indexes to look for a new match.
+        result.at(idx - 1) = a[i - 1];
+
+        // Track the current range.
+        if (arange_start == alen) {
+          arange_start = i - 1;
+          arange_end = i - 1;
+          brange_start = j - 1;
+          brange_end = j - 1;
+        }
+        // Let's see if we can extend the range backward since
+        // it is contiguous.
+        else if (arange_start == i && brange_start == j) {
+          arange_start--;
+          brange_start--;
+        } else {
+          emit_range = true;
+        }
+
+        // Emit the range if we matched with the first byte of
+        // one of the two strings. We'll exit the loop ASAP.
+        if (arange_start == 0 || brange_start == 0) {
+          emit_range = true;
+        }
+        idx--;
+        i--;
+        j--;
+      } else {
+        // Otherwise reduce i and j depending on the largest
+        // LCS between, to understand what direction we need to go.
+        uint32_t lcs1 = lcs(i - 1, j);
+        uint32_t lcs2 = lcs(i, j - 1);
+        if (lcs1 > lcs2)
+          i--;
+        else
+          j--;
+        if (arange_start != alen) emit_range = true;
+      }
+
+      // Emit the current range if needed.
+      uint32_t match_len = arange_end - arange_start + 1;
+      if (emit_range) {
+        if (get_idx_ && (min_match_len_ == 0 || match_len >= min_match_len_)) {
+          matches += redis::MultiLen(with_match_len_ ? 3 : 2);
+          matches += redis::MultiLen(2);
+          matches += redis::Integer(arange_start);
+          matches += redis::Integer(arange_end);
+          matches += redis::MultiLen(2);
+          matches += redis::Integer(brange_start);
+          matches += redis::Integer(brange_end);
+          if (with_match_len_) {
+            matches += redis::Integer(match_len);
+          }
+          matches_len++;
+        }
+
+        // Restart at the next match.
+        arange_start = alen;
+      }
+    }
+
+    // Build output by the given options.
+    if (get_idx_) {
+      *output = conn->HeaderOfMap(2);
+      *output += redis::BulkString("matches");
+      *output += redis::MultiLen(matches_len);
+      *output += matches;
+      *output += redis::BulkString("len");
+      *output += redis::Integer(lcs(alen, blen));
+    } else if (get_len_) {
+      *output = redis::Integer(lcs(alen, blen));
+    } else {
+      *output = redis::BulkString(result);
+    }
+
+    return Status::OK();
+  }
+
+ private:
+  bool get_idx_ = false;
+  bool get_len_ = false;
+  bool with_match_len_ = false;
+  int64_t min_match_len_ = 0;
+};
+
 REDIS_REGISTER_COMMANDS(
     MakeCmdAttr<CommandGet>("get", 2, "read-only", 1, 1, 1), MakeCmdAttr<CommandGetEx>("getex", -2, "write", 1, 1, 1),
     MakeCmdAttr<CommandStrlen>("strlen", 2, "read-only", 1, 1, 1),
@@ -637,6 +833,5 @@ REDIS_REGISTER_COMMANDS(
     MakeCmdAttr<CommandIncrByFloat>("incrbyfloat", 3, "write", 1, 1, 1),
     MakeCmdAttr<CommandIncr>("incr", 2, "write", 1, 1, 1), MakeCmdAttr<CommandDecrBy>("decrby", 3, "write", 1, 1, 1),
     MakeCmdAttr<CommandDecr>("decr", 2, "write", 1, 1, 1), MakeCmdAttr<CommandCAS>("cas", -4, "write", 1, 1, 1),
-    MakeCmdAttr<CommandCAD>("cad", 3, "write", 1, 1, 1), )
-
+    MakeCmdAttr<CommandCAD>("cad", 3, "write", 1, 1, 1), MakeCmdAttr<CommandLCS>("lcs", -3, "read-only", 1, 2, 1), )
 }  // namespace redis

src/server/redis_request.cc

@@ -36,10 +36,6 @@
 
 namespace redis {
 
-const size_t PROTO_INLINE_MAX_SIZE = 16 * 1024L;
-const size_t PROTO_BULK_MAX_SIZE = 512 * 1024L * 1024L;
-const size_t PROTO_MULTI_MAX_SIZE = 1024 * 1024L;
-
 Status Request::Tokenize(evbuffer *input) {
   size_t pipeline_size = 0;
 

src/server/redis_request.h

@@ -32,6 +32,10 @@ class Server;
 
 namespace redis {
 
+const size_t PROTO_INLINE_MAX_SIZE = 16 * 1024L;
+const size_t PROTO_BULK_MAX_SIZE = 512 * 1024L * 1024L;
+const size_t PROTO_MULTI_MAX_SIZE = 1024 * 1024L;
+
 using CommandTokens = std::vector<std::string>;
 
 class Connection;

tests/gocase/unit/type/strings/strings_test.go

@@ -895,4 +895,108 @@ func TestString(t *testing.T) {
 		require.ErrorContains(t, rdb.Do(ctx, "CAD", "cad_key").Err(), "ERR wrong number of arguments")
 		require.ErrorContains(t, rdb.Do(ctx, "CAD", "cad_key", "123", "234").Err(), "ERR wrong number of arguments")
 	})
+
+	rna1 := "CACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTTCTCTAAACGAACTTTAAAATCTGTGTGGCTGTCACTCGGCTGCATGCTTAGTGCACTCACGCAGTATAATTAATAACTAATTACTGTCGTTGACAGGACACGAGTAACTCGTCTATCTTCTGCAGGCTGCTTACGGTTTCGTCCGTGTTGCAGCCGATCATCAGCACATCTAGGTTTCGTCCGGGTGTG"
+	rna2 := "ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTTCTCTAAACGAACTTTAAAATCTGTGTGGCTGTCACTCGGCTGCATGCTTAGTGCACTCACGCAGTATAATTAATAACTAATTACTGTCGTTGACAGGACACGAGTAACTCGTCTATCTTCTGCAGGCTGCTTACGGTTTCGTCCGTGTTGCAGCCGATCATCAGCACATCTAGGTTT"
+	rnalcs := "ACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTTCTCTAAACGAACTTTAAAATCTGTGTGGCTGTCACTCGGCTGCATGCTTAGTGCACTCACGCAGTATAATTAATAACTAATTACTGTCGTTGACAGGACACGAGTAACTCGTCTATCTTCTGCAGGCTGCTTACGGTTTCGTCCGTGTTGCAGCCGATCATCAGCACATCTAGGTTT"
+
+	t.Run("LCS basic", func(t *testing.T) {
+		require.NoError(t, rdb.Set(ctx, "virus1", rna1, 0).Err())
+		require.NoError(t, rdb.Set(ctx, "virus2", rna2, 0).Err())
+		require.Equal(t, rnalcs, rdb.LCS(ctx, &redis.LCSQuery{Key1: "virus1", Key2: "virus2"}).Val().MatchString)
+	})
+
+	t.Run("LCS len", func(t *testing.T) {
+		require.NoError(t, rdb.Set(ctx, "virus1", rna1, 0).Err())
+		require.NoError(t, rdb.Set(ctx, "virus2", rna2, 0).Err())
+		require.Equal(t, int64(len(rnalcs)), rdb.LCS(ctx, &redis.LCSQuery{Key1: "virus1", Key2: "virus2", Len: true}).Val().Len)
+	})
+
+	t.Run("LCS indexes", func(t *testing.T) {
+		require.NoError(t, rdb.Set(ctx, "virus1", rna1, 0).Err())
+		require.NoError(t, rdb.Set(ctx, "virus2", rna2, 0).Err())
+		matches := rdb.LCS(ctx, &redis.LCSQuery{Key1: "virus1", Key2: "virus2", Idx: true}).Val().Matches
+		require.Equal(t, []redis.LCSMatchedPosition{
+			{
+				Key1: redis.LCSPosition{Start: 238, End: 238},
+				Key2: redis.LCSPosition{Start: 239, End: 239},
+			},
+			{
+				Key1: redis.LCSPosition{Start: 236, End: 236},
+				Key2: redis.LCSPosition{Start: 238, End: 238},
+			},
+			{
+				Key1: redis.LCSPosition{Start: 229, End: 230},
+				Key2: redis.LCSPosition{Start: 236, End: 237},
+			},
+			{
+				Key1: redis.LCSPosition{Start: 224, End: 224},
+				Key2: redis.LCSPosition{Start: 235, End: 235},
+			},
+			{
+				Key1: redis.LCSPosition{Start: 1, End: 222},
+				Key2: redis.LCSPosition{Start: 13, End: 234},
+			},
+		}, matches)
+	})
+
+	t.Run("LCS indexes with match len", func(t *testing.T) {
+		require.NoError(t, rdb.Set(ctx, "virus1", rna1, 0).Err())
+		require.NoError(t, rdb.Set(ctx, "virus2", rna2, 0).Err())
+		matches := rdb.LCS(ctx, &redis.LCSQuery{Key1: "virus1", Key2: "virus2", Idx: true, WithMatchLen: true}).Val().Matches
+		require.Equal(t, []redis.LCSMatchedPosition{
+			{
+				Key1:     redis.LCSPosition{Start: 238, End: 238},
+				Key2:     redis.LCSPosition{Start: 239, End: 239},
+				MatchLen: 1,
+			},
+			{
+				Key1:     redis.LCSPosition{Start: 236, End: 236},
+				Key2:     redis.LCSPosition{Start: 238, End: 238},
+				MatchLen: 1,
+			},
+			{
+				Key1:     redis.LCSPosition{Start: 229, End: 230},
+				Key2:     redis.LCSPosition{Start: 236, End: 237},
+				MatchLen: 2,
+			},
+			{
+				Key1:     redis.LCSPosition{Start: 224, End: 224},
+				Key2:     redis.LCSPosition{Start: 235, End: 235},
+				MatchLen: 1,
+			},
+			{
+				Key1:     redis.LCSPosition{Start: 1, End: 222},
+				Key2:     redis.LCSPosition{Start: 13, End: 234},
+				MatchLen: 222,
+			},
+		}, matches)
+	})
+
+	t.Run("LCS indexes with match len and minimum match len", func(t *testing.T) {
+		require.NoError(t, rdb.Set(ctx, "virus1", rna1, 0).Err())
+		require.NoError(t, rdb.Set(ctx, "virus2", rna2, 0).Err())
+		matches := rdb.LCS(ctx, &redis.LCSQuery{Key1: "virus1", Key2: "virus2", Idx: true, WithMatchLen: true, MinMatchLen: 5}).Val().Matches
+		require.Equal(t, []redis.LCSMatchedPosition{
+			{
+				Key1:     redis.LCSPosition{Start: 1, End: 222},
+				Key2:     redis.LCSPosition{Start: 13, End: 234},
+				MatchLen: 222,
+			},
+		}, matches)
+	})
+
+	t.Run("LCS empty", func(t *testing.T) {
+		require.NoError(t, rdb.Set(ctx, "virus1", rna1, 0).Err())
+		require.NoError(t, rdb.Set(ctx, "virus2", "", 0).Err())
+
+		require.Equal(t, rna1, rdb.LCS(ctx, &redis.LCSQuery{Key1: "virus1", Key2: "virus1"}).Val().MatchString)
+		require.Equal(t, "", rdb.LCS(ctx, &redis.LCSQuery{Key1: "virus1", Key2: "virus2"}).Val().MatchString)
+		require.Equal(t, "", rdb.LCS(ctx, &redis.LCSQuery{Key1: "virus2", Key2: "virus1"}).Val().MatchString)
+		require.Equal(t, "", rdb.LCS(ctx, &redis.LCSQuery{Key1: "virus2", Key2: "virus2"}).Val().MatchString)
+
+		require.Equal(t, int64(0), rdb.LCS(ctx, &redis.LCSQuery{Key1: "virus1", Key2: "virus2"}).Val().Len)
+		require.Equal(t, []redis.LCSMatchedPosition{}, rdb.LCS(ctx, &redis.LCSQuery{Key1: "virus1", Key2: "virus2", Idx: true}).Val().Matches)
+		require.Equal(t, []redis.LCSMatchedPosition{}, rdb.LCS(ctx, &redis.LCSQuery{Key1: "virus1", Key2: "virus2", Idx: true, WithMatchLen: true}).Val().Matches)
+	})
 }