Error while running test command

[amoltej]

Hi I am new to Nextflow and smrnaseq.
After installing docker and nextflow, I tried to run the test command

nextflow run nf-core/smrnaseq \ -profile test,docker \ --outdir <OUTDIR>

However I am getting follwoing error, can you please help me understand and resolve it?
Thanks
Amol

nf-core/smrnaseq 2.4.0

Input/output options
input : https://github.com/nf-core/test-datasets/raw/smrnaseq/samplesheet/v2.0/samplesheet.csv
outdir : /home/gho016/volume/work/nfcode_test/smrnaseq

Reference genome options
mirtrace_species : hsa
fasta : https://github.com/nf-core/test-datasets/raw/smrnaseq/reference/genome.fa
bowtie_index : https://github.com/nf-core/test-datasets/raw/smrnaseq/reference/bowtie_index.tar.gz

Trimming options
clip_r1 : 0
three_prime_clip_r1 : 0
three_prime_adapter : TGGAATTCTCGGGTGCCAAGG

Skipping pipeline steps
skip_mirdeep : true

Institutional config options
config_profile_name : Test profile
config_profile_description: Minimal test dataset to check pipeline function

Core Nextflow options
revision : master
runName : chaotic_rutherford
containerEngine : docker
launchDir : /mnt/hb-antique/work/nfcode_test/smrnaseq
workDir : /mnt/hb-antique/work/nfcode_test/smrnaseq/work
projectDir : /home/gho016/.nextflow/assets/nf-core/smrnaseq
userName : gho016
profile : test,docker
configFiles :

!! Only displaying parameters that differ from the pipeline defaults !!
------------------------------------------------------* The pipeline
https://doi.org/10.5281/zenodo.3456879

• The nf-core framework
  https://doi.org/10.1038/s41587-020-0439-x

• Software dependencies
  https://github.com/nf-core/smrnaseq/blob/master/CITATIONS.md

Execution cancelled -- Finishing pending tasks before exit
-[nf-core/smrnaseq] Pipeline completed with errors-
Staging foreign file: s3://ngi-igenomes/test-data/smrnaseq/C1-N3-R1_S6_L001_R1_001.fastq.gz
Staging foreign file: s3://ngi-igenomes/test-data/smrnaseq/Ctl-N3-R1_S3_L001_R1_001.fastq.gz
Staging foreign file: s3://ngi-igenomes/test-data/smrnaseq/C9-N1-R1_S7_L001_R1_001.fastq.gz
Staging foreign file: s3://ngi-igenomes/test-data/smrnaseq/C9-N2-R1_S8_L001_R1_001.fastq.gz
Staging foreign file: s3://ngi-igenomes/test-data/smrnaseq/Ctl-N2-R1_S2_L001_R1_001.fastq.gz
Staging foreign file: s3://ngi-igenomes/test-data/smrnaseq/C9-N3-R1_S9_L001_R1_001.fastq.gz
Staging foreign file: s3://ngi-igenomes/test-data/smrnaseq/Ctl-N1-R1_S1_L001_R1_001.fastq.gz
Staging foreign file: s3://ngi-igenomes/test-data/smrnaseq/C1-N1-R1_S4_L001_R1_001.fastq.gz
WARN: The operator first is useless when applied to a value channel which returns a single value by definition
WARN: The operator first is useless when applied to a value channel which returns a single value by definition
ERROR ~ Error executing process > 'NFCORE_SMRNASEQ:MIRNA_QUANT:PARSE_HAIRPIN'

Caused by:
Process NFCORE_SMRNASEQ:MIRNA_QUANT:PARSE_HAIRPIN terminated with an error exit status (126)

Command executed:

Uncompress FASTA reference files if necessary
FASTA="hairpin.fa"
if [ ${FASTA: -3} == ".gz" ]; then
gunzip -f $FASTA
FASTA=${FASTA%%.gz}
fi
sed 's/>/>/g' $FASTA | sed 's#
#\n#g' | sed 's#

##g' | sed 's#

##g' | sed -e :a -e '/^\n*$/{$d;N;};/\n$/ba' > ${FASTA}_html_cleaned.fa
Remove spaces from miRBase FASTA files
sed '#^[^>]#s#[^AUGCaugc]#N#g' ${FASTA}_html_cleaned.fa > ${FASTA}_parsed.fa

sed -i 's# .*##' ${FASTA}_parsed.fa
seqkit grep -r --pattern ".hsa-." ${FASTA}_parsed.fa > ${FASTA}_sps.fa
seqkit seq --rna2dna ${FASTA}_sps.fa > ${FASTA}_igenome.fa

cat <<-END_VERSIONS > versions.yml
"NFCORE_SMRNASEQ:MIRNA_QUANT:PARSE_HAIRPIN":
seqkit: $(echo $(seqkit 2>&1) | sed 's/^.Version: //; s/ .$//')
END_VERSIONS

Command exit status:
126

Command output:
(empty)

Command error:
docker: Error response from daemon: error while creating mount source path '/mnt/hb-antique/work/nfcode_test/smrnaseq/work': mkdir /mnt/hb-antique/work/nfcode_test: permission denied.

Work dir:
/mnt/hb-antique/work/nfcode_test/smrnaseq/work/87/2bf75dac50169ed0835781e432bf58

Container:
quay.io/biocontainers/seqkit:2.6.1--h9ee0642_0

Tip: view the complete command output by changing to the process work dir and entering the command cat .command.out

-- Check '.nextflow.log' file for details
ERROR ~ Pipeline failed. Please refer to troubleshooting docs: https://nf-co.re/docs/usage/troubleshooting

-- Check '.nextflow.log' file for details
Waiting for file transfers to complete (8 files)
WARN: [NFCORE_SMRNASEQ:FASTQ_FASTQC_UMITOOLS_FASTP:FASTQC_RAW (7)] Unable to resume cached task -- See log file for details
WARN: [NFCORE_SMRNASEQ:FASTQ_FASTQC_UMITOOLS_FASTP:FASTP (7)] Unable to resume cached task -- See log file for details
WARN: [NFCORE_SMRNASEQ:FASTQ_FASTQC_UMITOOLS_FASTP:FASTP (2)] Unable to resume cached task -- See log file for details
WARN: [NFCORE_SMRNASEQ:FASTQ_FASTQC_UMITOOLS_FASTP:FASTQC_RAW (2)] Unable to resume cached task -- See log file for details
WARN: [NFCORE_SMRNASEQ:FASTQ_FASTQC_UMITOOLS_FASTP:FASTP (5)] Unable to resume cached task -- See log file for details
WARN: [NFCORE_SMRNASEQ:FASTQ_FASTQC_UMITOOLS_FASTP:FASTQC_RAW (5)] Unable to resume cached task -- See log file for details
WARN: [NFCORE_SMRNASEQ:FASTQ_FASTQC_UMITOOLS_FASTP:FASTP (4)] Unable to resume cached task -- See log file for details
WARN: [NFCORE_SMRNASEQ:FASTQ_FASTQC_UMITOOLS_FASTP:FASTQC_RAW (4)] Unable to resume cached task -- See log file for details
WARN: [NFCORE_SMRNASEQ:FASTQ_FASTQC_UMITOOLS_FASTP:FASTP (6)] Unable to resume cached task -- See log file for details
WARN: [NFCORE_SMRNASEQ:FASTQ_FASTQC_UMITOOLS_FASTP:FASTQC_RAW (6)] Unable to resume cached task -- See log file for details
WARN: [NFCORE_SMRNASEQ:FASTQ_FASTQC_UMITOOLS_FASTP:FASTP (8)] Unable to resume cached task -- See log file for details
WARN: [NFCORE_SMRNASEQ:FASTQ_FASTQC_UMITOOLS_FASTP:FASTQC_RAW (8)] Unable to resume cached task -- See log file for details
WARN: [NFCORE_SMRNASEQ:FASTQ_FASTQC_UMITOOLS_FASTP:FASTP (1)] Unable to resume cached task -- See log file for details
WARN: [NFCORE_SMRNASEQ:FASTQ_FASTQC_UMITOOLS_FASTP:FASTQC_RAW (1)] Unable to resume cached task -- See log file for details
WARN: [NFCORE_SMRNASEQ:FASTQ_FASTQC_UMITOOLS_FASTP:FASTP (3)] Unable to resume cached task -- See log file for details
WARN: [NFCORE_SMRNASEQ:FASTQ_FASTQC_UMITOOLS_FASTP:FASTQC_RAW (3)] Unable to resume cached task -- See log file for details