diff --git a/.github/workflows/ci.yml b/.github/workflows/ci.yml index b6747cce5..8346f837c 100644 --- a/.github/workflows/ci.yml +++ b/.github/workflows/ci.yml @@ -5,7 +5,7 @@ on: env: NXF_ANSI_LOG: false - NFT_VER: "0.8.4" + NFT_VER: "0.9.0" NFT_WORKDIR: "~" NFT_DIFF: "pdiff" NFT_DIFF_ARGS: "--line-numbers --expand-tabs=2" diff --git a/CHANGELOG.md b/CHANGELOG.md index dad3ea168..7e06350e8 100644 --- a/CHANGELOG.md +++ b/CHANGELOG.md @@ -102,6 +102,7 @@ Thank you to everyone else that has contributed by reporting bugs, enhancements - [PR #1330](https://github.com/nf-core/rnaseq/pull/1330) - Update all nf-core/modules and subworkflows - [PR #1331](https://github.com/nf-core/rnaseq/pull/1331) - Adding stubs for local modules - [PR #1334](https://github.com/nf-core/rnaseq/pull/1334) - Update all nf-core/modules and subworkflows with stubs +- [PR #1335](https://github.com/nf-core/rnaseq/pull/1335) - Adding stubs at all levels - [PR #1336](https://github.com/nf-core/rnaseq/pull/1334) - Use nf-core/setup-nf-test to install nf-test from cache during CI/CD - [PR #1340](https://github.com/nf-core/rnaseq/pull/1340) - Remove out-of-date Azure specific guidance - [PR #1341](https://github.com/nf-core/rnaseq/pull/1341) - Add rename in the MultiQC report for samples without techreps @@ -137,6 +138,7 @@ Thank you to everyone else that has contributed by reporting bugs, enhancements | `samtools` | 1.17 | 1.20 | | `sortmerna` | 4.3.4 | 4.3.6 | | `umi_tools` | 1.14 | 1.15 | +| `untar` | 1.3 | 1.34 | > **NB:** Dependency has been **updated** if both old and new version information is present. > diff --git a/modules.json b/modules.json index 93774f80e..a01086438 100644 --- a/modules.json +++ b/modules.json @@ -7,7 +7,7 @@ "nf-core": { "bbmap/bbsplit": { "branch": "master", - "git_sha": "2c6b1144ed58b6184ad58fc4e6b6a90219b4bf4f", + "git_sha": "1ceaa8ba4d0fd886dbca0e545815d905b7407de7", "installed_by": ["fastq_qc_trim_filter_setstrandedness", "modules"] }, "bedtools/genomecov": { @@ -17,22 +17,22 @@ }, "cat/fastq": { "branch": "master", - "git_sha": "4fc983ad0b30e6e32696fa7d980c76c7bfe1c03e", + "git_sha": "1ceaa8ba4d0fd886dbca0e545815d905b7407de7", "installed_by": ["fastq_qc_trim_filter_setstrandedness", "modules"] }, "custom/catadditionalfasta": { "branch": "master", - "git_sha": "2c6b1144ed58b6184ad58fc4e6b6a90219b4bf4f", + "git_sha": "1ceaa8ba4d0fd886dbca0e545815d905b7407de7", "installed_by": ["modules"] }, "custom/getchromsizes": { "branch": "master", - "git_sha": "41a4135c502b42ede663af87efa70a96ecbd7cb9", + "git_sha": "1ceaa8ba4d0fd886dbca0e545815d905b7407de7", "installed_by": ["modules"] }, "custom/tx2gene": { "branch": "master", - "git_sha": "82024cf6325d2ee194e7f056d841ecad2f6856e9", + "git_sha": "4e5f4687318f24ba944a13609d3ea6ebd890737d", "installed_by": ["modules", "quantify_pseudo_alignment"] }, "dupradar": { @@ -42,12 +42,12 @@ }, "fastp": { "branch": "master", - "git_sha": "b90b5cd93149a1b3be263d916c7234fe0708a71c", + "git_sha": "1ceaa8ba4d0fd886dbca0e545815d905b7407de7", "installed_by": ["fastq_fastqc_umitools_fastp", "modules"] }, "fastqc": { "branch": "master", - "git_sha": "285a50500f9e02578d90b3ce6382ea3c30216acd", + "git_sha": "46eca555142d6e597729fcb682adcc791796f514", "installed_by": ["fastq_fastqc_umitools_fastp", "fastq_fastqc_umitools_trimgalore"] }, "fq/subsample": { @@ -62,7 +62,7 @@ }, "gunzip": { "branch": "master", - "git_sha": "a7231cbccb86535529e33859e05d19ac93f3ea04", + "git_sha": "4e5f4687318f24ba944a13609d3ea6ebd890737d", "installed_by": ["modules"] }, "hisat2/align": { @@ -82,12 +82,12 @@ }, "kallisto/index": { "branch": "master", - "git_sha": "de5811dd9ca15af1e131806001bcaae909e42021", + "git_sha": "fbe341e9af0bb98533757f536b26d38507d31724", "installed_by": ["modules"] }, "kallisto/quant": { "branch": "master", - "git_sha": "de5811dd9ca15af1e131806001bcaae909e42021", + "git_sha": "fbe341e9af0bb98533757f536b26d38507d31724", "installed_by": ["modules", "quantify_pseudo_alignment"] }, "multiqc": { @@ -97,8 +97,9 @@ }, "picard/markduplicates": { "branch": "master", - "git_sha": "1943aa60f7490c3d6740e8872e6e69122ccc8087", - "installed_by": ["bam_markduplicates_picard"] + "git_sha": "46eca555142d6e597729fcb682adcc791796f514", + "installed_by": ["bam_markduplicates_picard"], + "patch": "modules/nf-core/picard/markduplicates/picard-markduplicates.diff" }, "preseq/lcextrap": { "branch": "master", @@ -107,7 +108,7 @@ }, "qualimap/rnaseq": { "branch": "master", - "git_sha": "6b0e4fe14ca1b12e131f64608f0bbaf36fd11451", + "git_sha": "46eca555142d6e597729fcb682adcc791796f514", "installed_by": ["modules"] }, "rsem/calculateexpression": { @@ -172,17 +173,17 @@ }, "samtools/flagstat": { "branch": "master", - "git_sha": "04fbbc7c43cebc0b95d5b126f6d9fe4effa33519", + "git_sha": "46eca555142d6e597729fcb682adcc791796f514", "installed_by": ["bam_stats_samtools"] }, "samtools/idxstats": { "branch": "master", - "git_sha": "04fbbc7c43cebc0b95d5b126f6d9fe4effa33519", + "git_sha": "46eca555142d6e597729fcb682adcc791796f514", "installed_by": ["bam_stats_samtools"] }, "samtools/index": { "branch": "master", - "git_sha": "04fbbc7c43cebc0b95d5b126f6d9fe4effa33519", + "git_sha": "46eca555142d6e597729fcb682adcc791796f514", "installed_by": [ "bam_dedup_stats_samtools_umitools", "bam_markduplicates_picard", @@ -191,12 +192,12 @@ }, "samtools/sort": { "branch": "master", - "git_sha": "04fbbc7c43cebc0b95d5b126f6d9fe4effa33519", + "git_sha": "46eca555142d6e597729fcb682adcc791796f514", "installed_by": ["bam_sort_stats_samtools"] }, "samtools/stats": { "branch": "master", - "git_sha": "04fbbc7c43cebc0b95d5b126f6d9fe4effa33519", + "git_sha": "1fe379cf6e6c1e6fa5e32bcbeefea0f1e874dac6", "installed_by": ["bam_stats_samtools"] }, "sortmerna": { @@ -206,17 +207,17 @@ }, "star/align": { "branch": "master", - "git_sha": "a21faa6a3481af92a343a10926f59c189a2c16c9", + "git_sha": "46eca555142d6e597729fcb682adcc791796f514", "installed_by": ["modules"] }, "star/genomegenerate": { "branch": "master", - "git_sha": "a21faa6a3481af92a343a10926f59c189a2c16c9", + "git_sha": "46eca555142d6e597729fcb682adcc791796f514", "installed_by": ["modules"] }, "stringtie/stringtie": { "branch": "master", - "git_sha": "b1b959609bda44341120aed1766329909f54b8d0", + "git_sha": "c789476080a150f87066ca3ed42a622339a26c0b", "installed_by": ["modules"] }, "subread/featurecounts": { @@ -226,7 +227,7 @@ }, "summarizedexperiment/summarizedexperiment": { "branch": "master", - "git_sha": "31751460f9ce9552846e13fdeec6953dcb47132d", + "git_sha": "4e5f4687318f24ba944a13609d3ea6ebd890737d", "installed_by": ["modules", "quantify_pseudo_alignment"] }, "trimgalore": { @@ -246,12 +247,12 @@ }, "ucsc/bedgraphtobigwig": { "branch": "master", - "git_sha": "7c75d01997236f61b9b77399d9933cb36041f2c3", + "git_sha": "46eca555142d6e597729fcb682adcc791796f514", "installed_by": ["bedgraph_bedclip_bedgraphtobigwig"] }, "umitools/dedup": { "branch": "master", - "git_sha": "3bd4f34e3093c2a16e6a8eefc22242b9b94641db", + "git_sha": "0eacd714effe5aac1c1de26593873960b3346cab", "installed_by": ["bam_dedup_stats_samtools_umitools"] }, "umitools/extract": { @@ -266,7 +267,7 @@ }, "untar": { "branch": "master", - "git_sha": "5caf7640a9ef1d18d765d55339be751bb0969dfa", + "git_sha": "4e5f4687318f24ba944a13609d3ea6ebd890737d", "installed_by": ["modules"] } } @@ -275,27 +276,27 @@ "nf-core": { "bam_dedup_stats_samtools_umitools": { "branch": "master", - "git_sha": "8f2062e7b4185590fb9f43c275381a31a6544fc0", + "git_sha": "46eca555142d6e597729fcb682adcc791796f514", "installed_by": ["subworkflows"] }, "bam_markduplicates_picard": { "branch": "master", - "git_sha": "04fbbc7c43cebc0b95d5b126f6d9fe4effa33519", + "git_sha": "46eca555142d6e597729fcb682adcc791796f514", "installed_by": ["subworkflows"] }, "bam_rseqc": { "branch": "master", - "git_sha": "9eb22e4d3f28c274b7c498a1564581377349a242", + "git_sha": "0eacd714effe5aac1c1de26593873960b3346cab", "installed_by": ["subworkflows"] }, "bam_sort_stats_samtools": { "branch": "master", - "git_sha": "04fbbc7c43cebc0b95d5b126f6d9fe4effa33519", + "git_sha": "46eca555142d6e597729fcb682adcc791796f514", "installed_by": ["fastq_align_hisat2"] }, "bam_stats_samtools": { "branch": "master", - "git_sha": "04fbbc7c43cebc0b95d5b126f6d9fe4effa33519", + "git_sha": "0eacd714effe5aac1c1de26593873960b3346cab", "installed_by": [ "bam_dedup_stats_samtools_umitools", "bam_markduplicates_picard", @@ -304,22 +305,22 @@ }, "bedgraph_bedclip_bedgraphtobigwig": { "branch": "master", - "git_sha": "a4bceac1aecee5aa0a5dbc601baf0e2e61013fb2", + "git_sha": "0eacd714effe5aac1c1de26593873960b3346cab", "installed_by": ["subworkflows"] }, "fastq_align_hisat2": { "branch": "master", - "git_sha": "c60c14b285b89bdd0607e371417dadb80385ad6e", + "git_sha": "c789476080a150f87066ca3ed42a622339a26c0b", "installed_by": ["subworkflows"] }, "fastq_fastqc_umitools_fastp": { "branch": "master", - "git_sha": "db35d26edeafacf9906a517827df621a29adc13d", + "git_sha": "46eca555142d6e597729fcb682adcc791796f514", "installed_by": ["fastq_qc_trim_filter_setstrandedness", "subworkflows"] }, "fastq_fastqc_umitools_trimgalore": { "branch": "master", - "git_sha": "cb6defa0834eda9d6d3f967e981c819fc3e257bf", + "git_sha": "46eca555142d6e597729fcb682adcc791796f514", "installed_by": ["fastq_qc_trim_filter_setstrandedness", "subworkflows"] }, "fastq_qc_trim_filter_setstrandedness": { @@ -329,12 +330,12 @@ }, "fastq_subsample_fq_salmon": { "branch": "master", - "git_sha": "727232afb8294b53dd9d05bfe469b70cce1675bb", + "git_sha": "fbe341e9af0bb98533757f536b26d38507d31724", "installed_by": ["fastq_qc_trim_filter_setstrandedness", "subworkflows"] }, "quantify_pseudo_alignment": { "branch": "master", - "git_sha": "5d095e8413da1f4c72b7d07ce87f75c09482486f", + "git_sha": "fbe341e9af0bb98533757f536b26d38507d31724", "installed_by": ["subworkflows"] }, "utils_nextflow_pipeline": { diff --git a/modules/local/deseq2_qc/main.nf b/modules/local/deseq2_qc/main.nf index 7ff5877bb..7aa81e9b5 100644 --- a/modules/local/deseq2_qc/main.nf +++ b/modules/local/deseq2_qc/main.nf @@ -63,16 +63,16 @@ process DESEQ2_QC { def label_lower = args2.toLowerCase() prefix = task.ext.prefix ?: "deseq2" """ - mkdir size_factors touch ${label_lower}.pca.vals_mqc.tsv touch ${label_lower}.sample.dists_mqc.tsv - touch ${prefix}.plots.pdf touch ${prefix}.dds.RData touch ${prefix}.pca.vals.txt + touch ${prefix}.plots.pdf touch ${prefix}.sample.dists.txt touch R_sessionInfo.log - touch size_factors/${prefix}.size_factors.RData + mkdir size_factors + touch size_factors/${prefix}.size_factors.RData for i in `head $counts -n 1 | cut -f3-`; do touch size_factors/\${i}.size_factors.RData diff --git a/modules/local/star_align_igenomes/main.nf b/modules/local/star_align_igenomes/main.nf index 04068f142..7bda3df84 100644 --- a/modules/local/star_align_igenomes/main.nf +++ b/modules/local/star_align_igenomes/main.nf @@ -76,6 +76,8 @@ process STAR_ALIGN_IGENOMES { stub: def prefix = task.ext.prefix ?: "${meta.id}" """ + echo "" | gzip > ${prefix}.unmapped_1.fastq.gz + echo "" | gzip > ${prefix}.unmapped_2.fastq.gz touch ${prefix}Xd.out.bam touch ${prefix}.Log.final.out touch ${prefix}.Log.out @@ -84,8 +86,6 @@ process STAR_ALIGN_IGENOMES { touch ${prefix}.toTranscriptome.out.bam touch ${prefix}.Aligned.unsort.out.bam touch ${prefix}.Aligned.sortedByCoord.out.bam - touch ${prefix}.unmapped_1.fastq.gz - touch ${prefix}.unmapped_2.fastq.gz touch ${prefix}.tab touch ${prefix}.SJ.out.tab touch ${prefix}.ReadsPerGene.out.tab diff --git a/modules/local/star_align_igenomes/tests/main.nf.test b/modules/local/star_align_igenomes/tests/main.nf.test index 8255c1732..37f65930a 100644 --- a/modules/local/star_align_igenomes/tests/main.nf.test +++ b/modules/local/star_align_igenomes/tests/main.nf.test @@ -4,20 +4,324 @@ nextflow_process { script "../main.nf" process "STAR_ALIGN_IGENOMES" - setup { - run("STAR_GENOMEGENERATE_IGENOMES") { - script "../../star_genomegenerate_igenomes/main.nf" + test("homo_sapiens - single_end") { + config "./nextflow.config" + setup { + run("STAR_GENOMEGENERATE_IGENOMES") { + script "../../star_genomegenerate_igenomes/main.nf" + process { + """ + input[0] = Channel.of([file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)]) + input[1] = Channel.of([file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true)]) + """ + } + } + } + + when { process { """ - input[0] = Channel.of([file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)]) - input[1] = Channel.of([file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true)]) + input[0] = Channel.of([ + [ id:'test', single_end:true ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_rnaseq_1.fastq.gz', checkIfExists: true) ] + ]) + input[1] = STAR_GENOMEGENERATE_IGENOMES.out.index.map{ [ [id:'star'], it ] } + input[2] = Channel.of([ + [ id:'test_gtf' ], + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true) ] + ]) + input[3] = false + input[4] = 'illumina' + input[5] = false """ } } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + file(process.out.log_final[0][1]).name, + file(process.out.log_out[0][1]).name, + file(process.out.log_progress[0][1]).name, + process.out.bam, + process.out.bam_sorted, + process.out.bam_transcript, + process.out.bam_unsorted, + process.out.bedgraph, + process.out.fastq, + process.out.junction, + process.out.read_per_gene_tab, + process.out.sam, + process.out.spl_junc_tab, + process.out.tab, + process.out.wig, + process.out.versions + ).match() } + ) + } } - test("homo_sapiens - single_end") { + test("homo_sapiens - paired_end") { config "./nextflow.config" + setup { + run("STAR_GENOMEGENERATE_IGENOMES") { + script "../../star_genomegenerate_igenomes/main.nf" + process { + """ + input[0] = Channel.of([file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)]) + input[1] = Channel.of([file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true)]) + """ + } + } + } + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_rnaseq_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_rnaseq_2.fastq.gz', checkIfExists: true) + ] + ]) + input[1] = STAR_GENOMEGENERATE_IGENOMES.out.index.map{ [ [id:'star'], it ] } + input[2] = Channel.of([ + [ id:'test_gtf' ], + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true) ] + ]) + input[3] = false + input[4] = 'illumina' + input[5] = false + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + file(process.out.log_final[0][1]).name, + file(process.out.log_out[0][1]).name, + file(process.out.log_progress[0][1]).name, + process.out.bam, + process.out.bam_sorted, + process.out.bam_transcript, + process.out.bam_unsorted, + process.out.bedgraph, + process.out.fastq, + process.out.junction, + process.out.read_per_gene_tab, + process.out.sam, + process.out.spl_junc_tab, + process.out.tab, + process.out.wig, + process.out.versions + ).match() } + ) + } + } + + test("homo_sapiens - paired_end - arriba") { + config "./nextflow.arriba.config" + setup { + run("STAR_GENOMEGENERATE_IGENOMES") { + script "../../star_genomegenerate_igenomes/main.nf" + process { + """ + input[0] = Channel.of([file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)]) + input[1] = Channel.of([file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true)]) + """ + } + } + } + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_rnaseq_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_rnaseq_2.fastq.gz', checkIfExists: true) + ] + ]) + input[1] = STAR_GENOMEGENERATE_IGENOMES.out.index.map{ [ [id:'star'], it ] } + input[2] = Channel.of([ + [ id:'test_gtf' ], + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true) ] + ]) + input[3] = false + input[4] = 'illumina' + input[5] = false + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + file(process.out.log_final[0][1]).name, + file(process.out.log_out[0][1]).name, + file(process.out.log_progress[0][1]).name, + process.out.bam, + process.out.bam_sorted, + process.out.bam_transcript, + process.out.bam_unsorted, + process.out.bedgraph, + process.out.fastq, + process.out.junction, + process.out.read_per_gene_tab, + process.out.sam, + process.out.spl_junc_tab, + process.out.tab, + process.out.wig, + process.out.versions + ).match() } + ) + } + } + + test("homo_sapiens - paired_end - starfusion") { + config "./nextflow.starfusion.config" + setup { + run("STAR_GENOMEGENERATE_IGENOMES") { + script "../../star_genomegenerate_igenomes/main.nf" + process { + """ + input[0] = Channel.of([file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)]) + input[1] = Channel.of([file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true)]) + """ + } + } + } + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_rnaseq_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_rnaseq_2.fastq.gz', checkIfExists: true) + ] + ]) + input[1] = STAR_GENOMEGENERATE_IGENOMES.out.index.map{ [ [id:'star'], it ] } + input[2] = Channel.of([ + [ id:'test_gtf' ], + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true) ] + ]) + input[3] = false + input[4] = 'illumina' + input[5] = false + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + file(process.out.log_final[0][1]).name, + file(process.out.log_out[0][1]).name, + file(process.out.log_progress[0][1]).name, + process.out.bam, + process.out.bam_sorted, + process.out.bam_transcript, + process.out.bam_unsorted, + process.out.bedgraph, + process.out.fastq, + process.out.junction, + process.out.read_per_gene_tab, + process.out.sam, + process.out.spl_junc_tab, + process.out.tab, + process.out.wig, + process.out.versions + ).match() } + ) + } + } + + test("homo_sapiens - paired_end - multiple") { + config "./nextflow.config" + setup { + run("STAR_GENOMEGENERATE_IGENOMES") { + script "../../star_genomegenerate_igenomes/main.nf" + process { + """ + input[0] = Channel.of([file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)]) + input[1] = Channel.of([file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true)]) + """ + } + } + } + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_rnaseq_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_rnaseq_2.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_rnaseq_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_rnaseq_2.fastq.gz', checkIfExists: true) + ] + ]) + input[1] = STAR_GENOMEGENERATE_IGENOMES.out.index.map{ [ [id:'star'], it ] } + input[2] = Channel.of([ + [ id:'test_gtf' ], + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true) ] + ]) + input[3] = false + input[4] = 'illumina' + input[5] = false + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + file(process.out.log_final[0][1]).name, + file(process.out.log_out[0][1]).name, + file(process.out.log_progress[0][1]).name, + process.out.bam, + process.out.bam_sorted, + process.out.bam_transcript, + process.out.bam_unsorted, + process.out.bedgraph, + process.out.fastq, + process.out.junction, + process.out.read_per_gene_tab, + process.out.sam, + process.out.spl_junc_tab, + process.out.tab, + process.out.wig, + process.out.versions + ).match() } + ) + } + } + + test("homo_sapiens - single_end - stub") { + options "-stub" + config "./nextflow.config" + setup { + run("STAR_GENOMEGENERATE_IGENOMES") { + script "../../star_genomegenerate_igenomes/main.nf" + process { + """ + input[0] = Channel.of([file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)]) + input[1] = Channel.of([file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true)]) + """ + } + } + } when { process { @@ -41,28 +345,25 @@ nextflow_process { then { assertAll( { assert process.success }, - { assert snapshot(file(process.out.log_final[0][1]).name).match("homo_sapiens - single_end - log_final") }, - { assert snapshot(file(process.out.log_out[0][1]).name).match("homo_sapiens - single_end - log_out") }, - { assert snapshot(process.out.bam).match("homo_sapiens - single_end - bam") }, - { assert snapshot(process.out.bam_sorted).match("homo_sapiens - single_end - bam_sorted") }, - { assert snapshot(process.out.bam_transcript).match("homo_sapiens - single_end - bam_transcript") }, - { assert snapshot(process.out.bam_unsorted).match("homo_sapiens - single_end - bam_unsorted") }, - { assert snapshot(process.out.bedgraph).match("homo_sapiens - single_end - bedgraph") }, - { assert snapshot(process.out.fastq).match("homo_sapiens - single_end - fastq") }, - { assert snapshot(process.out.junction).match("homo_sapiens - single_end - junction") }, - { assert snapshot(process.out.log_progress).match("homo_sapiens - single_end - log_progress") }, - { assert snapshot(process.out.read_per_gene_tab).match("homo_sapiens - single_end - read_per_gene_tab") }, - { assert snapshot(process.out.sam).match("homo_sapiens - single_end - sam") }, - { assert snapshot(process.out.spl_junc_tab).match("homo_sapiens - single_end - spl_junc_tab") }, - { assert snapshot(process.out.tab).match("homo_sapiens - single_end - tab") }, - { assert snapshot(process.out.wig).match("homo_sapiens - single_end - wig") }, - { assert snapshot(process.out.versions).match("homo_sapiens - single_end - versions") } + { assert snapshot(process.out).match() } ) } } - test("homo_sapiens - paired_end") { + test("homo_sapiens - paired_end - stub") { + options "-stub" config "./nextflow.config" + setup { + run("STAR_GENOMEGENERATE_IGENOMES") { + script "../../star_genomegenerate_igenomes/main.nf" + process { + """ + input[0] = Channel.of([file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)]) + input[1] = Channel.of([file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true)]) + """ + } + } + } when { process { @@ -89,28 +390,25 @@ nextflow_process { then { assertAll( { assert process.success }, - { assert snapshot(file(process.out.log_final[0][1]).name).match("homo_sapiens - paired_end - log_final") }, - { assert snapshot(file(process.out.log_out[0][1]).name).match("homo_sapiens - paired_end - log_out") }, - { assert snapshot(process.out.bam).match("homo_sapiens - paired_end - bam") }, - { assert snapshot(process.out.bam_sorted).match("homo_sapiens - paired_end - bam_sorted") }, - { assert snapshot(process.out.bam_transcript).match("homo_sapiens - paired_end - bam_transcript") }, - { assert snapshot(process.out.bam_unsorted).match("homo_sapiens - paired_end - bam_unsorted") }, - { assert snapshot(process.out.bedgraph).match("homo_sapiens - paired_end - bedgraph") }, - { assert snapshot(process.out.fastq).match("homo_sapiens - paired_end - fastq") }, - { assert snapshot(process.out.junction).match("homo_sapiens - paired_end - junction") }, - { assert snapshot(process.out.log_progress).match("homo_sapiens - paired_end - log_progress") }, - { assert snapshot(process.out.read_per_gene_tab).match("homo_sapiens - paired_end - read_per_gene_tab") }, - { assert snapshot(process.out.sam).match("homo_sapiens - paired_end - sam") }, - { assert snapshot(process.out.spl_junc_tab).match("homo_sapiens - paired_end - spl_junc_tab") }, - { assert snapshot(process.out.tab).match("homo_sapiens - paired_end - tab") }, - { assert snapshot(process.out.wig).match("homo_sapiens - paired_end - wig") }, - { assert snapshot(process.out.versions).match("homo_sapiens - paired_end - versions") } + { assert snapshot(process.out).match() } ) } } - test("homo_sapiens - paired_end - arriba") { + test("homo_sapiens - paired_end - arriba - stub") { + options "-stub" config "./nextflow.arriba.config" + setup { + run("STAR_GENOMEGENERATE_IGENOMES") { + script "../../star_genomegenerate_igenomes/main.nf" + process { + """ + input[0] = Channel.of([file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)]) + input[1] = Channel.of([file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true)]) + """ + } + } + } when { process { @@ -137,28 +435,25 @@ nextflow_process { then { assertAll( { assert process.success }, - { assert snapshot(file(process.out.log_final[0][1]).name).match("homo_sapiens - paired_end - arriba - log_final") }, - { assert snapshot(file(process.out.log_out[0][1]).name).match("homo_sapiens - paired_end - arriba - log_out") }, - { assert snapshot(file(process.out.log_progress[0][1]).name).match("homo_sapiens - paired_end - arriba - log_progress") }, - { assert snapshot(process.out.bam).match("homo_sapiens - paired_end - arriba - bam") }, - { assert snapshot(process.out.bam_sorted).match("homo_sapiens - paired_end - arriba - bam_sorted") }, - { assert snapshot(process.out.bam_transcript).match("homo_sapiens - paired_end - arriba - bam_transcript") }, - { assert snapshot(process.out.bam_unsorted).match("homo_sapiens - paired_end - arriba - bam_unsorted") }, - { assert snapshot(process.out.bedgraph).match("homo_sapiens - paired_end - arriba - bedgraph") }, - { assert snapshot(process.out.fastq).match("homo_sapiens - paired_end - arriba - fastq") }, - { assert snapshot(process.out.junction).match("homo_sapiens - paired_end - arriba - junction") }, - { assert snapshot(process.out.read_per_gene_tab).match("homo_sapiens - paired_end - arriba - read_per_gene_tab") }, - { assert snapshot(process.out.sam).match("homo_sapiens - paired_end - arriba - sam") }, - { assert snapshot(process.out.spl_junc_tab).match("homo_sapiens - paired_end - arriba - spl_junc_tab") }, - { assert snapshot(process.out.tab).match("homo_sapiens - paired_end - arriba - tab") }, - { assert snapshot(process.out.wig).match("homo_sapiens - paired_end - arriba - wig") }, - { assert snapshot(process.out.versions).match("homo_sapiens - paired_end - arriba - versions") } + { assert snapshot(process.out).match() } ) } } - test("homo_sapiens - paired_end - starfusion") { + test("homo_sapiens - paired_end - starfusion - stub") { + options "-stub" config "./nextflow.starfusion.config" + setup { + run("STAR_GENOMEGENERATE_IGENOMES") { + script "../../star_genomegenerate_igenomes/main.nf" + process { + """ + input[0] = Channel.of([file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)]) + input[1] = Channel.of([file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true)]) + """ + } + } + } when { process { @@ -185,28 +480,25 @@ nextflow_process { then { assertAll( { assert process.success }, - { assert snapshot(file(process.out.log_final[0][1]).name).match("homo_sapiens - paired_end - starfusion - log_final") }, - { assert snapshot(file(process.out.log_out[0][1]).name).match("homo_sapiens - paired_end - starfusion - log_out") }, - { assert snapshot(file(process.out.log_progress[0][1]).name).match("homo_sapiens - paired_end - starfusion - log_progress") }, - { assert snapshot(process.out.bam).match("homo_sapiens - paired_end - starfusion - bam") }, - { assert snapshot(process.out.bam_sorted).match("homo_sapiens - paired_end - starfusion - bam_sorted") }, - { assert snapshot(process.out.bam_transcript).match("homo_sapiens - paired_end - starfusion - bam_transcript") }, - { assert snapshot(process.out.bam_unsorted).match("homo_sapiens - paired_end - starfusion - bam_unsorted") }, - { assert snapshot(process.out.bedgraph).match("homo_sapiens - paired_end - starfusion - bedgraph") }, - { assert snapshot(process.out.fastq).match("homo_sapiens - paired_end - starfusion - fastq") }, - { assert snapshot(process.out.junction).match("homo_sapiens - paired_end - starfusion - junction") }, - { assert snapshot(process.out.read_per_gene_tab).match("homo_sapiens - paired_end - starfusion - read_per_gene_tab") }, - { assert snapshot(process.out.sam).match("homo_sapiens - paired_end - starfusion - sam") }, - { assert snapshot(process.out.spl_junc_tab).match("homo_sapiens - paired_end - starfusion - spl_junc_tab") }, - { assert snapshot(process.out.tab).match("homo_sapiens - paired_end - starfusion - tab") }, - { assert snapshot(process.out.wig).match("homo_sapiens - paired_end - starfusion - wig") }, - { assert snapshot(process.out.versions).match("homo_sapiens - paired_end - starfusion - versions") } + { assert snapshot(process.out).match() } ) } } - test("homo_sapiens - paired_end - multiple") { + test("homo_sapiens - paired_end - multiple - stub") { + options "-stub" config "./nextflow.config" + setup { + run("STAR_GENOMEGENERATE_IGENOMES") { + script "../../star_genomegenerate_igenomes/main.nf" + process { + """ + input[0] = Channel.of([file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)]) + input[1] = Channel.of([file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true)]) + """ + } + } + } when { process { @@ -235,22 +527,7 @@ nextflow_process { then { assertAll( { assert process.success }, - { assert snapshot(file(process.out.log_final[0][1]).name).match("homo_sapiens - paired_end - multiple - log_final") }, - { assert snapshot(file(process.out.log_out[0][1]).name).match("homo_sapiens - paired_end - multiple - log_out") }, - { assert snapshot(file(process.out.log_progress[0][1]).name).match("homo_sapiens - paired_end - multiple - log_progress") }, - { assert snapshot(process.out.bam).match("homo_sapiens - paired_end - multiple - bam") }, - { assert snapshot(process.out.bam_sorted).match("homo_sapiens - paired_end - multiple - bam_sorted") }, - { assert snapshot(process.out.bam_transcript).match("homo_sapiens - paired_end - multiple - bam_transcript") }, - { assert snapshot(process.out.bam_unsorted).match("homo_sapiens - paired_end - multiple - bam_unsorted") }, - { assert snapshot(process.out.bedgraph).match("homo_sapiens - paired_end - multiple - bedgraph") }, - { assert snapshot(process.out.fastq).match("homo_sapiens - paired_end - multiple - fastq") }, - { assert snapshot(process.out.junction).match("homo_sapiens - paired_end - multiple - junction") }, - { assert snapshot(process.out.read_per_gene_tab).match("homo_sapiens - paired_end - multiple - read_per_gene_tab") }, - { assert snapshot(process.out.sam).match("homo_sapiens - paired_end - multiple - sam") }, - { assert snapshot(process.out.spl_junc_tab).match("homo_sapiens - paired_end - multiple - spl_junc_tab") }, - { assert snapshot(process.out.tab).match("homo_sapiens - paired_end - multiple - tab") }, - { assert snapshot(process.out.wig).match("homo_sapiens - paired_end - multiple - wig") }, - { assert snapshot(process.out.versions).match("homo_sapiens - paired_end - multiple - versions") } + { assert snapshot(process.out).match() } ) } } diff --git a/modules/local/star_align_igenomes/tests/main.nf.test.snap b/modules/local/star_align_igenomes/tests/main.nf.test.snap index 7dad647c0..5a0b193b1 100644 --- a/modules/local/star_align_igenomes/tests/main.nf.test.snap +++ b/modules/local/star_align_igenomes/tests/main.nf.test.snap @@ -1,324 +1,565 @@ { - "homo_sapiens - paired_end - multiple - bam_sorted": { + "homo_sapiens - single_end - stub": { "content": [ - [ - [ - { - "id": "test", - "single_end": false - }, - "test.Aligned.sortedByCoord.out.bam:md5,7b20152380dbc52ec23d2e95a7953710" + { + "0": [ + [ + { + "id": "test", + "single_end": true + }, + "test.Log.final.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": true + }, + "test.Log.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "10": [ + [ + { + "id": "test", + "single_end": true + }, + "test.Chimeric.out.junction:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "11": [ + [ + { + "id": "test", + "single_end": true + }, + "test.out.sam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + [ + { + "id": "test", + "single_end": true + }, + "test.Log.progress.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + "versions.yml:md5,957a57604ceb366b7af0123738e13559" + ], + "4": [ + [ + { + "id": "test", + "single_end": true + }, + [ + "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "testXd.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "5": [ + [ + { + "id": "test", + "single_end": true + }, + [ + "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "6": [ + [ + { + "id": "test", + "single_end": true + }, + "test.toTranscriptome.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "7": [ + [ + { + "id": "test", + "single_end": true + }, + "test.Aligned.unsort.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "8": [ + [ + { + "id": "test", + "single_end": true + }, + [ + "test.unmapped_1.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test.unmapped_2.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "9": [ + [ + { + "id": "test", + "single_end": true + }, + [ + "test.ReadsPerGene.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.SJ.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.tab:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "bam": [ + [ + { + "id": "test", + "single_end": true + }, + [ + "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "testXd.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "bam_sorted": [ + [ + { + "id": "test", + "single_end": true + }, + [ + "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "bam_transcript": [ + [ + { + "id": "test", + "single_end": true + }, + "test.toTranscriptome.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "bam_unsorted": [ + [ + { + "id": "test", + "single_end": true + }, + "test.Aligned.unsort.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "fastq": [ + [ + { + "id": "test", + "single_end": true + }, + [ + "test.unmapped_1.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test.unmapped_2.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "junction": [ + [ + { + "id": "test", + "single_end": true + }, + "test.Chimeric.out.junction:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "log_final": [ + [ + { + "id": "test", + "single_end": true + }, + "test.Log.final.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "log_out": [ + [ + { + "id": "test", + "single_end": true + }, + "test.Log.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "log_progress": [ + [ + { + "id": "test", + "single_end": true + }, + "test.Log.progress.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "sam": [ + [ + { + "id": "test", + "single_end": true + }, + "test.out.sam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "tab": [ + [ + { + "id": "test", + "single_end": true + }, + [ + "test.ReadsPerGene.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.SJ.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.tab:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "versions": [ + "versions.yml:md5,957a57604ceb366b7af0123738e13559" ] - ] + } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-03-05T12:52:13.056684" + "timestamp": "2024-07-22T20:12:37.024869" }, - "homo_sapiens - paired_end - multiple - wig": { - "content": null, + "homo_sapiens - paired_end - arriba - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Log.final.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Log.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "10": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Chimeric.out.junction:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "11": [ + [ + { + "id": "test", + "single_end": false + }, + "test.out.sam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Log.progress.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + "versions.yml:md5,957a57604ceb366b7af0123738e13559" + ], + "4": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "testXd.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "5": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "6": [ + [ + { + "id": "test", + "single_end": false + }, + "test.toTranscriptome.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "7": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Aligned.unsort.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "8": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.unmapped_1.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test.unmapped_2.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "9": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.ReadsPerGene.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.SJ.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.tab:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "bam": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "testXd.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "bam_sorted": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "bam_transcript": [ + [ + { + "id": "test", + "single_end": false + }, + "test.toTranscriptome.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "bam_unsorted": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Aligned.unsort.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "fastq": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.unmapped_1.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test.unmapped_2.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "junction": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Chimeric.out.junction:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "log_final": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Log.final.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "log_out": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Log.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "log_progress": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Log.progress.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "sam": [ + [ + { + "id": "test", + "single_end": false + }, + "test.out.sam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "tab": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.ReadsPerGene.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.SJ.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.tab:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "versions": [ + "versions.yml:md5,957a57604ceb366b7af0123738e13559" + ] + } + ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-03-05T11:43:54.502911" + "timestamp": "2024-07-22T20:13:17.56838" }, - "homo_sapiens - paired_end - arriba - tab": { + "homo_sapiens - single_end": { "content": [ + "test.Log.final.out", + "test.Log.out", + "test.Log.progress.out", [ [ { "id": "test", - "single_end": false + "single_end": true }, - "test.SJ.out.tab:md5,5155c9fd1f787ad6d7d80987fb06219c" + "test.Aligned.sortedByCoord.out.bam:md5,e5060a8dd60584378786c588c3f25b4d" ] - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-05T12:48:07.200426" - }, - "homo_sapiens - single_end - wig": { - "content": null, - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-05T11:39:12.419461" - }, - "homo_sapiens - paired_end - sam": { - "content": [ + ], [ - - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-05T11:39:28.821547" - }, - "homo_sapiens - paired_end - arriba - versions": { - "content": [ - [ - "versions.yml:md5,957a57604ceb366b7af0123738e13559" - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-05T12:48:07.267343" - }, - "homo_sapiens - paired_end - multiple - bedgraph": { - "content": null, - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-05T11:43:54.432752" - }, - "homo_sapiens - paired_end - read_per_gene_tab": { - "content": null, - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-05T11:39:28.81774" - }, - "homo_sapiens - paired_end - arriba - bedgraph": { - "content": null, - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-05T11:39:45.643743" - }, - "homo_sapiens - single_end - junction": { - "content": [ - [ - - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-05T11:39:12.406191" - }, - "homo_sapiens - paired_end - arriba - spl_junc_tab": { - "content": null, - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-05T11:39:45.65723" - }, - "homo_sapiens - single_end - sam": { - "content": [ - [ - - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-05T11:39:12.411481" - }, - "homo_sapiens - paired_end - fastq": { - "content": [ + [ + { + "id": "test", + "single_end": true + }, + "test.Aligned.sortedByCoord.out.bam:md5,e5060a8dd60584378786c588c3f25b4d" + ] + ], [ - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-05T11:39:28.810584" - }, - "homo_sapiens - single_end - versions": { - "content": [ - [ - "versions.yml:md5,957a57604ceb366b7af0123738e13559" - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-05T12:40:00.104687" - }, - "homo_sapiens - paired_end - multiple - log_out": { - "content": [ - "test.Log.out" - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-05T12:52:12.894285" - }, - "homo_sapiens - paired_end - arriba - fastq": { - "content": [ + ], [ - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-05T11:39:45.646457" - }, - "homo_sapiens - paired_end - multiple - junction": { - "content": [ + ], + null, [ - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-05T11:43:54.45332" - }, - "homo_sapiens - paired_end - multiple - spl_junc_tab": { - "content": null, - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-05T11:43:54.482358" - }, - "homo_sapiens - paired_end - starfusion - log_final": { - "content": [ - "test.Log.final.out" - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-05T12:44:02.475493" - }, - "homo_sapiens - paired_end - starfusion - fastq": { - "content": [ + ], [ - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-05T11:41:39.262375" - }, - "homo_sapiens - paired_end - multiple - sam": { - "content": [ + ], + null, [ - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-05T11:43:54.472236" - }, - "homo_sapiens - paired_end - multiple - log_final": { - "content": [ - "test.Log.final.out" - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-05T12:52:12.865334" - }, - "homo_sapiens - paired_end - starfusion - bam": { - "content": [ + ], + null, [ [ { "id": "test", - "single_end": false + "single_end": true }, - "test.Aligned.out.bam:md5,7806e69c537f72e494f9ce8e95f16355" + "test.SJ.out.tab:md5,75a516ab950fb958f40b29996474949c" ] + ], + null, + [ + "versions.yml:md5,957a57604ceb366b7af0123738e13559" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-03-05T12:44:02.545949" + "timestamp": "2024-07-22T20:04:35.055193" }, - "homo_sapiens - paired_end - arriba - junction": { + "homo_sapiens - paired_end": { "content": [ + "test.Log.final.out", + "test.Log.out", + "test.Log.progress.out", [ [ { "id": "test", "single_end": false }, - "test.Chimeric.out.junction:md5,62760fd60371d5bacae324c370358944" + "test.Aligned.sortedByCoord.out.bam:md5,b6cec9bba6b04b9b92eddbef128bdfbb" ] - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-05T12:48:07.133125" - }, - "homo_sapiens - single_end - bedgraph": { - "content": null, - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-05T11:39:12.402541" - }, - "homo_sapiens - paired_end - arriba - read_per_gene_tab": { - "content": null, - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-05T11:39:45.651485" - }, - "homo_sapiens - paired_end - starfusion - bam_sorted": { - "content": [ - [ - - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-05T11:41:39.217628" - }, - "homo_sapiens - single_end - bam_unsorted": { - "content": [ - [ - - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-05T11:39:12.400925" - }, - "homo_sapiens - paired_end - bam": { - "content": [ + ], [ [ { @@ -327,102 +568,25 @@ }, "test.Aligned.sortedByCoord.out.bam:md5,b6cec9bba6b04b9b92eddbef128bdfbb" ] - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-05T12:40:45.530038" - }, - "homo_sapiens - paired_end - arriba - bam_transcript": { - "content": [ + ], [ - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-05T11:39:45.63966" - }, - "homo_sapiens - paired_end - log_out": { - "content": [ - "test.Log.out" - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-05T12:40:45.492406" - }, - "homo_sapiens - paired_end - arriba - log_out": { - "content": [ - "test.Log.out" - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-05T12:48:06.975033" - }, - "homo_sapiens - paired_end - multiple - versions": { - "content": [ + ], [ - "versions.yml:md5,957a57604ceb366b7af0123738e13559" - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-05T12:52:13.193701" - }, - "homo_sapiens - paired_end - starfusion - bam_transcript": { - "content": [ + + ], + null, [ - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-05T11:41:39.224799" - }, - "homo_sapiens - paired_end - starfusion - tab": { - "content": [ + ], [ - [ - { - "id": "test", - "single_end": false - }, - "test.SJ.out.tab:md5,19c3faa1bfa9a0cc5e4c45f17065b53a" - ] - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-05T12:44:02.631643" - }, - "homo_sapiens - single_end - fastq": { - "content": [ + + ], + null, [ - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-05T11:39:12.404069" - }, - "homo_sapiens - paired_end - tab": { - "content": [ + ], + null, [ [ { @@ -431,204 +595,592 @@ }, "test.SJ.out.tab:md5,844af19ab0fc8cd9a3f75228445aca0d" ] - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-05T12:40:45.687553" - }, - "homo_sapiens - paired_end - starfusion - bedgraph": { - "content": null, - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-05T11:41:39.254528" - }, - "homo_sapiens - single_end - bam_transcript": { - "content": [ - [ - - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-05T11:39:12.39955" - }, - "homo_sapiens - paired_end - versions": { - "content": [ + ], + null, [ "versions.yml:md5,957a57604ceb366b7af0123738e13559" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-03-05T12:40:45.748799" + "timestamp": "2024-07-22T20:05:25.626464" }, - "homo_sapiens - paired_end - multiple - tab": { + "homo_sapiens - paired_end - multiple - stub": { "content": [ - [ - [ - { - "id": "test", - "single_end": false - }, - "test.SJ.out.tab:md5,069877e053714e23010fe4e1c003b4a2" + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Log.final.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Log.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "10": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Chimeric.out.junction:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "11": [ + [ + { + "id": "test", + "single_end": false + }, + "test.out.sam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Log.progress.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + "versions.yml:md5,957a57604ceb366b7af0123738e13559" + ], + "4": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "testXd.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "5": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "6": [ + [ + { + "id": "test", + "single_end": false + }, + "test.toTranscriptome.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "7": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Aligned.unsort.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "8": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.unmapped_1.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test.unmapped_2.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "9": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.ReadsPerGene.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.SJ.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.tab:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "bam": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "testXd.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "bam_sorted": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "bam_transcript": [ + [ + { + "id": "test", + "single_end": false + }, + "test.toTranscriptome.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "bam_unsorted": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Aligned.unsort.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "fastq": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.unmapped_1.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test.unmapped_2.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "junction": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Chimeric.out.junction:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "log_final": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Log.final.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "log_out": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Log.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "log_progress": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Log.progress.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "sam": [ + [ + { + "id": "test", + "single_end": false + }, + "test.out.sam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "tab": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.ReadsPerGene.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.SJ.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.tab:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "versions": [ + "versions.yml:md5,957a57604ceb366b7af0123738e13559" ] - ] + } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-03-05T12:52:13.125877" + "timestamp": "2024-07-22T20:14:00.135162" }, - "homo_sapiens - single_end - bam": { + "homo_sapiens - paired_end - multiple": { "content": [ + "test.Log.final.out", + "test.Log.out", + "test.Log.progress.out", [ [ { "id": "test", - "single_end": true + "single_end": false }, - "test.Aligned.sortedByCoord.out.bam:md5,e5060a8dd60584378786c588c3f25b4d" + "test.Aligned.sortedByCoord.out.bam:md5,7b20152380dbc52ec23d2e95a7953710" ] - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-05T12:39:59.959658" - }, - "homo_sapiens - paired_end - arriba - wig": { - "content": null, - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-05T11:39:45.663497" - }, - "homo_sapiens - paired_end - log_progress": { - "content": [ + ], [ [ { "id": "test", "single_end": false }, - "test.Log.progress.out:md5,b2bd061d6cbaaf3d6d3b1fed547f69b8" + "test.Aligned.sortedByCoord.out.bam:md5,7b20152380dbc52ec23d2e95a7953710" ] - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-05T12:40:45.630526" - }, - "homo_sapiens - paired_end - arriba - log_final": { - "content": [ - "test.Log.final.out" - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-05T12:48:06.951543" - }, - "homo_sapiens - paired_end - bam_unsorted": { - "content": [ + ], [ - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-05T11:39:28.805957" - }, - "homo_sapiens - paired_end - arriba - sam": { - "content": [ + ], [ - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-05T11:39:45.654389" - }, - "homo_sapiens - paired_end - multiple - bam": { - "content": [ + ], + null, + [ + + ], + [ + + ], + null, + [ + + ], + null, [ [ { "id": "test", "single_end": false }, - "test.Aligned.sortedByCoord.out.bam:md5,7b20152380dbc52ec23d2e95a7953710" + "test.SJ.out.tab:md5,069877e053714e23010fe4e1c003b4a2" ] + ], + null, + [ + "versions.yml:md5,957a57604ceb366b7af0123738e13559" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-03-05T12:52:12.98725" + "timestamp": "2024-07-22T20:12:16.618713" }, - "homo_sapiens - paired_end - multiple - fastq": { + "homo_sapiens - paired_end - stub": { "content": [ - [ - - ] + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Log.final.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Log.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "10": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Chimeric.out.junction:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "11": [ + [ + { + "id": "test", + "single_end": false + }, + "test.out.sam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Log.progress.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + "versions.yml:md5,957a57604ceb366b7af0123738e13559" + ], + "4": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "testXd.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "5": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "6": [ + [ + { + "id": "test", + "single_end": false + }, + "test.toTranscriptome.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "7": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Aligned.unsort.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "8": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.unmapped_1.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test.unmapped_2.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "9": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.ReadsPerGene.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.SJ.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.tab:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "bam": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "testXd.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "bam_sorted": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "bam_transcript": [ + [ + { + "id": "test", + "single_end": false + }, + "test.toTranscriptome.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "bam_unsorted": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Aligned.unsort.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "fastq": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.unmapped_1.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test.unmapped_2.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "junction": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Chimeric.out.junction:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "log_final": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Log.final.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "log_out": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Log.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "log_progress": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Log.progress.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "sam": [ + [ + { + "id": "test", + "single_end": false + }, + "test.out.sam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "tab": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.ReadsPerGene.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.SJ.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.tab:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "versions": [ + "versions.yml:md5,957a57604ceb366b7af0123738e13559" + ] + } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-03-05T11:43:54.445019" + "timestamp": "2024-07-22T20:12:56.326797" }, - "homo_sapiens - single_end - bam_sorted": { + "homo_sapiens - paired_end - starfusion": { "content": [ + "test.Log.final.out", + "test.Log.out", + "test.Log.progress.out", [ [ { "id": "test", - "single_end": true + "single_end": false }, - "test.Aligned.sortedByCoord.out.bam:md5,e5060a8dd60584378786c588c3f25b4d" + "test.Aligned.out.bam:md5,7806e69c537f72e494f9ce8e95f16355" ] - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-05T12:39:59.996165" - }, - "homo_sapiens - paired_end - arriba - bam_sorted": { - "content": [ + ], [ - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-05T11:39:45.637599" - }, - "homo_sapiens - paired_end - starfusion - junction": { - "content": [ + ], + [ + + ], + [ + + ], + null, + [ + + ], [ [ { @@ -637,322 +1189,334 @@ }, "test.Chimeric.out.junction:md5,c6d4d8c641ebb1c152a10da44f0dbf20" ] - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-05T12:44:02.589611" - }, - "homo_sapiens - single_end - tab": { - "content": [ + ], + null, + [ + + ], + null, [ [ { "id": "test", - "single_end": true + "single_end": false }, - "test.SJ.out.tab:md5,75a516ab950fb958f40b29996474949c" + "test.SJ.out.tab:md5,19c3faa1bfa9a0cc5e4c45f17065b53a" ] - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-05T12:40:00.069146" - }, - "homo_sapiens - paired_end - starfusion - versions": { - "content": [ + ], + null, [ "versions.yml:md5,957a57604ceb366b7af0123738e13559" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-03-05T12:44:02.672571" + "timestamp": "2024-07-22T20:10:49.022723" }, - "homo_sapiens - paired_end - multiple - bam_unsorted": { - "content": [ - [ - - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-05T11:43:54.423849" - }, - "homo_sapiens - paired_end - arriba - log_progress": { - "content": [ - "test.Log.progress.out" - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-05T12:48:06.986955" - }, - "homo_sapiens - paired_end - bedgraph": { - "content": null, - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-05T11:39:28.808248" - }, - "homo_sapiens - paired_end - starfusion - bam_unsorted": { - "content": [ - [ - - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-05T11:41:39.247036" - }, - "homo_sapiens - paired_end - starfusion - read_per_gene_tab": { - "content": null, - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-05T11:41:39.285373" - }, - "homo_sapiens - paired_end - multiple - log_progress": { - "content": [ - "test.Log.progress.out" - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-05T12:52:12.923841" - }, - "homo_sapiens - paired_end - arriba - bam_unsorted": { - "content": [ - [ - - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-05T11:39:45.641672" - }, - "homo_sapiens - paired_end - bam_sorted": { + "homo_sapiens - paired_end - arriba": { "content": [ + "test.Log.final.out", + "test.Log.out", + "test.Log.progress.out", [ [ { "id": "test", "single_end": false }, - "test.Aligned.sortedByCoord.out.bam:md5,b6cec9bba6b04b9b92eddbef128bdfbb" + "test.Aligned.out.bam:md5,28ecaa85a5dec1a18c877c85d874adf2" ] - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-05T12:40:45.577077" - }, - "homo_sapiens - single_end - spl_junc_tab": { - "content": null, - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-05T11:39:12.4135" - }, - "homo_sapiens - paired_end - starfusion - spl_junc_tab": { - "content": null, - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-05T11:41:39.298186" - }, - "homo_sapiens - single_end - log_out": { - "content": [ - "test.Log.out" - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-05T12:39:59.921499" - }, - "homo_sapiens - paired_end - log_final": { - "content": [ - "test.Log.final.out" - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-05T12:40:45.485532" - }, - "homo_sapiens - paired_end - bam_transcript": { - "content": [ + ], [ - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-05T11:39:28.803499" - }, - "homo_sapiens - single_end - log_final": { - "content": [ - "test.Log.final.out" - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-05T12:39:59.911473" - }, - "homo_sapiens - paired_end - starfusion - log_progress": { - "content": [ - "test.Log.progress.out" - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-05T12:44:02.502543" - }, - "homo_sapiens - paired_end - multiple - bam_transcript": { - "content": [ + ], [ - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-05T11:43:54.413659" - }, - "homo_sapiens - paired_end - multiple - read_per_gene_tab": { - "content": null, - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-05T11:43:54.462815" - }, - "homo_sapiens - single_end - read_per_gene_tab": { - "content": null, - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-05T11:39:12.409493" - }, - "homo_sapiens - paired_end - junction": { - "content": [ + ], [ - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-05T11:39:28.812836" - }, - "homo_sapiens - paired_end - spl_junc_tab": { - "content": null, - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-05T11:39:28.825946" - }, - "homo_sapiens - paired_end - starfusion - sam": { - "content": [ + ], + null, [ - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-05T11:41:39.291398" - }, - "homo_sapiens - paired_end - arriba - bam": { - "content": [ + ], [ [ { "id": "test", "single_end": false }, - "test.Aligned.out.bam:md5,28ecaa85a5dec1a18c877c85d874adf2" + "test.Chimeric.out.junction:md5,62760fd60371d5bacae324c370358944" ] - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-05T12:48:07.064585" - }, - "homo_sapiens - single_end - log_progress": { - "content": [ + ], + null, + [ + + ], + null, [ [ { "id": "test", - "single_end": true + "single_end": false }, - "test.Log.progress.out:md5,b2bd061d6cbaaf3d6d3b1fed547f69b8" + "test.SJ.out.tab:md5,5155c9fd1f787ad6d7d80987fb06219c" ] + ], + null, + [ + "versions.yml:md5,957a57604ceb366b7af0123738e13559" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-03-05T12:40:00.033267" + "timestamp": "2024-07-22T20:07:19.724256" }, - "homo_sapiens - paired_end - starfusion - wig": { - "content": null, - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-05T11:41:39.311386" - }, - "homo_sapiens - paired_end - wig": { - "content": null, - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-05T11:39:28.830843" - }, - "homo_sapiens - paired_end - starfusion - log_out": { + "homo_sapiens - paired_end - starfusion - stub": { "content": [ - "test.Log.out" + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Log.final.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Log.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "10": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Chimeric.out.junction:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "11": [ + [ + { + "id": "test", + "single_end": false + }, + "test.out.sam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Log.progress.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + "versions.yml:md5,957a57604ceb366b7af0123738e13559" + ], + "4": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "testXd.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "5": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "6": [ + [ + { + "id": "test", + "single_end": false + }, + "test.toTranscriptome.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "7": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Aligned.unsort.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "8": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.unmapped_1.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test.unmapped_2.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "9": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.ReadsPerGene.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.SJ.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.tab:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "bam": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "testXd.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "bam_sorted": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "bam_transcript": [ + [ + { + "id": "test", + "single_end": false + }, + "test.toTranscriptome.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "bam_unsorted": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Aligned.unsort.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "fastq": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.unmapped_1.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test.unmapped_2.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "junction": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Chimeric.out.junction:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "log_final": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Log.final.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "log_out": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Log.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "log_progress": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Log.progress.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "sam": [ + [ + { + "id": "test", + "single_end": false + }, + "test.out.sam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "tab": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.ReadsPerGene.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.SJ.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.tab:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "versions": [ + "versions.yml:md5,957a57604ceb366b7af0123738e13559" + ] + } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-03-05T12:44:02.489254" + "timestamp": "2024-07-22T20:13:37.606866" } } \ No newline at end of file diff --git a/modules/local/star_genomegenerate_igenomes/main.nf b/modules/local/star_genomegenerate_igenomes/main.nf index e36e04179..4e2fcf6bf 100644 --- a/modules/local/star_genomegenerate_igenomes/main.nf +++ b/modules/local/star_genomegenerate_igenomes/main.nf @@ -115,4 +115,5 @@ process STAR_GENOMEGENERATE_IGENOMES { gawk: \$(echo \$(gawk --version 2>&1) | sed 's/^.*GNU Awk //; s/, .*\$//') END_VERSIONS """ - }} + } +} diff --git a/modules/local/star_genomegenerate_igenomes/tests/main.nf.test b/modules/local/star_genomegenerate_igenomes/tests/main.nf.test index aea6305c4..d3bd71891 100644 --- a/modules/local/star_genomegenerate_igenomes/tests/main.nf.test +++ b/modules/local/star_genomegenerate_igenomes/tests/main.nf.test @@ -18,21 +18,21 @@ nextflow_process { then { assertAll( { assert process.success }, - { assert snapshot(file(process.out.index[0][1]).listFiles().collect { it.getName() }.sort().toString()).match("fasta_gtf_index") }, - { assert snapshot(process.out.versions).match("fasta_gtf_versions") } + { assert snapshot( + file(process.out.index[0][1]).listFiles().collect { it.getName() }.sort().toString(), + process.out.versions + ).match() } ) } } - test("fasta with gtf - stub") { - - options '-stub' + test("fasta no gtf") { when { process { """ input[0] = Channel.of([file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)]) - input[1] = Channel.of([file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true)]) + input[1] = Channel.of([ ]) """ } } @@ -40,19 +40,24 @@ nextflow_process { then { assertAll( { assert process.success }, - { assert snapshot(file(process.out.index[0][1]).listFiles().collect { it.getName() }.sort().toString()).match("fasta_gtf_stub_index") }, - { assert snapshot(process.out.versions).match("fasta_gtf_stub_versions") } + { assert snapshot( + file(process.out.index[0][1]).listFiles().collect { it.getName() }.sort().toString(), + process.out.versions + ).match() } ) } + } - test("fasta no gtf") { + test("fasta with gtf - stub") { + + options '-stub' when { process { """ input[0] = Channel.of([file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)]) - input[1] = Channel.of([ ]) + input[1] = Channel.of([file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true)]) """ } } @@ -60,11 +65,9 @@ nextflow_process { then { assertAll( { assert process.success }, - { assert snapshot(file(process.out.index[0][1]).listFiles().collect { it.getName() }.sort().toString()).match("fasta_index") }, - { assert snapshot(process.out.versions).match("fasta_versions") } + { assert snapshot(process.out).match() } ) } - } test("fasta no gtf - stub") { @@ -83,8 +86,7 @@ nextflow_process { then { assertAll( { assert process.success }, - { assert snapshot(file(process.out.index[0][1]).listFiles().collect { it.getName() }.sort().toString()).match("fasta_stub_index") }, - { assert snapshot(process.out.versions).match("fasta_stub_versions") } + { assert snapshot(process.out).match() } ) } } diff --git a/modules/local/star_genomegenerate_igenomes/tests/main.nf.test.snap b/modules/local/star_genomegenerate_igenomes/tests/main.nf.test.snap index 4a3d6e033..1ba924611 100644 --- a/modules/local/star_genomegenerate_igenomes/tests/main.nf.test.snap +++ b/modules/local/star_genomegenerate_igenomes/tests/main.nf.test.snap @@ -1,90 +1,128 @@ { - "fasta_gtf_versions": { + "fasta with gtf": { "content": [ + "[]", [ "versions.yml:md5,562a70f12dd9e695449b59fbf604e98d" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-03-05T10:28:05.069709" + "timestamp": "2024-07-22T20:14:17.250178" }, - "fasta_stub_versions": { + "fasta no gtf - stub": { "content": [ - [ - "versions.yml:md5,562a70f12dd9e695449b59fbf604e98d" - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-05T10:31:12.153651" - }, - "fasta_gtf_stub_index": { - "content": [ - "[]" - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-05T10:28:16.309869" - }, - "fasta_gtf_stub_versions": { - "content": [ - [ - "versions.yml:md5,562a70f12dd9e695449b59fbf604e98d" - ] + { + "0": [ + [ + "Genome:md5,d41d8cd98f00b204e9800998ecf8427e", + "Log.out:md5,d41d8cd98f00b204e9800998ecf8427e", + "SA:md5,d41d8cd98f00b204e9800998ecf8427e", + "SAindex:md5,d41d8cd98f00b204e9800998ecf8427e", + "chrLength.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "chrName.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "chrNameLength.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "chrStart.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "genomeParameters.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + "versions.yml:md5,562a70f12dd9e695449b59fbf604e98d" + ], + "index": [ + [ + "Genome:md5,d41d8cd98f00b204e9800998ecf8427e", + "Log.out:md5,d41d8cd98f00b204e9800998ecf8427e", + "SA:md5,d41d8cd98f00b204e9800998ecf8427e", + "SAindex:md5,d41d8cd98f00b204e9800998ecf8427e", + "chrLength.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "chrName.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "chrNameLength.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "chrStart.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "genomeParameters.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,562a70f12dd9e695449b59fbf604e98d" + ] + } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-03-05T10:28:16.337298" + "timestamp": "2024-07-22T20:15:09.671637" }, - "fasta_index": { - "content": [ - "[]" - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-05T10:30:56.504744" - }, - "fasta_versions": { + "fasta no gtf": { "content": [ + "[]", [ "versions.yml:md5,562a70f12dd9e695449b59fbf604e98d" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-05T10:30:56.575367" - }, - "fasta_gtf_index": { - "content": [ - "[]" - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-03-05T10:28:05.031195" + "timestamp": "2024-07-22T20:14:35.674278" }, - "fasta_stub_index": { + "fasta with gtf - stub": { "content": [ - "[]" + { + "0": [ + [ + "Genome:md5,d41d8cd98f00b204e9800998ecf8427e", + "Log.out:md5,d41d8cd98f00b204e9800998ecf8427e", + "SA:md5,d41d8cd98f00b204e9800998ecf8427e", + "SAindex:md5,d41d8cd98f00b204e9800998ecf8427e", + "chrLength.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "chrName.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "chrNameLength.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "chrStart.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "exonGeTrInfo.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "exonInfo.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "geneInfo.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "genomeParameters.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "sjdbInfo.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "sjdbList.fromGTF.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "sjdbList.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "transcriptInfo.tab:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + "versions.yml:md5,562a70f12dd9e695449b59fbf604e98d" + ], + "index": [ + [ + "Genome:md5,d41d8cd98f00b204e9800998ecf8427e", + "Log.out:md5,d41d8cd98f00b204e9800998ecf8427e", + "SA:md5,d41d8cd98f00b204e9800998ecf8427e", + "SAindex:md5,d41d8cd98f00b204e9800998ecf8427e", + "chrLength.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "chrName.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "chrNameLength.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "chrStart.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "exonGeTrInfo.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "exonInfo.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "geneInfo.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "genomeParameters.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "sjdbInfo.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "sjdbList.fromGTF.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "sjdbList.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "transcriptInfo.tab:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,562a70f12dd9e695449b59fbf604e98d" + ] + } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-03-05T10:31:12.12097" + "timestamp": "2024-07-22T20:14:52.732323" } } \ No newline at end of file diff --git a/modules/nf-core/bbmap/bbsplit/main.nf b/modules/nf-core/bbmap/bbsplit/main.nf index 57bf6398a..f308f6983 100644 --- a/modules/nf-core/bbmap/bbsplit/main.nf +++ b/modules/nf-core/bbmap/bbsplit/main.nf @@ -54,7 +54,6 @@ process BBMAP_BBSPLIT { log.error 'ERROR: Please specify as input a primary fasta file along with names and paths to non-primary fasta files.' } } else { - index_files = '' if (index) { index_files = "path=$index" } else if (primary_ref && other_ref_names && other_ref_paths) { @@ -109,14 +108,19 @@ process BBMAP_BBSPLIT { def prefix = task.ext.prefix ?: "${meta.id}" def other_refs = '' other_ref_names.eachWithIndex { name, index -> - other_refs += "echo '' | gzip > ${prefix}_primary_${name}.fastq.gz" + other_refs += "echo '' | gzip > ${prefix}_${name}.fastq.gz" } """ - mkdir bbsplit + if [ ! -d bbsplit ]; then + mkdir bbsplit + fi + + if ! (${only_build_index}); then + echo '' | gzip > ${prefix}_primary.fastq.gz + ${other_refs} + touch ${prefix}.stats.txt + fi - echo '' | gzip > ${prefix}_primary.fastq.gz - ${other_refs} - touch ${prefix}.stats.txt touch ${prefix}.log cat <<-END_VERSIONS > versions.yml diff --git a/modules/nf-core/bbmap/bbsplit/tests/main.nf.test b/modules/nf-core/bbmap/bbsplit/tests/main.nf.test index b878366b3..0674d247f 100644 --- a/modules/nf-core/bbmap/bbsplit/tests/main.nf.test +++ b/modules/nf-core/bbmap/bbsplit/tests/main.nf.test @@ -3,20 +3,13 @@ nextflow_process { name "Test Process BBMAP_BBSPLIT" script "../main.nf" process "BBMAP_BBSPLIT" - tag "modules" - tag "modules_nfcore" - tag "bbmap" - tag "bbmap/bbsplit" test("sarscov2_se_fastq_fasta_chr22_fasta - index") { when { - params { - outdir = "$outputDir" - } process { """ - input[0] = [[:],[]] + input[0] = [[:], []] input[1] = [] input[2] = Channel.of(file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)) input[3] = Channel.of([ @@ -43,12 +36,9 @@ nextflow_process { options "-stub" when { - params { - outdir = "$outputDir" - } process { """ - input[0] = [[:],[]] + input[0] = [[:], []] input[1] = [] input[2] = Channel.of(file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)) input[3] = Channel.of([ @@ -76,7 +66,7 @@ nextflow_process { script "../main.nf" process { """ - input[0] = [[:],[]] + input[0] = [[:], []] input[1] = [] input[2] = Channel.of(file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)) input[3] = Channel.of([ @@ -90,9 +80,6 @@ nextflow_process { } when { - params { - outdir = "$outputDir" - } process { """ input[0] = Channel.of([ @@ -142,9 +129,11 @@ nextflow_process { assertAll( { assert process.success }, { assert path(process.out.log[0][1]).text.contains("If you wish to regenerate the index") }, - { assert snapshot(filteredFiles).match("bbsplit_index_filtered_files")}, { assert filesExist : "One or more files to exclude do not exist" }, - { assert snapshot(process.out.versions).match("versions")} + { assert snapshot( + filteredFiles, + process.out.versions + ).match()} ) } } @@ -153,17 +142,33 @@ nextflow_process { options "-stub" - when { - params { - outdir = "$outputDir" + setup { + + run("BBMAP_BBSPLIT", alias: "BBMAP_BBSPLIT_INDEX") { + script "../main.nf" + process { + """ + input[0] = [[:], []] + input[1] = [] + input[2] = Channel.of(file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)) + input[3] = Channel.of([ + [ 'human' ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr22/sequence/chr22_23800000-23980000.fa', checkIfExists: true) + ]) + input[4] = true + """ + } } + } + + when { process { """ input[0] = Channel.of([ [ id:'test', single_end:true ], // meta map file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ]) - input[1] = [] + input[1] = BBMAP_BBSPLIT_INDEX.out.index input[2] = Channel.of(file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)) input[3] = Channel.of([ [ 'human' ], // meta map diff --git a/modules/nf-core/bbmap/bbsplit/tests/main.nf.test.snap b/modules/nf-core/bbmap/bbsplit/tests/main.nf.test.snap index 6a4889aaa..0d648d7d6 100644 --- a/modules/nf-core/bbmap/bbsplit/tests/main.nf.test.snap +++ b/modules/nf-core/bbmap/bbsplit/tests/main.nf.test.snap @@ -1,5 +1,5 @@ { - "bbsplit_index_filtered_files": { + "sarscov2_se_fastq_fasta_chr22_fasta": { "content": [ [ "chr1.chrom.gz:md5,8fec4c63ec642613ad10adf4cc2e6ade", @@ -7,25 +7,16 @@ "chr1_index_k13_c13_b1.block2.gz:md5,2556b45206835a0ff7078d683b5fd6e2", "merged_ref_9222711925172838098.fa.gz:md5,983cef447fb28394b88a5b49b3579f0c", "namelist.txt:md5,45e7a4cdc7a11a39ada56844ca3a1e30" - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" - }, - "timestamp": "2024-02-01T17:15:59.705013452" - }, - "versions": { - "content": [ + ], [ "versions.yml:md5,cb7f0e697ab2537f8ced951bfade90d4" ] ], "meta": { "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nextflow": "24.04.2" }, - "timestamp": "2024-02-01T17:11:22.441753642" + "timestamp": "2024-07-05T11:41:32.116928" }, "sarscov2_se_fastq_fasta_chr22_fasta - index": { "content": [ @@ -37,7 +28,7 @@ "nf-test": "0.8.4", "nextflow": "24.04.2" }, - "timestamp": "2024-06-20T16:41:29.784895" + "timestamp": "2024-07-05T11:41:06.072212" }, "sarscov2_se_fastq_fasta_chr22_fasta - index - stub": { "content": [ @@ -48,34 +39,13 @@ ] ], "1": [ - [ - { - - }, - [ - "null_primary.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", - "null_primary_human.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ] + ], "2": [ - [ - { - - }, - [ - "null_primary.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", - "null_primary_human.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ] + ], "3": [ - [ - { - - }, - "null.stats.txt:md5,d41d8cd98f00b204e9800998ecf8427e" - ] + ], "4": [ [ @@ -89,15 +59,7 @@ "versions.yml:md5,cb7f0e697ab2537f8ced951bfade90d4" ], "all_fastq": [ - [ - { - - }, - [ - "null_primary.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", - "null_primary_human.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ] + ], "index": [ [ @@ -113,23 +75,10 @@ ] ], "primary_fastq": [ - [ - { - - }, - [ - "null_primary.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", - "null_primary_human.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ] + ], "stats": [ - [ - { - - }, - "null.stats.txt:md5,d41d8cd98f00b204e9800998ecf8427e" - ] + ], "versions": [ "versions.yml:md5,cb7f0e697ab2537f8ced951bfade90d4" @@ -140,7 +89,7 @@ "nf-test": "0.8.4", "nextflow": "24.04.2" }, - "timestamp": "2024-06-20T18:49:27.280432" + "timestamp": "2024-07-05T11:45:21.48352" }, "sarscov2_se_fastq_fasta_chr22_fasta - stub": { "content": [ @@ -156,10 +105,7 @@ "id": "test", "single_end": true }, - [ - "test_primary.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", - "test_primary_human.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] + "test_primary.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" ] ], "2": [ @@ -169,8 +115,8 @@ "single_end": true }, [ - "test_primary.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", - "test_primary_human.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + "test_human.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test_primary.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" ] ] ], @@ -202,8 +148,8 @@ "single_end": true }, [ - "test_primary.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", - "test_primary_human.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + "test_human.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test_primary.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" ] ] ], @@ -227,10 +173,7 @@ "id": "test", "single_end": true }, - [ - "test_primary.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", - "test_primary_human.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] + "test_primary.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" ] ], "stats": [ @@ -251,6 +194,6 @@ "nf-test": "0.8.4", "nextflow": "24.04.2" }, - "timestamp": "2024-06-20T16:16:05.793544" + "timestamp": "2024-07-05T11:51:38.805111" } } \ No newline at end of file diff --git a/modules/nf-core/bedtools/genomecov/tests/main.nf.test b/modules/nf-core/bedtools/genomecov/tests/main.nf.test index 16a03492c..b8caa1e11 100644 --- a/modules/nf-core/bedtools/genomecov/tests/main.nf.test +++ b/modules/nf-core/bedtools/genomecov/tests/main.nf.test @@ -4,11 +4,6 @@ nextflow_process { process "BEDTOOLS_GENOMECOV" config "./nextflow.config" - tag "modules" - tag "modules_nfcore" - tag "bedtools" - tag "bedtools/genomecov" - test("sarscov2 - no scale") { when { process { diff --git a/modules/nf-core/cat/fastq/main.nf b/modules/nf-core/cat/fastq/main.nf index f132b2adc..b68e5f911 100644 --- a/modules/nf-core/cat/fastq/main.nf +++ b/modules/nf-core/cat/fastq/main.nf @@ -53,9 +53,9 @@ process CAT_FASTQ { def prefix = task.ext.prefix ?: "${meta.id}" def readList = reads instanceof List ? reads.collect{ it.toString() } : [reads.toString()] if (meta.single_end) { - if (readList.size > 1) { + if (readList.size >= 1) { """ - touch ${prefix}.merged.fastq.gz + echo '' | gzip > ${prefix}.merged.fastq.gz cat <<-END_VERSIONS > versions.yml "${task.process}": @@ -64,10 +64,10 @@ process CAT_FASTQ { """ } } else { - if (readList.size > 2) { + if (readList.size >= 2) { """ - touch ${prefix}_1.merged.fastq.gz - touch ${prefix}_2.merged.fastq.gz + echo '' | gzip > ${prefix}_1.merged.fastq.gz + echo '' | gzip > ${prefix}_2.merged.fastq.gz cat <<-END_VERSIONS > versions.yml "${task.process}": diff --git a/modules/nf-core/cat/fastq/tests/main.nf.test b/modules/nf-core/cat/fastq/tests/main.nf.test index 7236c6cd9..6cc7aad15 100644 --- a/modules/nf-core/cat/fastq/tests/main.nf.test +++ b/modules/nf-core/cat/fastq/tests/main.nf.test @@ -9,9 +9,6 @@ nextflow_process { test("test_cat_fastq_single_end") { when { - params { - outdir = "$outputDir" - } process { """ input[0] = Channel.of([ @@ -34,9 +31,6 @@ nextflow_process { test("test_cat_fastq_paired_end") { when { - params { - outdir = "$outputDir" - } process { """ input[0] = Channel.of([ @@ -61,9 +55,6 @@ nextflow_process { test("test_cat_fastq_single_end_same_name") { when { - params { - outdir = "$outputDir" - } process { """ input[0] = Channel.of([ @@ -86,9 +77,6 @@ nextflow_process { test("test_cat_fastq_paired_end_same_name") { when { - params { - outdir = "$outputDir" - } process { """ input[0] = Channel.of([ @@ -113,9 +101,129 @@ nextflow_process { test("test_cat_fastq_single_end_single_file") { when { - params { - outdir = "$outputDir" + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:true ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true)] + ]) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("test_cat_fastq_single_end - stub") { + + options "-stub" + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:true ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)] + ]) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("test_cat_fastq_paired_end - stub") { + + options "-stub" + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test2_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test2_2.fastq.gz', checkIfExists: true)] + ]) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("test_cat_fastq_single_end_same_name - stub") { + + options "-stub" + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:true ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true)] + ]) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("test_cat_fastq_paired_end_same_name - stub") { + + options "-stub" + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)] + ]) + """ } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("test_cat_fastq_single_end_single_file - stub") { + + options "-stub" + + when { process { """ input[0] = Channel.of([ diff --git a/modules/nf-core/cat/fastq/tests/main.nf.test.snap b/modules/nf-core/cat/fastq/tests/main.nf.test.snap index 43dfe28fc..aec119a94 100644 --- a/modules/nf-core/cat/fastq/tests/main.nf.test.snap +++ b/modules/nf-core/cat/fastq/tests/main.nf.test.snap @@ -28,6 +28,10 @@ ] } ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, "timestamp": "2024-01-17T17:30:39.816981" }, "test_cat_fastq_single_end_same_name": { @@ -59,6 +63,10 @@ ] } ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, "timestamp": "2024-01-17T17:32:35.229332" }, "test_cat_fastq_single_end_single_file": { @@ -90,6 +98,10 @@ ] } ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, "timestamp": "2024-01-17T17:34:00.058829" }, "test_cat_fastq_paired_end_same_name": { @@ -127,8 +139,123 @@ ] } ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, "timestamp": "2024-01-17T17:33:33.031555" }, + "test_cat_fastq_single_end - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": true + }, + "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ], + "1": [ + "versions.yml:md5,d42d6e24d67004608495883e00bd501b" + ], + "reads": [ + [ + { + "id": "test", + "single_end": true + }, + "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ], + "versions": [ + "versions.yml:md5,d42d6e24d67004608495883e00bd501b" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-07-05T12:07:28.244999" + }, + "test_cat_fastq_paired_end_same_name - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test_2.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "1": [ + "versions.yml:md5,d42d6e24d67004608495883e00bd501b" + ], + "reads": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test_2.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "versions": [ + "versions.yml:md5,d42d6e24d67004608495883e00bd501b" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-07-05T12:07:57.070911" + }, + "test_cat_fastq_single_end_same_name - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": true + }, + "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ], + "1": [ + "versions.yml:md5,d42d6e24d67004608495883e00bd501b" + ], + "reads": [ + [ + { + "id": "test", + "single_end": true + }, + "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ], + "versions": [ + "versions.yml:md5,d42d6e24d67004608495883e00bd501b" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-07-05T12:07:46.796254" + }, "test_cat_fastq_paired_end": { "content": [ { @@ -164,6 +291,86 @@ ] } ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, "timestamp": "2024-01-17T17:32:02.270935" + }, + "test_cat_fastq_paired_end - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test_2.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "1": [ + "versions.yml:md5,d42d6e24d67004608495883e00bd501b" + ], + "reads": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test_2.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "versions": [ + "versions.yml:md5,d42d6e24d67004608495883e00bd501b" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-07-05T12:07:37.807553" + }, + "test_cat_fastq_single_end_single_file - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": true + }, + "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ], + "1": [ + "versions.yml:md5,d42d6e24d67004608495883e00bd501b" + ], + "reads": [ + [ + { + "id": "test", + "single_end": true + }, + "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ], + "versions": [ + "versions.yml:md5,d42d6e24d67004608495883e00bd501b" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-07-05T12:14:51.861264" } } \ No newline at end of file diff --git a/modules/nf-core/custom/catadditionalfasta/tests/main.nf.test b/modules/nf-core/custom/catadditionalfasta/tests/main.nf.test index 70227f1c5..878c05d16 100644 --- a/modules/nf-core/custom/catadditionalfasta/tests/main.nf.test +++ b/modules/nf-core/custom/catadditionalfasta/tests/main.nf.test @@ -26,9 +26,11 @@ nextflow_process { then { assertAll( { assert process.success }, - { assert snapshot(process.out.fasta).match("fasta") }, - { assert snapshot(process.out.gtf).match("gtf") }, - { assert snapshot(process.out.versions).match("versions") } + { assert snapshot( + process.out.fasta, + process.out.gtf, + process.out.versions + ).match() } ) } } diff --git a/modules/nf-core/custom/catadditionalfasta/tests/main.nf.test.snap b/modules/nf-core/custom/catadditionalfasta/tests/main.nf.test.snap index 9e49a90c9..4767fd9a0 100644 --- a/modules/nf-core/custom/catadditionalfasta/tests/main.nf.test.snap +++ b/modules/nf-core/custom/catadditionalfasta/tests/main.nf.test.snap @@ -1,17 +1,5 @@ { - "versions": { - "content": [ - [ - "versions.yml:md5,26f47339777a265af57338ac7f0f8798" - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" - }, - "timestamp": "2023-12-20T20:52:55.242485" - }, - "gtf": { + "sarscov2 - fastq - gtf": { "content": [ [ [ @@ -19,33 +7,27 @@ "id": "test", "single_end": false }, - "genome_transcriptome.gtf:md5,bc88d95e7f27540e6b9906105d5be361" + "genome_transcriptome.fasta:md5,6a20c1a2e465519320a0d01f338f5cb5" ] - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" - }, - "timestamp": "2023-12-20T19:46:31.839377" - }, - "fasta": { - "content": [ + ], [ [ { "id": "test", "single_end": false }, - "genome_transcriptome.fasta:md5,6a20c1a2e465519320a0d01f338f5cb5" + "genome_transcriptome.gtf:md5,bc88d95e7f27540e6b9906105d5be361" ] + ], + [ + "versions.yml:md5,26f47339777a265af57338ac7f0f8798" ] ], "meta": { "nf-test": "0.8.4", "nextflow": "24.04.2" }, - "timestamp": "2023-12-20T19:42:47.12194" + "timestamp": "2024-07-05T12:19:28.965471" }, "sarscov2 - fastq - gtf - stub": { "content": [ @@ -98,6 +80,6 @@ "nf-test": "0.8.4", "nextflow": "24.04.2" }, - "timestamp": "2024-06-20T17:10:38.966949" + "timestamp": "2024-07-05T12:19:38.549677" } } \ No newline at end of file diff --git a/modules/nf-core/custom/getchromsizes/main.nf b/modules/nf-core/custom/getchromsizes/main.nf index 581f4b77d..3edf7c221 100644 --- a/modules/nf-core/custom/getchromsizes/main.nf +++ b/modules/nf-core/custom/getchromsizes/main.nf @@ -35,6 +35,9 @@ process CUSTOM_GETCHROMSIZES { """ touch ${fasta}.fai touch ${fasta}.sizes + if [[ "${fasta.extension}" == "gz" ]]; then + touch ${fasta}.gzi + fi cat <<-END_VERSIONS > versions.yml "${task.process}": diff --git a/modules/nf-core/custom/getchromsizes/tests/main.nf.test b/modules/nf-core/custom/getchromsizes/tests/main.nf.test index 3b18914b1..2dadc1a55 100644 --- a/modules/nf-core/custom/getchromsizes/tests/main.nf.test +++ b/modules/nf-core/custom/getchromsizes/tests/main.nf.test @@ -7,9 +7,6 @@ nextflow_process { test("test_custom_getchromsizes") { when { - params { - outdir = "$outputDir" - } process { """ input[0] = Channel.of([ @@ -26,15 +23,11 @@ nextflow_process { { assert snapshot(process.out).match() } ) } - } test("test_custom_getchromsizes_bgzip") { when { - params { - outdir = "$outputDir" - } process { """ input[0] = Channel.of([ @@ -51,7 +44,51 @@ nextflow_process { { assert snapshot(process.out).match() } ) } + } + + test("test_custom_getchromsizes - stub") { + + options "-stub" + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test' ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ]) + """ + } + } + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } } + test("test_custom_getchromsizes_bgzip - stub") { + + options "-stub" + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test' ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.gz', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } } diff --git a/modules/nf-core/custom/getchromsizes/tests/main.nf.test.snap b/modules/nf-core/custom/getchromsizes/tests/main.nf.test.snap index 3c53d4624..c37b284d7 100644 --- a/modules/nf-core/custom/getchromsizes/tests/main.nf.test.snap +++ b/modules/nf-core/custom/getchromsizes/tests/main.nf.test.snap @@ -1,4 +1,69 @@ { + "test_custom_getchromsizes_bgzip - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "genome.fasta.gz.sizes:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test" + }, + "genome.fasta.gz.fai:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + [ + { + "id": "test" + }, + "genome.fasta.gz.gzi:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + "versions.yml:md5,0d5a7c33bddcb1edad6bf0705b258e6f" + ], + "fai": [ + [ + { + "id": "test" + }, + "genome.fasta.gz.fai:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "gzi": [ + [ + { + "id": "test" + }, + "genome.fasta.gz.gzi:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "sizes": [ + [ + { + "id": "test" + }, + "genome.fasta.gz.sizes:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,0d5a7c33bddcb1edad6bf0705b258e6f" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-07-05T12:38:36.927106" + }, "test_custom_getchromsizes": { "content": [ { @@ -118,5 +183,60 @@ "nextflow": "24.04.2" }, "timestamp": "2024-06-20T13:23:06.241379" + }, + "test_custom_getchromsizes - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "genome.fasta.sizes:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test" + }, + "genome.fasta.fai:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + + ], + "3": [ + "versions.yml:md5,0d5a7c33bddcb1edad6bf0705b258e6f" + ], + "fai": [ + [ + { + "id": "test" + }, + "genome.fasta.fai:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "gzi": [ + + ], + "sizes": [ + [ + { + "id": "test" + }, + "genome.fasta.sizes:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,0d5a7c33bddcb1edad6bf0705b258e6f" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-07-05T12:24:05.697845" } } \ No newline at end of file diff --git a/modules/nf-core/custom/tx2gene/tests/main.nf.test b/modules/nf-core/custom/tx2gene/tests/main.nf.test index 8a7a6d1b2..e56a0b8fe 100644 --- a/modules/nf-core/custom/tx2gene/tests/main.nf.test +++ b/modules/nf-core/custom/tx2gene/tests/main.nf.test @@ -4,22 +4,21 @@ nextflow_process { script "../main.nf" process "CUSTOM_TX2GENE" - setup { + test("saccharomyces_cerevisiae - gtf") { - run("UNTAR") { - script "../../../untar/main.nf" - process { - """ - input[0] = Channel.of([ - [ id:'test'], // meta map - file(params.modules_testdata_base_path + 'genomics/eukaryotes/saccharomyces_cerevisiae/kallisto_results.tar.gz', checkIfExists: true) - ]) - """ + setup { + run("UNTAR") { + script "../../../untar/main.nf" + process { + """ + input[0] = Channel.of([ + [ id:'test'], // meta map + file(params.modules_testdata_base_path + 'genomics/eukaryotes/saccharomyces_cerevisiae/kallisto_results.tar.gz', checkIfExists: true) + ]) + """ + } } } - } - - test("saccharomyces_cerevisiae - gtf") { when { process { @@ -39,8 +38,7 @@ nextflow_process { then { assertAll( { assert process.success }, - { assert snapshot(process.out.tx2gene).match('tx2gene') }, - { assert snapshot(process.out.versions).match('versions') } + { assert snapshot(process.out).match() } ) } } @@ -49,6 +47,20 @@ nextflow_process { options "-stub" + setup { + run("UNTAR") { + script "../../../untar/main.nf" + process { + """ + input[0] = Channel.of([ + [ id:'test'], // meta map + file(params.modules_testdata_base_path + 'genomics/eukaryotes/saccharomyces_cerevisiae/kallisto_results.tar.gz', checkIfExists: true) + ]) + """ + } + } + } + when { process { """ @@ -67,8 +79,7 @@ nextflow_process { then { assertAll( { assert process.success }, - { assert snapshot(process.out.tx2gene).match('tx2gene - stub') }, - { assert snapshot(process.out.versions).match('versions - stub') } + { assert snapshot(process.out).match() } ) } } diff --git a/modules/nf-core/custom/tx2gene/tests/main.nf.test.snap b/modules/nf-core/custom/tx2gene/tests/main.nf.test.snap index 1e76e10d6..c19f10f71 100644 --- a/modules/nf-core/custom/tx2gene/tests/main.nf.test.snap +++ b/modules/nf-core/custom/tx2gene/tests/main.nf.test.snap @@ -1,60 +1,68 @@ { - "versions": { + "saccharomyces_cerevisiae - gtf": { "content": [ - [ - "versions.yml:md5,fb8145d7fbc6043ba031249b23ecda50" - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-02-26T13:14:18.218251" - }, - "tx2gene": { - "content": [ - [ - [ - { - "id": "test" - }, - "test.tx2gene.tsv:md5,0e2418a69d2eba45097ebffc2f700bfe" + { + "0": [ + [ + { + "id": "test" + }, + "test.tx2gene.tsv:md5,0e2418a69d2eba45097ebffc2f700bfe" + ] + ], + "1": [ + "versions.yml:md5,fb8145d7fbc6043ba031249b23ecda50" + ], + "tx2gene": [ + [ + { + "id": "test" + }, + "test.tx2gene.tsv:md5,0e2418a69d2eba45097ebffc2f700bfe" + ] + ], + "versions": [ + "versions.yml:md5,fb8145d7fbc6043ba031249b23ecda50" ] - ] + } ], "meta": { "nf-test": "0.8.4", - "nextflow": "24.01.0" + "nextflow": "24.04.2" }, - "timestamp": "2024-02-26T13:14:18.21054" + "timestamp": "2024-07-05T13:13:11.305047" }, - "tx2gene - stub": { + "saccharomyces_cerevisiae - gtf - stub": { "content": [ - [ - [ - { - "id": "test" - }, - "test.tx2gene.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + { + "0": [ + [ + { + "id": "test" + }, + "test.tx2gene.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + "versions.yml:md5,5613eefbca41377128f1d8dc09b9fb60" + ], + "tx2gene": [ + [ + { + "id": "test" + }, + "test.tx2gene.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,5613eefbca41377128f1d8dc09b9fb60" ] - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-02-26T13:14:25.915434" - }, - "versions - stub": { - "content": [ - [ - "versions.yml:md5,5613eefbca41377128f1d8dc09b9fb60" - ] + } ], "meta": { "nf-test": "0.8.4", - "nextflow": "24.01.0" + "nextflow": "24.04.3" }, - "timestamp": "2024-02-26T13:14:25.919243" + "timestamp": "2024-07-10T15:15:34.064489" } } \ No newline at end of file diff --git a/modules/nf-core/dupradar/templates/dupradar.r b/modules/nf-core/dupradar/templates/dupradar.r index 7653e5873..cbaeded13 100755 --- a/modules/nf-core/dupradar/templates/dupradar.r +++ b/modules/nf-core/dupradar/templates/dupradar.r @@ -88,6 +88,7 @@ line="#id: DupInt # max: 100 # min: 0 # scale: 'RdYlGn-rev' +# format: '{:.2f}%' Sample dupRadar_intercept" write(line,file=paste0(output_prefix, "_dup_intercept_mqc.txt"),append=TRUE) @@ -114,21 +115,21 @@ line="#id: dupradar # This plot shows the general linear models - a summary of the gene duplication distributions. \" #pconfig: # title: 'DupRadar General Linear Model' -# xlog: True +# xLog: True # xlab: 'expression (reads/kbp)' # ylab: '% duplicate reads' # ymax: 100 # ymin: 0 # tt_label: '{point.x:.1f} reads/kbp: {point.y:,.2f}% duplicates' -# x_lines: +# xPlotLines: # - color: 'green' -# dash: 'LongDash' +# dashStyle: 'LongDash' # label: # text: '0.5 RPKM' # value: 0.5 # width: 1 # - color: 'red' -# dash: 'LongDash' +# dashStyle: 'LongDash' # label: # text: '1 read/bp' # value: 1000 diff --git a/modules/nf-core/dupradar/tests/tags.yml b/modules/nf-core/dupradar/tests/tags.yml deleted file mode 100644 index 255dc4ef3..000000000 --- a/modules/nf-core/dupradar/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -dupradar: - - "modules/nf-core/dupradar/**" diff --git a/modules/nf-core/fastp/main.nf b/modules/nf-core/fastp/main.nf index df60ff61e..e1b9f5656 100644 --- a/modules/nf-core/fastp/main.nf +++ b/modules/nf-core/fastp/main.nf @@ -106,14 +106,16 @@ process FASTP { stub: def prefix = task.ext.prefix ?: "${meta.id}" def is_single_output = task.ext.args?.contains('--interleaved_in') || meta.single_end - def touch_reads = (is_single_output && !discard_trimmed_pass) ? "echo '' | gzip > ${prefix}.fastp.fastq.gz" : "echo '' | gzip > ${prefix}_1.fastp.fastq.gz ; echo '' | gzip > ${prefix}_2.fastp.fastq.gz" + def touch_reads = (discard_trimmed_pass) ? "" : (is_single_output) ? "echo '' | gzip > ${prefix}.fastp.fastq.gz" : "echo '' | gzip > ${prefix}_1.fastp.fastq.gz ; echo '' | gzip > ${prefix}_2.fastp.fastq.gz" def touch_merged = (!is_single_output && save_merged) ? "echo '' | gzip > ${prefix}.merged.fastq.gz" : "" + def touch_fail_fastq = (!save_trimmed_fail) ? "" : meta.single_end ? "echo '' | gzip > ${prefix}.fail.fastq.gz" : "echo '' | gzip > ${prefix}.paired.fail.fastq.gz ; echo '' | gzip > ${prefix}_1.fail.fastq.gz ; echo '' | gzip > ${prefix}_2.fail.fastq.gz" """ $touch_reads + $touch_fail_fastq + $touch_merged touch "${prefix}.fastp.json" touch "${prefix}.fastp.html" touch "${prefix}.fastp.log" - $touch_merged cat <<-END_VERSIONS > versions.yml "${task.process}": diff --git a/modules/nf-core/fastp/tests/main.nf.test b/modules/nf-core/fastp/tests/main.nf.test index ed5fa5ed6..c4e119aff 100644 --- a/modules/nf-core/fastp/tests/main.nf.test +++ b/modules/nf-core/fastp/tests/main.nf.test @@ -25,28 +25,33 @@ nextflow_process { then { assertAll( { assert process.success }, + { assert path(process.out.html.get(0).get(1)).getText().contains("single end (151 cycles)") }, + { assert path(process.out.log.get(0).get(1)).getText().contains("reads passed filter: 99") }, { assert snapshot( - process.out.reads, process.out.json, - process.out.versions).match() }, - { assert process.out.reads_fail == [] }, - { assert process.out.reads_merged == [] }, - { assert path(process.out.log.get(0).get(1)).getText().contains("reads passed filter: 99") }, - { assert path(process.out.html.get(0).get(1)).getText().contains("single end (151 cycles)") } + process.out.reads, + process.out.reads_fail, + process.out.reads_merged, + process.out.versions).match() } ) } } - test("test_fastp_single_end-stub") { - - options '-stub' + test("test_fastp_paired_end") { when { + process { """ + adapter_fasta = [] + save_trimmed_pass = true + save_trimmed_fail = false + save_merged = false + input[0] = Channel.of([ - [ id:'test', single_end:true ], - [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ] + [ id:'test', single_end:false ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ] ]) input[1] = [] input[2] = false @@ -57,29 +62,29 @@ nextflow_process { } then { - assertAll( { assert process.success }, - { assert snapshot(process.out).match() } + { assert path(process.out.html.get(0).get(1)).getText().contains("The input has little adapter percentage (~0.000000%), probably it's trimmed before.") }, + { assert path(process.out.log.get(0).get(1)).getText().contains("Q30 bases: 12281(88.3716%)") }, + { assert snapshot( + process.out.json, + process.out.reads, + process.out.reads_fail, + process.out.reads_merged, + process.out.versions).match() } ) } } - test("test_fastp_paired_end") { + test("fastp test_fastp_interleaved") { + config './nextflow.interleaved.config' when { - process { """ - adapter_fasta = [] - save_trimmed_pass = true - save_trimmed_fail = false - save_merged = false - input[0] = Channel.of([ - [ id:'test', single_end:false ], // meta map - [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ] + [ id:'test', single_end:true ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_interleaved.fastq.gz', checkIfExists: true) ] ]) input[1] = [] input[2] = false @@ -92,34 +97,31 @@ nextflow_process { then { assertAll( { assert process.success }, + { assert path(process.out.html.get(0).get(1)).getText().contains("paired end (151 cycles + 151 cycles)") }, + { assert path(process.out.log.get(0).get(1)).getText().contains("reads passed filter: 162") }, + { assert process.out.reads_fail == [] }, + { assert process.out.reads_merged == [] }, { assert snapshot( process.out.reads, process.out.json, - process.out.versions).match() }, - { assert process.out.reads_fail == [] }, - { assert process.out.reads_merged == [] }, - { assert path(process.out.log.get(0).get(1)).getText().contains("Q30 bases: 12281(88.3716%)") }, - { assert path(process.out.html.get(0).get(1)).getText().contains("The input has little adapter percentage (~0.000000%), probably it's trimmed before.") } + process.out.versions).match() } ) } } - test("test_fastp_paired_end - stub") { - - options '-stub' + test("test_fastp_single_end_trim_fail") { when { process { """ input[0] = Channel.of([ - [ id:'test', single_end:false ], // meta map - [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ] + [ id:'test', single_end:true ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ] ]) input[1] = [] input[2] = false - input[3] = false + input[3] = true input[4] = false """ } @@ -128,24 +130,32 @@ nextflow_process { then { assertAll( { assert process.success }, - { assert snapshot(process.out).match() }, + { assert path(process.out.html.get(0).get(1)).getText().contains("single end (151 cycles)") }, + { assert path(process.out.log.get(0).get(1)).getText().contains("reads passed filter: 99") }, + { assert snapshot( + process.out.json, + process.out.reads, + process.out.reads_fail, + process.out.reads_merged, + process.out.versions).match() } ) } } - test("fastp test_fastp_interleaved") { + test("test_fastp_paired_end_trim_fail") { - config './nextflow.interleaved.config' + config './nextflow.save_failed.config' when { process { """ input[0] = Channel.of([ - [ id:'test', single_end:true ], // meta map - [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_interleaved.fastq.gz', checkIfExists: true) ] + [ id:'test', single_end:false ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)] ]) input[1] = [] input[2] = false - input[3] = false + input[3] = true input[4] = false """ } @@ -154,35 +164,32 @@ nextflow_process { then { assertAll( { assert process.success }, + { assert path(process.out.html.get(0).get(1)).getText().contains("The input has little adapter percentage (~0.000000%), probably it's trimmed before.") }, + { assert path(process.out.log.get(0).get(1)).getText().contains("reads passed filter: 162") }, { assert snapshot( process.out.reads, + process.out.reads_fail, + process.out.reads_merged, process.out.json, - process.out.versions).match() }, - { assert process.out.reads_fail == [] }, - { assert process.out.reads_merged == [] }, - { assert path(process.out.log.get(0).get(1)).getText().contains("reads passed filter: 162") }, - { assert path(process.out.html.get(0).get(1)).getText().contains("paired end (151 cycles + 151 cycles)") } + process.out.versions).match() } ) } } - test("fastp test_fastp_interleaved - stub") { - - options '-stub' + test("test_fastp_paired_end_merged") { - config './nextflow.interleaved.config' when { - process { """ input[0] = Channel.of([ - [ id:'test', single_end:true ], // meta map - [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_interleaved.fastq.gz', checkIfExists: true) ] + [ id:'test', single_end:false ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ] ]) input[1] = [] input[2] = false input[3] = false - input[4] = false + input[4] = true """ } } @@ -190,25 +197,32 @@ nextflow_process { then { assertAll( { assert process.success }, - { assert snapshot(process.out).match() }, + { assert path(process.out.html.get(0).get(1)).getText().contains("The input has little adapter percentage (~0.000000%), probably it's trimmed before.") }, + { assert path(process.out.log.get(0).get(1)).getText().contains("total reads: 75") }, + { assert snapshot( + process.out.json, + process.out.reads, + process.out.reads_fail, + process.out.reads_merged, + process.out.versions).match() }, ) } } - test("test_fastp_single_end_trim_fail") { + test("test_fastp_paired_end_merged_adapterlist") { when { - process { """ input[0] = Channel.of([ - [ id:'test', single_end:true ], // meta map - [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ] + [ id:'test', single_end:false ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ] ]) - input[1] = [] + input[1] = Channel.of([ file(params.modules_testdata_base_path + 'delete_me/fastp/adapters.fasta', checkIfExists: true) ]) input[2] = false - input[3] = true - input[4] = false + input[3] = false + input[4] = true """ } } @@ -216,32 +230,30 @@ nextflow_process { then { assertAll( { assert process.success }, + { assert path(process.out.html.get(0).get(1)).getText().contains("
") }, + { assert path(process.out.log.get(0).get(1)).getText().contains("total bases: 13683") }, { assert snapshot( + process.out.json, process.out.reads, process.out.reads_fail, - process.out.json, - process.out.versions).match() }, - { assert process.out.reads_merged == [] }, - { assert path(process.out.log.get(0).get(1)).getText().contains("reads passed filter: 99") }, - { assert path(process.out.html.get(0).get(1)).getText().contains("single end (151 cycles)") }, + process.out.reads_merged, + process.out.versions).match() } ) } } - test("test_fastp_paired_end_trim_fail") { + test("test_fastp_single_end_qc_only") { - config './nextflow.save_failed.config' when { process { """ input[0] = Channel.of([ - [ id:'test', single_end:false ], // meta map - [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)] + [ id:'test', single_end:true ], + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ] ]) input[1] = [] - input[2] = false - input[3] = true + input[2] = true + input[3] = false input[4] = false """ } @@ -250,19 +262,22 @@ nextflow_process { then { assertAll( { assert process.success }, + { assert path(process.out.html.get(0).get(1)).getText().contains("single end (151 cycles)") }, + { assert path(process.out.log.get(0).get(1)).getText().contains("reads passed filter: 99") }, { assert snapshot( + process.out.json, + process.out.reads, process.out.reads, process.out.reads_fail, - process.out.json, - process.out.versions).match() }, - { assert process.out.reads_merged == [] }, - { assert path(process.out.log.get(0).get(1)).getText().contains("reads passed filter: 162") }, - { assert path(process.out.html.get(0).get(1)).getText().contains("The input has little adapter percentage (~0.000000%), probably it's trimmed before.") } + process.out.reads_fail, + process.out.reads_merged, + process.out.reads_merged, + process.out.versions).match() } ) } } - test("test_fastp_paired_end_merged") { + test("test_fastp_paired_end_qc_only") { when { process { @@ -273,9 +288,9 @@ nextflow_process { file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ] ]) input[1] = [] - input[2] = false + input[2] = true input[3] = false - input[4] = true + input[4] = false """ } } @@ -283,34 +298,37 @@ nextflow_process { then { assertAll( { assert process.success }, + { assert path(process.out.html.get(0).get(1)).getText().contains("The input has little adapter percentage (~0.000000%), probably it's trimmed before.") }, + { assert path(process.out.log.get(0).get(1)).getText().contains("Q30 bases: 12281(88.3716%)") }, { assert snapshot( + process.out.json, process.out.reads, + process.out.reads, + process.out.reads_fail, + process.out.reads_fail, process.out.reads_merged, - process.out.json, - process.out.versions).match() }, - { assert process.out.reads_fail == [] }, - { assert path(process.out.log.get(0).get(1)).getText().contains("total reads: 75") }, - { assert path(process.out.html.get(0).get(1)).getText().contains("The input has little adapter percentage (~0.000000%), probably it's trimmed before.") } + process.out.reads_merged, + process.out.versions).match() } ) } } - test("test_fastp_paired_end_merged-stub") { + test("test_fastp_single_end - stub") { - options '-stub' + options "-stub" when { + process { """ input[0] = Channel.of([ - [ id:'test', single_end:false ], // meta map - [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ] + [ id:'test', single_end:true ], + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ] ]) input[1] = [] input[2] = false input[3] = false - input[4] = true + input[4] = false """ } } @@ -318,25 +336,33 @@ nextflow_process { then { assertAll( { assert process.success }, - { assert snapshot(process.out).match() }, + { assert snapshot(process.out).match() } ) } } - test("test_fastp_paired_end_merged_adapterlist") { + test("test_fastp_paired_end - stub") { + + options "-stub" when { + process { """ + adapter_fasta = [] + save_trimmed_pass = true + save_trimmed_fail = false + save_merged = false + input[0] = Channel.of([ [ id:'test', single_end:false ], // meta map [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ] ]) - input[1] = Channel.of([ file(params.modules_testdata_base_path + 'delete_me/fastp/adapters.fasta', checkIfExists: true) ]) + input[1] = [] input[2] = false input[3] = false - input[4] = true + input[4] = false """ } } @@ -344,29 +370,25 @@ nextflow_process { then { assertAll( { assert process.success }, - { assert snapshot( - process.out.reads, - process.out.reads_merged, - process.out.json, - process.out.versions).match() }, - { assert process.out.reads_fail == [] }, - { assert path(process.out.log.get(0).get(1)).getText().contains("total bases: 13683") }, - { assert path(process.out.html.get(0).get(1)).getText().contains("
") } + { assert snapshot(process.out).match() } ) } } - test("test_fastp_single_end_qc_only") { + test("fastp - stub test_fastp_interleaved") { + + options "-stub" + config './nextflow.interleaved.config' when { process { """ input[0] = Channel.of([ - [ id:'test', single_end:true ], - [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ] + [ id:'test', single_end:true ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_interleaved.fastq.gz', checkIfExists: true) ] ]) input[1] = [] - input[2] = true + input[2] = false input[3] = false input[4] = false """ @@ -376,55 +398,101 @@ nextflow_process { then { assertAll( { assert process.success }, - { assert snapshot( - process.out.reads, - process.out.reads_fail, - process.out.reads_merged, - process.out.json, - process.out.versions).match() }, - { assert process.out.reads == [] }, - { assert process.out.reads_fail == [] }, - { assert process.out.reads_merged == [] }, - { assert path(process.out.log.get(0).get(1)).getText().contains("reads passed filter: 99") }, - { assert path(process.out.html.get(0).get(1)).getText().contains("single end (151 cycles)") }, + { assert snapshot(process.out).match() } ) } } - test("test_fastp_single_end_qc_only-stub") { + test("test_fastp_single_end_trim_fail - stub") { - options '-stub' + options "-stub" when { + process { """ input[0] = Channel.of([ - [ id:'test', single_end:true ], + [ id:'test', single_end:true ], // meta map [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ] ]) input[1] = [] - input[2] = true - input[3] = false + input[2] = false + input[3] = true input[4] = false """ } } then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("test_fastp_paired_end_trim_fail - stub") { + options "-stub" + + config './nextflow.save_failed.config' + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)] + ]) + input[1] = [] + input[2] = false + input[3] = true + input[4] = false + """ + } + } + + then { assertAll( { assert process.success }, - { assert snapshot(process.out).match() }, + { assert snapshot(process.out).match() } ) } } - test("test_fastp_paired_end_qc_only") { + test("test_fastp_paired_end_merged - stub") { + + options "-stub" when { - params { - outdir = "$outputDir" + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ] + ]) + input[1] = [] + input[2] = false + input[3] = false + input[4] = true + """ } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("test_fastp_paired_end_merged_adapterlist - stub") { + + options "-stub" + + when { process { """ input[0] = Channel.of([ @@ -432,6 +500,33 @@ nextflow_process { [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ] ]) + input[1] = Channel.of([ file(params.modules_testdata_base_path + 'delete_me/fastp/adapters.fasta', checkIfExists: true) ]) + input[2] = false + input[3] = false + input[4] = true + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("test_fastp_single_end_qc_only - stub") { + + options "-stub" + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:true ], + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ] + ]) input[1] = [] input[2] = true input[3] = false @@ -443,24 +538,14 @@ nextflow_process { then { assertAll( { assert process.success }, - { assert snapshot( - process.out.reads, - process.out.reads_merged, - process.out.reads_fail, - process.out.json, - process.out.versions).match() }, - { assert process.out.reads == [] }, - { assert process.out.reads_fail == [] }, - { assert process.out.reads_merged == [] }, - { assert path(process.out.log.get(0).get(1)).getText().contains("Q30 bases: 12281(88.3716%)") }, - { assert path(process.out.html.get(0).get(1)).getText().contains("The input has little adapter percentage (~0.000000%), probably it's trimmed before.") }, + { assert snapshot(process.out).match() } ) } } - test("test_fastp_paired_end_qc_only-stub") { + test("test_fastp_paired_end_qc_only - stub") { - options '-stub' + options "-stub" when { process { @@ -481,7 +566,7 @@ nextflow_process { then { assertAll( { assert process.success }, - { assert snapshot(process.out).match() }, + { assert snapshot(process.out).match() } ) } } diff --git a/modules/nf-core/fastp/tests/main.nf.test.snap b/modules/nf-core/fastp/tests/main.nf.test.snap index b609b9a2a..54be7e45f 100644 --- a/modules/nf-core/fastp/tests/main.nf.test.snap +++ b/modules/nf-core/fastp/tests/main.nf.test.snap @@ -1,24 +1,15 @@ { - "test_fastp_paired_end_qc_only-stub": { + "test_fastp_single_end_qc_only - stub": { "content": [ { "0": [ - [ - { - "id": "test", - "single_end": false - }, - [ - "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", - "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ] + ], "1": [ [ { "id": "test", - "single_end": false + "single_end": true }, "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" ] @@ -27,7 +18,7 @@ [ { "id": "test", - "single_end": false + "single_end": true }, "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" ] @@ -36,7 +27,7 @@ [ { "id": "test", - "single_end": false + "single_end": true }, "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" ] @@ -54,7 +45,7 @@ [ { "id": "test", - "single_end": false + "single_end": true }, "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" ] @@ -63,7 +54,7 @@ [ { "id": "test", - "single_end": false + "single_end": true }, "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" ] @@ -72,22 +63,13 @@ [ { "id": "test", - "single_end": false + "single_end": true }, "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" ] ], "reads": [ - [ - { - "id": "test", - "single_end": false - }, - [ - "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", - "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] - ] + ], "reads_fail": [ @@ -104,10 +86,19 @@ "nf-test": "0.8.4", "nextflow": "24.04.2" }, - "timestamp": "2024-06-08T05:42:26.603745039" + "timestamp": "2024-07-05T14:31:10.841098" }, "test_fastp_paired_end": { "content": [ + [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.json:md5,1e0f8e27e71728e2b63fc64086be95cd" + ] + ], [ [ { @@ -119,6 +110,48 @@ "test_2.fastp.fastq.gz:md5,25cbdca08e2083dbd4f0502de6b62f39" ] ] + ], + [ + + ], + [ + + ], + [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-07-05T13:43:28.665779" + }, + "test_fastp_paired_end_merged_adapterlist": { + "content": [ + [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.json:md5,5914ca3f21ce162123a824e33e8564f6" + ] + ], + [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.fastp.fastq.gz:md5,54b726a55e992a869fd3fa778afe1672", + "test_2.fastp.fastq.gz:md5,29d3b33b869f7b63417b8ff07bb128ba" + ] + ] + ], + [ + ], [ [ @@ -126,7 +159,95 @@ "id": "test", "single_end": false }, - "test.fastp.json:md5,1e0f8e27e71728e2b63fc64086be95cd" + "test.merged.fastq.gz:md5,c873bb1ab3fa859dcc47306465e749d5" + ] + ], + [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-07-05T13:44:18.210375" + }, + "test_fastp_single_end_qc_only": { + "content": [ + [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.json:md5,5cc5f01e449309e0e689ed6f51a2294a" + ] + ], + [ + + ], + [ + + ], + [ + + ], + [ + + ], + [ + + ], + [ + + ], + [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-07-05T13:44:27.380974" + }, + "test_fastp_paired_end_trim_fail": { + "content": [ + [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.fastp.fastq.gz:md5,6ff32a64c5188b9a9192be1398c262c7", + "test_2.fastp.fastq.gz:md5,db0cb7c9977e94ac2b4b446ebd017a8a" + ] + ] + ], + [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.paired.fail.fastq.gz:md5,409b687c734cedd7a1fec14d316e1366", + "test_1.fail.fastq.gz:md5,4f273cf3159c13f79e8ffae12f5661f6", + "test_2.fail.fastq.gz:md5,f97b9edefb5649aab661fbc9e71fc995" + ] + ] + ], + [ + + ], + [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.json:md5,4c3268ddb50ea5b33125984776aa3519" ] ], [ @@ -137,9 +258,9 @@ "nf-test": "0.8.4", "nextflow": "24.04.2" }, - "timestamp": "2024-06-10T13:02:09.747686552" + "timestamp": "2024-07-05T13:43:58.749589" }, - "fastp test_fastp_interleaved - stub": { + "fastp - stub test_fastp_interleaved": { "content": [ { "0": [ @@ -238,97 +359,248 @@ "nf-test": "0.8.4", "nextflow": "24.04.2" }, - "timestamp": "2024-06-10T13:03:09.374379128" + "timestamp": "2024-07-05T13:50:00.270029" }, - "test_fastp_paired_end_merged_adapterlist": { + "test_fastp_single_end - stub": { "content": [ - [ - [ - { - "id": "test", - "single_end": false - }, + { + "0": [ [ - "test_1.fastp.fastq.gz:md5,54b726a55e992a869fd3fa778afe1672", - "test_2.fastp.fastq.gz:md5,29d3b33b869f7b63417b8ff07bb128ba" + { + "id": "test", + "single_end": true + }, + "test.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" ] + ], + "1": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "4": [ + + ], + "5": [ + + ], + "6": [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + ], + "html": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "json": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "log": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "reads": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ], + "reads_fail": [ + + ], + "reads_merged": [ + + ], + "versions": [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" ] - ], - [ - [ - { - "id": "test", - "single_end": false - }, - "test.merged.fastq.gz:md5,c873bb1ab3fa859dcc47306465e749d5" - ] - ], - [ - [ - { - "id": "test", - "single_end": false - }, - "test.fastp.json:md5,5914ca3f21ce162123a824e33e8564f6" - ] - ], - [ - "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" - ] + } ], "meta": { "nf-test": "0.8.4", "nextflow": "24.04.2" }, - "timestamp": "2024-06-10T13:04:47.637461379" + "timestamp": "2024-07-05T13:49:42.502789" }, - "test_fastp_single_end_qc_only": { + "test_fastp_paired_end_merged_adapterlist - stub": { "content": [ - [ - - ], - [ - - ], - [ - - ], - [ - [ - { - "id": "test", - "single_end": true - }, - "test.fastp.json:md5,5cc5f01e449309e0e689ed6f51a2294a" + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "4": [ + + ], + "5": [ + [ + { + "id": "test", + "single_end": false + }, + "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ], + "6": [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + ], + "html": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "json": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "log": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "reads": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "reads_fail": [ + + ], + "reads_merged": [ + [ + { + "id": "test", + "single_end": false + }, + "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ], + "versions": [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" ] - ], - [ - "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" - ] + } ], "meta": { "nf-test": "0.8.4", "nextflow": "24.04.2" }, - "timestamp": "2024-06-10T20:11:50.885505279" + "timestamp": "2024-07-05T13:54:53.458252" }, - "test_fastp_single_end-stub": { + "test_fastp_paired_end_merged - stub": { "content": [ { "0": [ [ { "id": "test", - "single_end": true + "single_end": false }, - "test.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + [ + "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] ] ], "1": [ [ { "id": "test", - "single_end": true + "single_end": false }, "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" ] @@ -337,7 +609,7 @@ [ { "id": "test", - "single_end": true + "single_end": false }, "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" ] @@ -346,7 +618,7 @@ [ { "id": "test", - "single_end": true + "single_end": false }, "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" ] @@ -355,7 +627,13 @@ ], "5": [ - + [ + { + "id": "test", + "single_end": false + }, + "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] ], "6": [ "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" @@ -364,7 +642,7 @@ [ { "id": "test", - "single_end": true + "single_end": false }, "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" ] @@ -373,7 +651,7 @@ [ { "id": "test", - "single_end": true + "single_end": false }, "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" ] @@ -382,7 +660,7 @@ [ { "id": "test", - "single_end": true + "single_end": false }, "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" ] @@ -391,16 +669,25 @@ [ { "id": "test", - "single_end": true + "single_end": false }, - "test.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + [ + "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] ] ], "reads_fail": [ ], "reads_merged": [ - + [ + { + "id": "test", + "single_end": false + }, + "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] ], "versions": [ "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" @@ -411,9 +698,9 @@ "nf-test": "0.8.4", "nextflow": "24.04.2" }, - "timestamp": "2024-06-10T13:01:55.987280865" + "timestamp": "2024-07-05T13:50:27.689379" }, - "test_fastp_paired_end_trim_fail": { + "test_fastp_paired_end_merged": { "content": [ [ [ @@ -421,10 +708,7 @@ "id": "test", "single_end": false }, - [ - "test_1.fastp.fastq.gz:md5,6ff32a64c5188b9a9192be1398c262c7", - "test_2.fastp.fastq.gz:md5,db0cb7c9977e94ac2b4b446ebd017a8a" - ] + "test.fastp.json:md5,b712fd68ed0322f4bec49ff2a5237fcc" ] ], [ @@ -434,11 +718,13 @@ "single_end": false }, [ - "test.paired.fail.fastq.gz:md5,409b687c734cedd7a1fec14d316e1366", - "test_1.fail.fastq.gz:md5,4f273cf3159c13f79e8ffae12f5661f6", - "test_2.fail.fastq.gz:md5,f97b9edefb5649aab661fbc9e71fc995" + "test_1.fastp.fastq.gz:md5,54b726a55e992a869fd3fa778afe1672", + "test_2.fastp.fastq.gz:md5,29d3b33b869f7b63417b8ff07bb128ba" ] ] + ], + [ + ], [ [ @@ -446,7 +732,7 @@ "id": "test", "single_end": false }, - "test.fastp.json:md5,4c3268ddb50ea5b33125984776aa3519" + "test.merged.fastq.gz:md5,c873bb1ab3fa859dcc47306465e749d5" ] ], [ @@ -457,7 +743,7 @@ "nf-test": "0.8.4", "nextflow": "24.04.2" }, - "timestamp": "2024-06-10T13:03:46.458766801" + "timestamp": "2024-07-05T13:44:08.68476" }, "test_fastp_paired_end - stub": { "content": [ @@ -564,52 +850,19 @@ "nf-test": "0.8.4", "nextflow": "24.04.2" }, - "timestamp": "2024-06-08T05:36:36.446112695" + "timestamp": "2024-07-05T13:49:51.679221" }, - "test_fastp_paired_end_merged": { + "test_fastp_single_end": { "content": [ [ [ { "id": "test", - "single_end": false - }, - [ - "test_1.fastp.fastq.gz:md5,54b726a55e992a869fd3fa778afe1672", - "test_2.fastp.fastq.gz:md5,29d3b33b869f7b63417b8ff07bb128ba" - ] - ] - ], - [ - [ - { - "id": "test", - "single_end": false - }, - "test.merged.fastq.gz:md5,c873bb1ab3fa859dcc47306465e749d5" - ] - ], - [ - [ - { - "id": "test", - "single_end": false + "single_end": true }, - "test.fastp.json:md5,b712fd68ed0322f4bec49ff2a5237fcc" + "test.fastp.json:md5,c852d7a6dba5819e4ac8d9673bedcacc" ] ], - [ - "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" - }, - "timestamp": "2024-06-10T13:04:09.964580373" - }, - "test_fastp_single_end": { - "content": [ [ [ { @@ -620,13 +873,10 @@ ] ], [ - [ - { - "id": "test", - "single_end": true - }, - "test.fastp.json:md5,c852d7a6dba5819e4ac8d9673bedcacc" - ] + + ], + [ + ], [ "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" @@ -636,28 +886,25 @@ "nf-test": "0.8.4", "nextflow": "24.04.2" }, - "timestamp": "2024-06-10T13:01:34.044931225" + "timestamp": "2024-07-05T13:43:18.834322" }, - "test_fastp_paired_end_merged-stub": { + "test_fastp_single_end_trim_fail - stub": { "content": [ { "0": [ [ { "id": "test", - "single_end": false + "single_end": true }, - [ - "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", - "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] + "test.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" ] ], "1": [ [ { "id": "test", - "single_end": false + "single_end": true }, "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" ] @@ -666,7 +913,7 @@ [ { "id": "test", - "single_end": false + "single_end": true }, "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" ] @@ -675,22 +922,22 @@ [ { "id": "test", - "single_end": false + "single_end": true }, "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" ] ], "4": [ - - ], - "5": [ [ { "id": "test", - "single_end": false + "single_end": true }, - "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + "test.fail.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" ] + ], + "5": [ + ], "6": [ "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" @@ -699,7 +946,7 @@ [ { "id": "test", - "single_end": false + "single_end": true }, "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" ] @@ -708,7 +955,7 @@ [ { "id": "test", - "single_end": false + "single_end": true }, "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" ] @@ -717,7 +964,7 @@ [ { "id": "test", - "single_end": false + "single_end": true }, "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" ] @@ -726,25 +973,22 @@ [ { "id": "test", - "single_end": false + "single_end": true }, - [ - "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", - "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" - ] + "test.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" ] ], "reads_fail": [ - - ], - "reads_merged": [ [ { "id": "test", - "single_end": false + "single_end": true }, - "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + "test.fail.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" ] + ], + "reads_merged": [ + ], "versions": [ "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" @@ -755,16 +999,16 @@ "nf-test": "0.8.4", "nextflow": "24.04.2" }, - "timestamp": "2024-06-08T05:39:42.022707162" + "timestamp": "2024-07-05T14:05:36.898142" }, - "test_fastp_single_end_qc_only-stub": { + "test_fastp_paired_end_trim_fail - stub": { "content": [ { "0": [ [ { "id": "test", - "single_end": true + "single_end": false }, [ "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", @@ -776,7 +1020,7 @@ [ { "id": "test", - "single_end": true + "single_end": false }, "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" ] @@ -785,7 +1029,7 @@ [ { "id": "test", - "single_end": true + "single_end": false }, "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" ] @@ -794,13 +1038,23 @@ [ { "id": "test", - "single_end": true + "single_end": false }, "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" ] ], "4": [ - + [ + { + "id": "test", + "single_end": false + }, + [ + "test.paired.fail.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test_1.fail.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test_2.fail.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] ], "5": [ @@ -812,7 +1066,7 @@ [ { "id": "test", - "single_end": true + "single_end": false }, "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" ] @@ -821,7 +1075,7 @@ [ { "id": "test", - "single_end": true + "single_end": false }, "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" ] @@ -830,7 +1084,7 @@ [ { "id": "test", - "single_end": true + "single_end": false }, "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" ] @@ -839,7 +1093,7 @@ [ { "id": "test", - "single_end": true + "single_end": false }, [ "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", @@ -848,7 +1102,17 @@ ] ], "reads_fail": [ - + [ + { + "id": "test", + "single_end": false + }, + [ + "test.paired.fail.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test_1.fail.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test_2.fail.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] ], "reads_merged": [ @@ -862,7 +1126,7 @@ "nf-test": "0.8.4", "nextflow": "24.04.2" }, - "timestamp": "2024-06-10T13:05:31.722431847" + "timestamp": "2024-07-05T14:05:49.212847" }, "fastp test_fastp_interleaved": { "content": [ @@ -892,7 +1156,7 @@ "nf-test": "0.8.4", "nextflow": "24.04.2" }, - "timestamp": "2024-06-07T22:35:04.608948751" + "timestamp": "2024-07-05T13:43:38.910832" }, "test_fastp_single_end_trim_fail": { "content": [ @@ -902,7 +1166,7 @@ "id": "test", "single_end": true }, - "test.fastp.fastq.gz:md5,67b2bbae47f073e05a97a9c2edce23c7" + "test.fastp.json:md5,9a7ee180f000e8d00c7fb67f06293eb5" ] ], [ @@ -911,7 +1175,7 @@ "id": "test", "single_end": true }, - "test.fail.fastq.gz:md5,3e4aaadb66a5b8fc9b881bf39c227abd" + "test.fastp.fastq.gz:md5,67b2bbae47f073e05a97a9c2edce23c7" ] ], [ @@ -920,8 +1184,11 @@ "id": "test", "single_end": true }, - "test.fastp.json:md5,9a7ee180f000e8d00c7fb67f06293eb5" + "test.fail.fastq.gz:md5,3e4aaadb66a5b8fc9b881bf39c227abd" ] + ], + [ + ], [ "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" @@ -931,10 +1198,19 @@ "nf-test": "0.8.4", "nextflow": "24.04.2" }, - "timestamp": "2024-06-10T13:03:23.130471376" + "timestamp": "2024-07-05T13:43:48.22378" }, "test_fastp_paired_end_qc_only": { "content": [ + [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.json:md5,623064a45912dac6f2b64e3f2e9901df" + ] + ], [ ], @@ -945,13 +1221,13 @@ ], [ - [ - { - "id": "test", - "single_end": false - }, - "test.fastp.json:md5,623064a45912dac6f2b64e3f2e9901df" - ] + + ], + [ + + ], + [ + ], [ "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" @@ -961,6 +1237,95 @@ "nf-test": "0.8.4", "nextflow": "24.04.2" }, - "timestamp": "2024-06-10T20:12:14.00927619" + "timestamp": "2024-07-05T13:44:36.334938" + }, + "test_fastp_paired_end_qc_only - stub": { + "content": [ + { + "0": [ + + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "4": [ + + ], + "5": [ + + ], + "6": [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + ], + "html": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "json": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "log": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "reads": [ + + ], + "reads_fail": [ + + ], + "reads_merged": [ + + ], + "versions": [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-07-05T14:31:27.096468" } } \ No newline at end of file diff --git a/modules/nf-core/fastqc/tests/main.nf.test b/modules/nf-core/fastqc/tests/main.nf.test index c69808d8c..a67f92777 100644 --- a/modules/nf-core/fastqc/tests/main.nf.test +++ b/modules/nf-core/fastqc/tests/main.nf.test @@ -19,17 +19,14 @@ nextflow_process { then { assertAll ( - { assert process.success }, - - // NOTE The report contains the date inside it, which means that the md5sum is stable per day, but not longer than that. So you can't md5sum it. - // looks like this:
Mon 2 Oct 2023
test.gz
- // https://github.com/nf-core/modules/pull/3903#issuecomment-1743620039 - - { assert process.out.html[0][1] ==~ ".*/test_fastqc.html" }, - { assert process.out.zip[0][1] ==~ ".*/test_fastqc.zip" }, - { assert path(process.out.html[0][1]).text.contains("File typeConventional base calls") }, - - { assert snapshot(process.out.versions).match("fastqc_versions_single") } + { assert process.success }, + // NOTE The report contains the date inside it, which means that the md5sum is stable per day, but not longer than that. So you can't md5sum it. + // looks like this:
Mon 2 Oct 2023
test.gz
+ // https://github.com/nf-core/modules/pull/3903#issuecomment-1743620039 + { assert process.out.html[0][1] ==~ ".*/test_fastqc.html" }, + { assert process.out.zip[0][1] ==~ ".*/test_fastqc.zip" }, + { assert path(process.out.html[0][1]).text.contains("File typeConventional base calls") }, + { assert snapshot(process.out.versions).match() } ) } } @@ -50,16 +47,14 @@ nextflow_process { then { assertAll ( - { assert process.success }, - - { assert process.out.html[0][1][0] ==~ ".*/test_1_fastqc.html" }, - { assert process.out.html[0][1][1] ==~ ".*/test_2_fastqc.html" }, - { assert process.out.zip[0][1][0] ==~ ".*/test_1_fastqc.zip" }, - { assert process.out.zip[0][1][1] ==~ ".*/test_2_fastqc.zip" }, - { assert path(process.out.html[0][1][0]).text.contains("File typeConventional base calls") }, - { assert path(process.out.html[0][1][1]).text.contains("File typeConventional base calls") }, - - { assert snapshot(process.out.versions).match("fastqc_versions_paired") } + { assert process.success }, + { assert process.out.html[0][1][0] ==~ ".*/test_1_fastqc.html" }, + { assert process.out.html[0][1][1] ==~ ".*/test_2_fastqc.html" }, + { assert process.out.zip[0][1][0] ==~ ".*/test_1_fastqc.zip" }, + { assert process.out.zip[0][1][1] ==~ ".*/test_2_fastqc.zip" }, + { assert path(process.out.html[0][1][0]).text.contains("File typeConventional base calls") }, + { assert path(process.out.html[0][1][1]).text.contains("File typeConventional base calls") }, + { assert snapshot(process.out.versions).match() } ) } } @@ -79,13 +74,11 @@ nextflow_process { then { assertAll ( - { assert process.success }, - - { assert process.out.html[0][1] ==~ ".*/test_fastqc.html" }, - { assert process.out.zip[0][1] ==~ ".*/test_fastqc.zip" }, - { assert path(process.out.html[0][1]).text.contains("File typeConventional base calls") }, - - { assert snapshot(process.out.versions).match("fastqc_versions_interleaved") } + { assert process.success }, + { assert process.out.html[0][1] ==~ ".*/test_fastqc.html" }, + { assert process.out.zip[0][1] ==~ ".*/test_fastqc.zip" }, + { assert path(process.out.html[0][1]).text.contains("File typeConventional base calls") }, + { assert snapshot(process.out.versions).match() } ) } } @@ -105,13 +98,11 @@ nextflow_process { then { assertAll ( - { assert process.success }, - - { assert process.out.html[0][1] ==~ ".*/test_fastqc.html" }, - { assert process.out.zip[0][1] ==~ ".*/test_fastqc.zip" }, - { assert path(process.out.html[0][1]).text.contains("File typeConventional base calls") }, - - { assert snapshot(process.out.versions).match("fastqc_versions_bam") } + { assert process.success }, + { assert process.out.html[0][1] ==~ ".*/test_fastqc.html" }, + { assert process.out.zip[0][1] ==~ ".*/test_fastqc.zip" }, + { assert path(process.out.html[0][1]).text.contains("File typeConventional base calls") }, + { assert snapshot(process.out.versions).match() } ) } } @@ -134,22 +125,20 @@ nextflow_process { then { assertAll ( - { assert process.success }, - - { assert process.out.html[0][1][0] ==~ ".*/test_1_fastqc.html" }, - { assert process.out.html[0][1][1] ==~ ".*/test_2_fastqc.html" }, - { assert process.out.html[0][1][2] ==~ ".*/test_3_fastqc.html" }, - { assert process.out.html[0][1][3] ==~ ".*/test_4_fastqc.html" }, - { assert process.out.zip[0][1][0] ==~ ".*/test_1_fastqc.zip" }, - { assert process.out.zip[0][1][1] ==~ ".*/test_2_fastqc.zip" }, - { assert process.out.zip[0][1][2] ==~ ".*/test_3_fastqc.zip" }, - { assert process.out.zip[0][1][3] ==~ ".*/test_4_fastqc.zip" }, - { assert path(process.out.html[0][1][0]).text.contains("File typeConventional base calls") }, - { assert path(process.out.html[0][1][1]).text.contains("File typeConventional base calls") }, - { assert path(process.out.html[0][1][2]).text.contains("File typeConventional base calls") }, - { assert path(process.out.html[0][1][3]).text.contains("File typeConventional base calls") }, - - { assert snapshot(process.out.versions).match("fastqc_versions_multiple") } + { assert process.success }, + { assert process.out.html[0][1][0] ==~ ".*/test_1_fastqc.html" }, + { assert process.out.html[0][1][1] ==~ ".*/test_2_fastqc.html" }, + { assert process.out.html[0][1][2] ==~ ".*/test_3_fastqc.html" }, + { assert process.out.html[0][1][3] ==~ ".*/test_4_fastqc.html" }, + { assert process.out.zip[0][1][0] ==~ ".*/test_1_fastqc.zip" }, + { assert process.out.zip[0][1][1] ==~ ".*/test_2_fastqc.zip" }, + { assert process.out.zip[0][1][2] ==~ ".*/test_3_fastqc.zip" }, + { assert process.out.zip[0][1][3] ==~ ".*/test_4_fastqc.zip" }, + { assert path(process.out.html[0][1][0]).text.contains("File typeConventional base calls") }, + { assert path(process.out.html[0][1][1]).text.contains("File typeConventional base calls") }, + { assert path(process.out.html[0][1][2]).text.contains("File typeConventional base calls") }, + { assert path(process.out.html[0][1][3]).text.contains("File typeConventional base calls") }, + { assert snapshot(process.out.versions).match() } ) } } @@ -169,21 +158,18 @@ nextflow_process { then { assertAll ( - { assert process.success }, - - { assert process.out.html[0][1] ==~ ".*/mysample_fastqc.html" }, - { assert process.out.zip[0][1] ==~ ".*/mysample_fastqc.zip" }, - { assert path(process.out.html[0][1]).text.contains("File typeConventional base calls") }, - - { assert snapshot(process.out.versions).match("fastqc_versions_custom_prefix") } + { assert process.success }, + { assert process.out.html[0][1] ==~ ".*/mysample_fastqc.html" }, + { assert process.out.zip[0][1] ==~ ".*/mysample_fastqc.zip" }, + { assert path(process.out.html[0][1]).text.contains("File typeConventional base calls") }, + { assert snapshot(process.out.versions).match() } ) } } test("sarscov2 single-end [fastq] - stub") { - options "-stub" - + options "-stub" when { process { """ @@ -197,12 +183,123 @@ nextflow_process { then { assertAll ( - { assert process.success }, - { assert snapshot(process.out.html.collect { file(it[1]).getName() } + - process.out.zip.collect { file(it[1]).getName() } + - process.out.versions ).match("fastqc_stub") } + { assert process.success }, + { assert snapshot(process.out).match() } ) } } + test("sarscov2 paired-end [fastq] - stub") { + + options "-stub" + when { + process { + """ + input[0] = Channel.of([ + [id: 'test', single_end: false], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ] + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("sarscov2 interleaved [fastq] - stub") { + + options "-stub" + when { + process { + """ + input[0] = Channel.of([ + [id: 'test', single_end: false], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_interleaved.fastq.gz', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("sarscov2 paired-end [bam] - stub") { + + options "-stub" + when { + process { + """ + input[0] = Channel.of([ + [id: 'test', single_end: false], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("sarscov2 multiple [fastq] - stub") { + + options "-stub" + when { + process { + """ + input[0] = Channel.of([ + [id: 'test', single_end: false], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test2_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test2_2.fastq.gz', checkIfExists: true) ] + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("sarscov2 custom_prefix - stub") { + + options "-stub" + when { + process { + """ + input[0] = Channel.of([ + [ id:'mysample', single_end:true ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } } diff --git a/modules/nf-core/fastqc/tests/main.nf.test.snap b/modules/nf-core/fastqc/tests/main.nf.test.snap index 86f7c3115..d5db3092f 100644 --- a/modules/nf-core/fastqc/tests/main.nf.test.snap +++ b/modules/nf-core/fastqc/tests/main.nf.test.snap @@ -1,88 +1,392 @@ { - "fastqc_versions_interleaved": { + "sarscov2 custom_prefix": { "content": [ [ "versions.yml:md5,e1cc25ca8af856014824abd842e93978" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-01-31T17:40:07.293713" + "timestamp": "2024-07-22T11:02:16.374038" }, - "fastqc_stub": { + "sarscov2 single-end [fastq] - stub": { "content": [ - [ - "test.html", - "test.zip", - "versions.yml:md5,e1cc25ca8af856014824abd842e93978" - ] + { + "0": [ + [ + { + "id": "test", + "single_end": true + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": true + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "html": [ + [ + { + "id": "test", + "single_end": true + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "zip": [ + [ + { + "id": "test", + "single_end": true + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T11:02:24.993809" + }, + "sarscov2 custom_prefix - stub": { + "content": [ + { + "0": [ + [ + { + "id": "mysample", + "single_end": true + }, + "mysample.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "mysample", + "single_end": true + }, + "mysample.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "html": [ + [ + { + "id": "mysample", + "single_end": true + }, + "mysample.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "zip": [ + [ + { + "id": "mysample", + "single_end": true + }, + "mysample.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-01-31T17:31:01.425198" + "timestamp": "2024-07-22T11:03:10.93942" }, - "fastqc_versions_multiple": { + "sarscov2 interleaved [fastq]": { "content": [ [ "versions.yml:md5,e1cc25ca8af856014824abd842e93978" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-01-31T17:40:55.797907" + "timestamp": "2024-07-22T11:01:42.355718" }, - "fastqc_versions_bam": { + "sarscov2 paired-end [bam]": { "content": [ [ "versions.yml:md5,e1cc25ca8af856014824abd842e93978" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-01-31T17:40:26.795862" + "timestamp": "2024-07-22T11:01:53.276274" }, - "fastqc_versions_single": { + "sarscov2 multiple [fastq]": { "content": [ [ "versions.yml:md5,e1cc25ca8af856014824abd842e93978" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-01-31T17:39:27.043675" + "timestamp": "2024-07-22T11:02:05.527626" }, - "fastqc_versions_paired": { + "sarscov2 paired-end [fastq]": { "content": [ [ "versions.yml:md5,e1cc25ca8af856014824abd842e93978" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T11:01:31.188871" + }, + "sarscov2 paired-end [fastq] - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "html": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "zip": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T11:02:34.273566" + }, + "sarscov2 multiple [fastq] - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "html": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "zip": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-01-31T17:39:47.584191" + "timestamp": "2024-07-22T11:03:02.304411" }, - "fastqc_versions_custom_prefix": { + "sarscov2 single-end [fastq]": { "content": [ [ "versions.yml:md5,e1cc25ca8af856014824abd842e93978" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T11:01:19.095607" + }, + "sarscov2 interleaved [fastq] - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "html": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "zip": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T11:02:44.640184" + }, + "sarscov2 paired-end [bam] - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "html": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "zip": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-01-31T17:41:14.576531" + "timestamp": "2024-07-22T11:02:53.550742" } } \ No newline at end of file diff --git a/modules/nf-core/gunzip/environment.yml b/modules/nf-core/gunzip/environment.yml index 25910b340..dfc02a7b5 100644 --- a/modules/nf-core/gunzip/environment.yml +++ b/modules/nf-core/gunzip/environment.yml @@ -4,4 +4,6 @@ channels: - bioconda - defaults dependencies: - - conda-forge::sed=4.7 + - conda-forge::grep=3.11 + - conda-forge::sed=4.8 + - conda-forge::tar=1.34 diff --git a/modules/nf-core/gunzip/main.nf b/modules/nf-core/gunzip/main.nf index 4ae609fb1..5e67e3b9b 100644 --- a/modules/nf-core/gunzip/main.nf +++ b/modules/nf-core/gunzip/main.nf @@ -4,8 +4,8 @@ process GUNZIP { conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/ubuntu:20.04' : - 'nf-core/ubuntu:20.04' }" + 'https://depot.galaxyproject.org/singularity/ubuntu:22.04' : + 'nf-core/ubuntu:22.04' }" input: tuple val(meta), path(archive) diff --git a/modules/nf-core/kallisto/index/main.nf b/modules/nf-core/kallisto/index/main.nf index 28a47dbeb..bbd226c93 100644 --- a/modules/nf-core/kallisto/index/main.nf +++ b/modules/nf-core/kallisto/index/main.nf @@ -34,7 +34,7 @@ process KALLISTO_INDEX { stub: """ - touch kallisto + mkdir kallisto cat <<-END_VERSIONS > versions.yml "${task.process}": diff --git a/modules/nf-core/kallisto/index/tests/main.nf.test b/modules/nf-core/kallisto/index/tests/main.nf.test index 7999daf41..c5e86e87c 100644 --- a/modules/nf-core/kallisto/index/tests/main.nf.test +++ b/modules/nf-core/kallisto/index/tests/main.nf.test @@ -24,4 +24,27 @@ nextflow_process { ) } } + + test("sarscov2 transcriptome.fasta - stub") { + + options "-stub" + + when { + process { + """ + input[0] = Channel.of([ + [ id:'transcriptome' ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/transcriptome.fasta', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } } diff --git a/modules/nf-core/kallisto/index/tests/main.nf.test.snap b/modules/nf-core/kallisto/index/tests/main.nf.test.snap index 054f36e21..b2891a4a3 100644 --- a/modules/nf-core/kallisto/index/tests/main.nf.test.snap +++ b/modules/nf-core/kallisto/index/tests/main.nf.test.snap @@ -1,4 +1,41 @@ { + "sarscov2 transcriptome.fasta - stub": { + "content": [ + { + "0": [ + [ + { + "id": "transcriptome" + }, + [ + + ] + ] + ], + "1": [ + "versions.yml:md5,178f9b57d4228edc356911d571b958a4" + ], + "index": [ + [ + { + "id": "transcriptome" + }, + [ + + ] + ] + ], + "versions": [ + "versions.yml:md5,178f9b57d4228edc356911d571b958a4" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-07-03T15:27:54.464205" + }, "sarscov2 transcriptome.fasta": { "content": [ { @@ -26,6 +63,10 @@ ] } ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, "timestamp": "2024-01-19T09:17:56.733532" } -} +} \ No newline at end of file diff --git a/modules/nf-core/kallisto/quant/main.nf b/modules/nf-core/kallisto/quant/main.nf index f5444d791..acfc8c9c7 100644 --- a/modules/nf-core/kallisto/quant/main.nf +++ b/modules/nf-core/kallisto/quant/main.nf @@ -69,7 +69,13 @@ process KALLISTO_QUANT { """ stub: + prefix = task.ext.prefix ?: "${meta.id}" + """ + mkdir -p $prefix + touch ${prefix}.log + touch ${prefix}.run_info.json + cat <<-END_VERSIONS > versions.yml "${task.process}": kallisto: \$(echo \$(kallisto version) | sed "s/kallisto, version //g" ) diff --git a/modules/nf-core/kallisto/quant/tests/main.nf.test b/modules/nf-core/kallisto/quant/tests/main.nf.test index cb7e480a1..ec6e3d60c 100644 --- a/modules/nf-core/kallisto/quant/tests/main.nf.test +++ b/modules/nf-core/kallisto/quant/tests/main.nf.test @@ -16,14 +16,22 @@ nextflow_process { """ } } + + run("KALLISTO_INDEX", alias: "KALLISTO_INDEX_STUB") { + script "../../index/main.nf" + process { + """ + input[0] = Channel.of([ + [ id:'transcriptome' ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/transcriptome.fasta', checkIfExists: true) + ]) + """ + } + } } test("sarscov2 single-end") { when { - params{ - outdir = "$outputDir" - } - process { """ gtf = [] @@ -47,19 +55,85 @@ nextflow_process { then { assertAll( { assert process.success }, - { assert snapshot(path("${process.out.results[0][1]}/abundance.tsv")).match("se_abundance_tsv") }, - { assert snapshot(process.out.log).match("se_log") }, - { assert snapshot(process.out.versions).match("se_versions") } + { assert snapshot( + path("${process.out.results[0][1]}/abundance.tsv"), + process.out.log, + process.out.versions).match() } ) } } test("sarscov2 paired-end") { when { - params{ - outdir = "$outputDir" + process { + """ + gtf = [] + chromosomes = [] + fragment_length = [] + fragment_length_sd = [] + + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ] + ]) + input[1] = KALLISTO_INDEX.out.index + input[2] = gtf + input[3] = chromosomes + input[4] = fragment_length + input[5] = fragment_length_sd + """ } + } + then { + assertAll( + { assert process.success }, + { assert snapshot( + path("${process.out.results[0][1]}/abundance.tsv"), + process.out.log, + process.out.versions).match() } + ) + } + } + + test("sarscov2 single-end - stub") { + options "-stub" + + when { + process { + """ + gtf = [] + chromosomes = [] + fragment_length = 150 + fragment_length_sd = 75 + + input[0] = Channel.of([ + [ id:'test', single_end:true ], + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ] + ]) + input[1] = KALLISTO_INDEX_STUB.out.index + input[2] = gtf + input[3] = chromosomes + input[4] = fragment_length + input[5] = fragment_length_sd + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("sarscov2 paired-end - stub") { + + options "-stub" + + when { process { """ gtf = [] @@ -72,7 +146,7 @@ nextflow_process { [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ] ]) - input[1] = KALLISTO_INDEX.out.index + input[1] = KALLISTO_INDEX_STUB.out.index input[2] = gtf input[3] = chromosomes input[4] = fragment_length @@ -83,9 +157,7 @@ nextflow_process { then { assertAll( { assert process.success }, - { assert snapshot(path("${process.out.results[0][1]}/abundance.tsv")).match("pe_abundance_tsv") }, - { assert snapshot(process.out.log).match("pe_log") }, - { assert snapshot(process.out.versions).match("pe_versions") } + { assert snapshot(process.out).match() } ) } } diff --git a/modules/nf-core/kallisto/quant/tests/main.nf.test.snap b/modules/nf-core/kallisto/quant/tests/main.nf.test.snap index f957e6c8b..cf0d73304 100644 --- a/modules/nf-core/kallisto/quant/tests/main.nf.test.snap +++ b/modules/nf-core/kallisto/quant/tests/main.nf.test.snap @@ -1,6 +1,7 @@ { - "pe_log": { + "sarscov2 paired-end": { "content": [ + "abundance.tsv:md5,f0a9a2543f8fc0c8442be0a939d70f66", [ [ { @@ -9,32 +10,170 @@ }, "test.log:md5,8a5987f8e779cd12ca708e2212f771f5" ] - ] - ], - "timestamp": "2024-01-19T09:31:05.549084" - }, - "se_versions": { - "content": [ + ], [ "versions.yml:md5,f981ad0cc089194a8fb00a47948eea94" ] ], - "timestamp": "2024-01-19T09:30:00.138848" + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-07-03T15:25:27.043048" }, - "se_abundance_tsv": { + "sarscov2 paired-end - stub": { "content": [ - "abundance.tsv:md5,8a4afe91e6a75b4e619daaf664eb7d9b" + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + [ + + ] + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.run_info.json:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + [ + { + "id": "test", + "single_end": false + }, + "test.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + "versions.yml:md5,f981ad0cc089194a8fb00a47948eea94" + ], + "json_info": [ + [ + { + "id": "test", + "single_end": false + }, + "test.run_info.json:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "log": [ + [ + { + "id": "test", + "single_end": false + }, + "test.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "results": [ + [ + { + "id": "test", + "single_end": false + }, + [ + + ] + ] + ], + "versions": [ + "versions.yml:md5,f981ad0cc089194a8fb00a47948eea94" + ] + } ], - "timestamp": "2024-01-19T09:30:00.127992" + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-07-03T15:26:04.484652" }, - "pe_abundance_tsv": { + "sarscov2 single-end - stub": { "content": [ - "abundance.tsv:md5,f0a9a2543f8fc0c8442be0a939d70f66" + { + "0": [ + [ + { + "id": "test", + "single_end": true + }, + [ + + ] + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": true + }, + "test.run_info.json:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + [ + { + "id": "test", + "single_end": true + }, + "test.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + "versions.yml:md5,f981ad0cc089194a8fb00a47948eea94" + ], + "json_info": [ + [ + { + "id": "test", + "single_end": true + }, + "test.run_info.json:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "log": [ + [ + { + "id": "test", + "single_end": true + }, + "test.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "results": [ + [ + { + "id": "test", + "single_end": true + }, + [ + + ] + ] + ], + "versions": [ + "versions.yml:md5,f981ad0cc089194a8fb00a47948eea94" + ] + } ], - "timestamp": "2024-01-19T09:31:05.544756" + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-07-03T15:25:46.479136" }, - "se_log": { + "sarscov2 single-end": { "content": [ + "abundance.tsv:md5,8a4afe91e6a75b4e619daaf664eb7d9b", [ [ { @@ -43,16 +182,15 @@ }, "test.log:md5,9c166f0c50cd4fdbdbf1bff9d5d8aba2" ] - ] - ], - "timestamp": "2024-01-19T09:30:00.135036" - }, - "pe_versions": { - "content": [ + ], [ "versions.yml:md5,f981ad0cc089194a8fb00a47948eea94" ] ], - "timestamp": "2024-01-19T09:31:05.553993" + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-07-03T15:25:08.348876" } } \ No newline at end of file diff --git a/modules/nf-core/multiqc/tests/tags.yml b/modules/nf-core/multiqc/tests/tags.yml deleted file mode 100644 index bea6c0d37..000000000 --- a/modules/nf-core/multiqc/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -multiqc: - - modules/nf-core/multiqc/** diff --git a/modules/nf-core/picard/markduplicates/picard-markduplicates.diff b/modules/nf-core/picard/markduplicates/picard-markduplicates.diff new file mode 100644 index 000000000..bf684640d --- /dev/null +++ b/modules/nf-core/picard/markduplicates/picard-markduplicates.diff @@ -0,0 +1,25 @@ +Changes in module 'nf-core/picard/markduplicates' +--- modules/nf-core/picard/markduplicates/main.nf ++++ modules/nf-core/picard/markduplicates/main.nf +@@ -4,8 +4,8 @@ + + conda "${moduleDir}/environment.yml" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? +- 'https://depot.galaxyproject.org/singularity/picard:3.2.0--hdfd78af_0' : +- 'biocontainers/picard:3.2.0--hdfd78af_0' }" ++ 'https://depot.galaxyproject.org/singularity/picard:3.1.1--hdfd78af_0' : ++ 'biocontainers/picard:3.1.1--hdfd78af_0' }" + + input: + tuple val(meta), path(reads) + +--- modules/nf-core/picard/markduplicates/environment.yml ++++ modules/nf-core/picard/markduplicates/environment.yml +@@ -4,4 +4,4 @@ + - bioconda + - defaults + dependencies: +- - bioconda::picard=3.2.0 ++ - bioconda::picard=3.1.1 + +************************************************************ diff --git a/modules/nf-core/picard/markduplicates/tests/main.nf.test b/modules/nf-core/picard/markduplicates/tests/main.nf.test index 04eff3581..1abea33e3 100644 --- a/modules/nf-core/picard/markduplicates/tests/main.nf.test +++ b/modules/nf-core/picard/markduplicates/tests/main.nf.test @@ -23,9 +23,11 @@ nextflow_process { then { assertAll( { assert process.success }, - { assert snapshot(file(process.out.bam[0][1]).name).match("unsorted_bam_name") }, - { assert snapshot(path(process.out.metrics.get(0).get(1)).readLines()[0..2]).match("unsorted_bam_metrics") }, - { assert snapshot(process.out.versions).match("unsorted_bam_versions") } + { assert snapshot( + file(process.out.bam[0][1]).name, + path(process.out.metrics.get(0).get(1)).readLines()[0..2], + process.out.versions) + .match() } ) } } @@ -48,9 +50,11 @@ nextflow_process { then { assertAll( { assert process.success }, - { assert snapshot(file(process.out.bam[0][1]).name).match("sorted_bam_name") }, - { assert snapshot(path(process.out.metrics.get(0).get(1)).readLines()[0..2]).match("sorted_bam_metrics") }, - { assert snapshot(process.out.versions).match("sorted_bam_versions") } + { assert snapshot( + file(process.out.bam[0][1]).name, + path(process.out.metrics.get(0).get(1)).readLines()[0..2], + process.out.versions) + .match() } ) } } @@ -79,9 +83,86 @@ nextflow_process { then { assertAll( { assert process.success }, - { assert snapshot(file(process.out.cram[0][1]).name).match("cram_name") }, - { assert snapshot(path(process.out.metrics.get(0).get(1)).readLines()[0..2]).match("cram_metrics") }, - { assert snapshot(process.out.versions).match("cram_versions") } + { assert snapshot( + file(process.out.cram[0][1]).name, + path(process.out.metrics.get(0).get(1)).readLines()[0..2], + process.out.versions) + .match() } + ) + } + } + + test("sarscov2 [unsorted bam] - stub") { + options "-stub" + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.bam', checkIfExists: true) + ]) + input[1] = [ [:], [] ] + input[2] = [ [:], [] ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("sarscov2 [sorted bam] - stub") { + options "-stub" + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true) + ]) + input[1] = [ [:], [] ] + input[2] = [ [:], [] ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("homo_sapiens [cram] - stub") { + options "-stub" + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram', checkIfExists: true) + ]) + input[1] = Channel.of([ + [ id:'genome' ], + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) + ]) + input[2] = Channel.of([ + [ id:'genome' ], + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } ) } } diff --git a/modules/nf-core/picard/markduplicates/tests/main.nf.test.snap b/modules/nf-core/picard/markduplicates/tests/main.nf.test.snap index eb17111e4..1a6598aa9 100644 --- a/modules/nf-core/picard/markduplicates/tests/main.nf.test.snap +++ b/modules/nf-core/picard/markduplicates/tests/main.nf.test.snap @@ -1,110 +1,251 @@ { - "sorted_bam_versions": { + "sarscov2 [sorted bam] - stub": { "content": [ - [ - "versions.yml:md5,b699af51b1956f3810f8a7c066e0ab17" - ] + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.marked.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + + ], + "2": [ + + ], + "3": [ + [ + { + "id": "test", + "single_end": false + }, + "test.marked.MarkDuplicates.metrics.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "4": [ + "versions.yml:md5,b699af51b1956f3810f8a7c066e0ab17" + ], + "bai": [ + + ], + "bam": [ + [ + { + "id": "test", + "single_end": false + }, + "test.marked.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "cram": [ + + ], + "metrics": [ + [ + { + "id": "test", + "single_end": false + }, + "test.marked.MarkDuplicates.metrics.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,b699af51b1956f3810f8a7c066e0ab17" + ] + } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-03-20T15:31:50.928021" + "timestamp": "2024-07-22T19:34:20.663558" }, - "unsorted_bam_name": { + "sarscov2 [unsorted bam] - stub": { "content": [ - "test.marked.bam" + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.marked.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + + ], + "2": [ + + ], + "3": [ + [ + { + "id": "test", + "single_end": false + }, + "test.marked.MarkDuplicates.metrics.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "4": [ + "versions.yml:md5,b699af51b1956f3810f8a7c066e0ab17" + ], + "bai": [ + + ], + "bam": [ + [ + { + "id": "test", + "single_end": false + }, + "test.marked.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "cram": [ + + ], + "metrics": [ + [ + { + "id": "test", + "single_end": false + }, + "test.marked.MarkDuplicates.metrics.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,b699af51b1956f3810f8a7c066e0ab17" + ] + } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-01-19T10:26:28.100755" + "timestamp": "2024-07-22T19:34:01.021052" }, - "cram_metrics": { + "sarscov2 [unsorted bam]": { "content": [ + "test.marked.bam", [ "## htsjdk.samtools.metrics.StringHeader", - "# MarkDuplicates --INPUT test.paired_end.sorted.cram --OUTPUT test.marked.cram --METRICS_FILE test.marked.MarkDuplicates.metrics.txt --ASSUME_SORT_ORDER queryname --REFERENCE_SEQUENCE genome.fasta --MAX_SEQUENCES_FOR_DISK_READ_ENDS_MAP 50000 --MAX_FILE_HANDLES_FOR_READ_ENDS_MAP 8000 --SORTING_COLLECTION_SIZE_RATIO 0.25 --TAG_DUPLICATE_SET_MEMBERS false --REMOVE_SEQUENCING_DUPLICATES false --TAGGING_POLICY DontTag --CLEAR_DT true --DUPLEX_UMI false --FLOW_MODE false --FLOW_QUALITY_SUM_STRATEGY false --USE_END_IN_UNPAIRED_READS false --USE_UNPAIRED_CLIPPED_END false --UNPAIRED_END_UNCERTAINTY 0 --FLOW_SKIP_FIRST_N_FLOWS 0 --FLOW_Q_IS_KNOWN_END false --FLOW_EFFECTIVE_QUALITY_THRESHOLD 15 --ADD_PG_TAG_TO_READS true --REMOVE_DUPLICATES false --ASSUME_SORTED false --DUPLICATE_SCORING_STRATEGY SUM_OF_BASE_QUALITIES --PROGRAM_RECORD_ID MarkDuplicates --PROGRAM_GROUP_NAME MarkDuplicates --READ_NAME_REGEX --OPTICAL_DUPLICATE_PIXEL_DISTANCE 100 --MAX_OPTICAL_DUPLICATE_SET_SIZE 300000 --VERBOSITY INFO --QUIET false --VALIDATION_STRINGENCY STRICT --COMPRESSION_LEVEL 5 --MAX_RECORDS_IN_RAM 500000 --CREATE_INDEX false --CREATE_MD5_FILE false --help false --version false --showHidden false --USE_JDK_DEFLATER false --USE_JDK_INFLATER false", + "# MarkDuplicates --INPUT test.paired_end.bam --OUTPUT test.marked.bam --METRICS_FILE test.marked.MarkDuplicates.metrics.txt --ASSUME_SORT_ORDER queryname --MAX_SEQUENCES_FOR_DISK_READ_ENDS_MAP 50000 --MAX_FILE_HANDLES_FOR_READ_ENDS_MAP 8000 --SORTING_COLLECTION_SIZE_RATIO 0.25 --TAG_DUPLICATE_SET_MEMBERS false --REMOVE_SEQUENCING_DUPLICATES false --TAGGING_POLICY DontTag --CLEAR_DT true --DUPLEX_UMI false --FLOW_MODE false --FLOW_QUALITY_SUM_STRATEGY false --USE_END_IN_UNPAIRED_READS false --USE_UNPAIRED_CLIPPED_END false --UNPAIRED_END_UNCERTAINTY 0 --FLOW_SKIP_FIRST_N_FLOWS 0 --FLOW_Q_IS_KNOWN_END false --FLOW_EFFECTIVE_QUALITY_THRESHOLD 15 --ADD_PG_TAG_TO_READS true --REMOVE_DUPLICATES false --ASSUME_SORTED false --DUPLICATE_SCORING_STRATEGY SUM_OF_BASE_QUALITIES --PROGRAM_RECORD_ID MarkDuplicates --PROGRAM_GROUP_NAME MarkDuplicates --READ_NAME_REGEX --OPTICAL_DUPLICATE_PIXEL_DISTANCE 100 --MAX_OPTICAL_DUPLICATE_SET_SIZE 300000 --VERBOSITY INFO --QUIET false --VALIDATION_STRINGENCY STRICT --COMPRESSION_LEVEL 5 --MAX_RECORDS_IN_RAM 500000 --CREATE_INDEX false --CREATE_MD5_FILE false --help false --version false --showHidden false --USE_JDK_DEFLATER false --USE_JDK_INFLATER false", "## htsjdk.samtools.metrics.StringHeader" + ], + [ + "versions.yml:md5,b699af51b1956f3810f8a7c066e0ab17" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-03-20T15:25:47.518152" + "timestamp": "2024-07-22T19:32:49.777427" }, - "sorted_bam_metrics": { + "sarscov2 [sorted bam]": { "content": [ + "test.marked.bam", [ "## htsjdk.samtools.metrics.StringHeader", "# MarkDuplicates --INPUT test.paired_end.sorted.bam --OUTPUT test.marked.bam --METRICS_FILE test.marked.MarkDuplicates.metrics.txt --ASSUME_SORT_ORDER queryname --MAX_SEQUENCES_FOR_DISK_READ_ENDS_MAP 50000 --MAX_FILE_HANDLES_FOR_READ_ENDS_MAP 8000 --SORTING_COLLECTION_SIZE_RATIO 0.25 --TAG_DUPLICATE_SET_MEMBERS false --REMOVE_SEQUENCING_DUPLICATES false --TAGGING_POLICY DontTag --CLEAR_DT true --DUPLEX_UMI false --FLOW_MODE false --FLOW_QUALITY_SUM_STRATEGY false --USE_END_IN_UNPAIRED_READS false --USE_UNPAIRED_CLIPPED_END false --UNPAIRED_END_UNCERTAINTY 0 --FLOW_SKIP_FIRST_N_FLOWS 0 --FLOW_Q_IS_KNOWN_END false --FLOW_EFFECTIVE_QUALITY_THRESHOLD 15 --ADD_PG_TAG_TO_READS true --REMOVE_DUPLICATES false --ASSUME_SORTED false --DUPLICATE_SCORING_STRATEGY SUM_OF_BASE_QUALITIES --PROGRAM_RECORD_ID MarkDuplicates --PROGRAM_GROUP_NAME MarkDuplicates --READ_NAME_REGEX --OPTICAL_DUPLICATE_PIXEL_DISTANCE 100 --MAX_OPTICAL_DUPLICATE_SET_SIZE 300000 --VERBOSITY INFO --QUIET false --VALIDATION_STRINGENCY STRICT --COMPRESSION_LEVEL 5 --MAX_RECORDS_IN_RAM 500000 --CREATE_INDEX false --CREATE_MD5_FILE false --help false --version false --showHidden false --USE_JDK_DEFLATER false --USE_JDK_INFLATER false", "## htsjdk.samtools.metrics.StringHeader" - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" - }, - "timestamp": "2024-03-21T11:39:10.318331" - }, - "cram_name": { - "content": [ - "test.marked.cram" - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" - }, - "timestamp": "2024-03-20T15:25:47.459663" - }, - "cram_versions": { - "content": [ + ], [ "versions.yml:md5,b699af51b1956f3810f8a7c066e0ab17" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-01-19T10:27:03.26989" + "timestamp": "2024-07-22T19:33:14.462596" }, - "unsorted_bam_versions": { - "content": [ - [ - "versions.yml:md5,b699af51b1956f3810f8a7c066e0ab17" - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" - }, - "timestamp": "2024-03-20T15:31:24.040403" - }, - "unsorted_bam_metrics": { + "homo_sapiens [cram]": { "content": [ + "test.marked.cram", [ "## htsjdk.samtools.metrics.StringHeader", - "# MarkDuplicates --INPUT test.paired_end.bam --OUTPUT test.marked.bam --METRICS_FILE test.marked.MarkDuplicates.metrics.txt --ASSUME_SORT_ORDER queryname --MAX_SEQUENCES_FOR_DISK_READ_ENDS_MAP 50000 --MAX_FILE_HANDLES_FOR_READ_ENDS_MAP 8000 --SORTING_COLLECTION_SIZE_RATIO 0.25 --TAG_DUPLICATE_SET_MEMBERS false --REMOVE_SEQUENCING_DUPLICATES false --TAGGING_POLICY DontTag --CLEAR_DT true --DUPLEX_UMI false --FLOW_MODE false --FLOW_QUALITY_SUM_STRATEGY false --USE_END_IN_UNPAIRED_READS false --USE_UNPAIRED_CLIPPED_END false --UNPAIRED_END_UNCERTAINTY 0 --FLOW_SKIP_FIRST_N_FLOWS 0 --FLOW_Q_IS_KNOWN_END false --FLOW_EFFECTIVE_QUALITY_THRESHOLD 15 --ADD_PG_TAG_TO_READS true --REMOVE_DUPLICATES false --ASSUME_SORTED false --DUPLICATE_SCORING_STRATEGY SUM_OF_BASE_QUALITIES --PROGRAM_RECORD_ID MarkDuplicates --PROGRAM_GROUP_NAME MarkDuplicates --READ_NAME_REGEX --OPTICAL_DUPLICATE_PIXEL_DISTANCE 100 --MAX_OPTICAL_DUPLICATE_SET_SIZE 300000 --VERBOSITY INFO --QUIET false --VALIDATION_STRINGENCY STRICT --COMPRESSION_LEVEL 5 --MAX_RECORDS_IN_RAM 500000 --CREATE_INDEX false --CREATE_MD5_FILE false --help false --version false --showHidden false --USE_JDK_DEFLATER false --USE_JDK_INFLATER false", + "# MarkDuplicates --INPUT test.paired_end.sorted.cram --OUTPUT test.marked.cram --METRICS_FILE test.marked.MarkDuplicates.metrics.txt --ASSUME_SORT_ORDER queryname --REFERENCE_SEQUENCE genome.fasta --MAX_SEQUENCES_FOR_DISK_READ_ENDS_MAP 50000 --MAX_FILE_HANDLES_FOR_READ_ENDS_MAP 8000 --SORTING_COLLECTION_SIZE_RATIO 0.25 --TAG_DUPLICATE_SET_MEMBERS false --REMOVE_SEQUENCING_DUPLICATES false --TAGGING_POLICY DontTag --CLEAR_DT true --DUPLEX_UMI false --FLOW_MODE false --FLOW_QUALITY_SUM_STRATEGY false --USE_END_IN_UNPAIRED_READS false --USE_UNPAIRED_CLIPPED_END false --UNPAIRED_END_UNCERTAINTY 0 --FLOW_SKIP_FIRST_N_FLOWS 0 --FLOW_Q_IS_KNOWN_END false --FLOW_EFFECTIVE_QUALITY_THRESHOLD 15 --ADD_PG_TAG_TO_READS true --REMOVE_DUPLICATES false --ASSUME_SORTED false --DUPLICATE_SCORING_STRATEGY SUM_OF_BASE_QUALITIES --PROGRAM_RECORD_ID MarkDuplicates --PROGRAM_GROUP_NAME MarkDuplicates --READ_NAME_REGEX --OPTICAL_DUPLICATE_PIXEL_DISTANCE 100 --MAX_OPTICAL_DUPLICATE_SET_SIZE 300000 --VERBOSITY INFO --QUIET false --VALIDATION_STRINGENCY STRICT --COMPRESSION_LEVEL 5 --MAX_RECORDS_IN_RAM 500000 --CREATE_INDEX false --CREATE_MD5_FILE false --help false --version false --showHidden false --USE_JDK_DEFLATER false --USE_JDK_INFLATER false", "## htsjdk.samtools.metrics.StringHeader" + ], + [ + "versions.yml:md5,b699af51b1956f3810f8a7c066e0ab17" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-03-21T10:51:12.831787" + "timestamp": "2024-07-22T19:33:40.215159" }, - "sorted_bam_name": { + "homo_sapiens [cram] - stub": { "content": [ - "test.marked.bam" + { + "0": [ + + ], + "1": [ + + ], + "2": [ + [ + { + "id": "test", + "single_end": false + }, + "test.marked.cram:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + [ + { + "id": "test", + "single_end": false + }, + "test.marked.MarkDuplicates.metrics.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "4": [ + "versions.yml:md5,b699af51b1956f3810f8a7c066e0ab17" + ], + "bai": [ + + ], + "bam": [ + + ], + "cram": [ + [ + { + "id": "test", + "single_end": false + }, + "test.marked.cram:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "metrics": [ + [ + { + "id": "test", + "single_end": false + }, + "test.marked.MarkDuplicates.metrics.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,b699af51b1956f3810f8a7c066e0ab17" + ] + } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-01-19T10:26:45.080116" + "timestamp": "2024-07-22T19:34:51.753515" } } \ No newline at end of file diff --git a/modules/nf-core/preseq/lcextrap/tests/main.nf.test b/modules/nf-core/preseq/lcextrap/tests/main.nf.test index d1af1f0ed..50e44157e 100644 --- a/modules/nf-core/preseq/lcextrap/tests/main.nf.test +++ b/modules/nf-core/preseq/lcextrap/tests/main.nf.test @@ -3,10 +3,6 @@ nextflow_process { name "Test Process PRESEQ_LCEXTRAP" script "../main.nf" process "PRESEQ_LCEXTRAP" - tag "modules" - tag "modules_nfcore" - tag "preseq" - tag "preseq/lcextrap" test("sarscov2 - single_end") { when { diff --git a/modules/nf-core/qualimap/rnaseq/tests/main.nf.test b/modules/nf-core/qualimap/rnaseq/tests/main.nf.test index 42403c502..ff4197eeb 100644 --- a/modules/nf-core/qualimap/rnaseq/tests/main.nf.test +++ b/modules/nf-core/qualimap/rnaseq/tests/main.nf.test @@ -5,11 +5,38 @@ nextflow_process { process "QUALIMAP_RNASEQ" test("homo_sapiens [bam]") { - when { - params { - outdir = "$outputDir" + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true) + ]) + input[1] = Channel.of([ + [ id:'test_fasta_gtf' ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true) ] + ]) + """ } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot( + file("${process.out.results[0][1]}/qualimapReport.html").name, + path("${process.out.results[0][1]}/rnaseq_qc_results.txt"), + process.out.versions + ).match() } + ) + } + } + + test("homo_sapiens [bam] - stub") { + + options "-stub" + + when { process { """ input[0] = Channel.of([ @@ -27,9 +54,7 @@ nextflow_process { then { assertAll ( { assert process.success }, - { assert path("${process.out.results[0][1]}/qualimapReport.html").exists() }, - { assert snapshot(path("${process.out.results[0][1]}/rnaseq_qc_results.txt")).match("rnaseq_qc_results") }, - { assert snapshot(process.out.versions).match("versions") } + { assert snapshot(process.out).match() } ) } } diff --git a/modules/nf-core/qualimap/rnaseq/tests/main.nf.test.snap b/modules/nf-core/qualimap/rnaseq/tests/main.nf.test.snap index 7d1c72811..682462639 100644 --- a/modules/nf-core/qualimap/rnaseq/tests/main.nf.test.snap +++ b/modules/nf-core/qualimap/rnaseq/tests/main.nf.test.snap @@ -1,16 +1,55 @@ { - "rnaseq_qc_results": { + "homo_sapiens [bam] - stub": { "content": [ - "rnaseq_qc_results.txt:md5,b77878cac45beaa79a892af54aad2da3" + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + [ + + ] + ] + ], + "1": [ + "versions.yml:md5,a6868ab89f7d31361a7791db2dea98e7" + ], + "results": [ + [ + { + "id": "test", + "single_end": false + }, + [ + + ] + ] + ], + "versions": [ + "versions.yml:md5,a6868ab89f7d31361a7791db2dea98e7" + ] + } ], - "timestamp": "2024-01-19T12:07:55.509784" + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T11:27:41.158111" }, - "versions": { + "homo_sapiens [bam]": { "content": [ + "qualimapReport.html", + "rnaseq_qc_results.txt:md5,b77878cac45beaa79a892af54aad2da3", [ "versions.yml:md5,a6868ab89f7d31361a7791db2dea98e7" ] ], - "timestamp": "2024-01-19T12:07:55.512116" + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T11:27:30.782304" } } \ No newline at end of file diff --git a/modules/nf-core/salmon/quant/tests/main.nf.test b/modules/nf-core/salmon/quant/tests/main.nf.test index 1bd264e96..24d8dd700 100644 --- a/modules/nf-core/salmon/quant/tests/main.nf.test +++ b/modules/nf-core/salmon/quant/tests/main.nf.test @@ -4,7 +4,7 @@ nextflow_process { script "../main.nf" process "SALMON_QUANT" config "./nextflow.config" - + setup { run("SALMON_INDEX") { script "../../../salmon/index/main.nf" diff --git a/modules/nf-core/samtools/flagstat/tests/main.nf.test b/modules/nf-core/samtools/flagstat/tests/main.nf.test index 4d3742361..b899f1fc7 100644 --- a/modules/nf-core/samtools/flagstat/tests/main.nf.test +++ b/modules/nf-core/samtools/flagstat/tests/main.nf.test @@ -7,9 +7,30 @@ nextflow_process { test("BAM") { when { - params { - outdir = "$outputDir" + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true) + ]) + """ } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("BAM - stub") { + + options "-stub" + + when { process { """ input[0] = Channel.of([ @@ -24,8 +45,7 @@ nextflow_process { then { assertAll ( { assert process.success }, - { assert snapshot(process.out.flagstat).match("flagstat") }, - { assert snapshot(process.out.versions).match("versions") } + { assert snapshot(process.out).match() } ) } } diff --git a/modules/nf-core/samtools/flagstat/tests/main.nf.test.snap b/modules/nf-core/samtools/flagstat/tests/main.nf.test.snap index e9f85efa9..23989c612 100644 --- a/modules/nf-core/samtools/flagstat/tests/main.nf.test.snap +++ b/modules/nf-core/samtools/flagstat/tests/main.nf.test.snap @@ -1,32 +1,72 @@ { - "flagstat": { + "BAM - stub": { "content": [ - [ - [ - { - "id": "test", - "single_end": false - }, - "test.flagstat:md5,4f7ffd1e6a5e85524d443209ac97d783" + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + "versions.yml:md5,f606681ef971cbb548a4d9e3fbabdbc2" + ], + "flagstat": [ + [ + { + "id": "test", + "single_end": false + }, + "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,f606681ef971cbb548a4d9e3fbabdbc2" ] - ] + } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.04.3" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-02-12T18:31:37.783927" + "timestamp": "2024-07-22T14:17:28.002887" }, - "versions": { + "BAM": { "content": [ - [ - "versions.yml:md5,f606681ef971cbb548a4d9e3fbabdbc2" - ] + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.flagstat:md5,4f7ffd1e6a5e85524d443209ac97d783" + ] + ], + "1": [ + "versions.yml:md5,f606681ef971cbb548a4d9e3fbabdbc2" + ], + "flagstat": [ + [ + { + "id": "test", + "single_end": false + }, + "test.flagstat:md5,4f7ffd1e6a5e85524d443209ac97d783" + ] + ], + "versions": [ + "versions.yml:md5,f606681ef971cbb548a4d9e3fbabdbc2" + ] + } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-05-28T15:41:52.516253882" + "timestamp": "2024-07-22T14:17:13.330971" } } \ No newline at end of file diff --git a/modules/nf-core/samtools/idxstats/tests/main.nf.test b/modules/nf-core/samtools/idxstats/tests/main.nf.test index e6c427053..bf4c31047 100644 --- a/modules/nf-core/samtools/idxstats/tests/main.nf.test +++ b/modules/nf-core/samtools/idxstats/tests/main.nf.test @@ -7,9 +7,6 @@ nextflow_process { test("bam") { when { - params { - outdir = "$outputDir" - } process { """ input[0] = Channel.of([ @@ -24,9 +21,29 @@ nextflow_process { then { assertAll ( { assert process.success }, - { assert snapshot(process.out.idxstats).match("idxstats") }, - { assert snapshot(process.out.versions).match("versions") } + { assert snapshot(process.out).match() } ) } } -} + + test("bam - stub") { + options "-stub" + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + }} diff --git a/modules/nf-core/samtools/idxstats/tests/main.nf.test.snap b/modules/nf-core/samtools/idxstats/tests/main.nf.test.snap index 4eacdb90f..a5ac8104e 100644 --- a/modules/nf-core/samtools/idxstats/tests/main.nf.test.snap +++ b/modules/nf-core/samtools/idxstats/tests/main.nf.test.snap @@ -1,32 +1,72 @@ { - "versions": { + "bam - stub": { "content": [ - [ - "versions.yml:md5,7acbcb2a8ec6436ba7b2916d3ff13351" - ] + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.idxstats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + "versions.yml:md5,7acbcb2a8ec6436ba7b2916d3ff13351" + ], + "idxstats": [ + [ + { + "id": "test", + "single_end": false + }, + "test.idxstats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,7acbcb2a8ec6436ba7b2916d3ff13351" + ] + } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-05-28T15:46:46.617989517" + "timestamp": "2024-07-22T14:17:56.180093" }, - "idxstats": { + "bam": { "content": [ - [ - [ - { - "id": "test", - "single_end": false - }, - "test.idxstats:md5,df60a8c8d6621100d05178c93fb053a2" + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.idxstats:md5,df60a8c8d6621100d05178c93fb053a2" + ] + ], + "1": [ + "versions.yml:md5,7acbcb2a8ec6436ba7b2916d3ff13351" + ], + "idxstats": [ + [ + { + "id": "test", + "single_end": false + }, + "test.idxstats:md5,df60a8c8d6621100d05178c93fb053a2" + ] + ], + "versions": [ + "versions.yml:md5,7acbcb2a8ec6436ba7b2916d3ff13351" ] - ] + } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.04.3" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-02-12T18:36:41.561026" + "timestamp": "2024-07-22T14:17:41.408704" } } \ No newline at end of file diff --git a/modules/nf-core/samtools/index/main.nf b/modules/nf-core/samtools/index/main.nf index b523c21b4..e002585b9 100644 --- a/modules/nf-core/samtools/index/main.nf +++ b/modules/nf-core/samtools/index/main.nf @@ -35,10 +35,11 @@ process SAMTOOLS_INDEX { """ stub: + def args = task.ext.args ?: '' + def extension = file(input).getExtension() == 'cram' ? + "crai" : args.contains("-c") ? "csi" : "bai" """ - touch ${input}.bai - touch ${input}.crai - touch ${input}.csi + touch ${input}.${extension} cat <<-END_VERSIONS > versions.yml "${task.process}": diff --git a/modules/nf-core/samtools/index/tests/main.nf.test b/modules/nf-core/samtools/index/tests/main.nf.test index e3f918965..b59a25b38 100644 --- a/modules/nf-core/samtools/index/tests/main.nf.test +++ b/modules/nf-core/samtools/index/tests/main.nf.test @@ -5,11 +5,7 @@ nextflow_process { process "SAMTOOLS_INDEX" test("bai") { - when { - params { - outdir = "$outputDir" - } process { """ input[0] = Channel.of([ @@ -23,18 +19,13 @@ nextflow_process { then { assertAll ( { assert process.success }, - { assert snapshot(process.out.bai).match("bai") }, - { assert snapshot(process.out.versions).match("bai_versions") } + { assert snapshot(process.out).match() } ) } } test("crai") { - when { - params { - outdir = "$outputDir" - } process { """ input[0] = Channel.of([ @@ -48,20 +39,83 @@ nextflow_process { then { assertAll ( { assert process.success }, - { assert snapshot(process.out.crai).match("crai") }, - { assert snapshot(process.out.versions).match("crai_versions") } + { assert snapshot(process.out).match() } ) } } test("csi") { - config "./csi.nextflow.config" when { - params { - outdir = "$outputDir" + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot( + file(process.out.csi[0][1]).name, + process.out.versions + ).match() } + ) + } + } + + test("bai - stub") { + options "-stub" + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("crai - stub") { + options "-stub" + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.recalibrated.sorted.cram', checkIfExists: true) + ]) + """ } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("csi - stub") { + options "-stub" + config "./csi.nextflow.config" + + when { process { """ input[0] = Channel.of([ @@ -75,8 +129,7 @@ nextflow_process { then { assertAll ( { assert process.success }, - { assert path(process.out.csi.get(0).get(1)).exists() }, - { assert snapshot(process.out.versions).match("csi_versions") } + { assert snapshot(process.out).match() } ) } } diff --git a/modules/nf-core/samtools/index/tests/main.nf.test.snap b/modules/nf-core/samtools/index/tests/main.nf.test.snap index 52756e85c..799d199ce 100644 --- a/modules/nf-core/samtools/index/tests/main.nf.test.snap +++ b/modules/nf-core/samtools/index/tests/main.nf.test.snap @@ -1,74 +1,250 @@ { - "crai_versions": { + "csi - stub": { "content": [ - [ - "versions.yml:md5,802c9776d9c5e95314e888cf18e96d77" - ] + { + "0": [ + + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.paired_end.sorted.bam.csi:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + + ], + "3": [ + "versions.yml:md5,802c9776d9c5e95314e888cf18e96d77" + ], + "bai": [ + + ], + "crai": [ + + ], + "csi": [ + [ + { + "id": "test", + "single_end": false + }, + "test.paired_end.sorted.bam.csi:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,802c9776d9c5e95314e888cf18e96d77" + ] + } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-05-28T15:42:04.203740976" + "timestamp": "2024-07-22T16:51:53.9057" }, - "csi_versions": { + "crai - stub": { "content": [ - [ - "versions.yml:md5,802c9776d9c5e95314e888cf18e96d77" - ] + { + "0": [ + + ], + "1": [ + + ], + "2": [ + [ + { + "id": "test", + "single_end": false + }, + "test.paired_end.recalibrated.sorted.cram.crai:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + "versions.yml:md5,802c9776d9c5e95314e888cf18e96d77" + ], + "bai": [ + + ], + "crai": [ + [ + { + "id": "test", + "single_end": false + }, + "test.paired_end.recalibrated.sorted.cram.crai:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "csi": [ + + ], + "versions": [ + "versions.yml:md5,802c9776d9c5e95314e888cf18e96d77" + ] + } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-05-28T15:42:09.57475878" + "timestamp": "2024-07-22T16:51:45.931558" }, - "crai": { + "bai - stub": { "content": [ - [ - [ - { - "id": "test", - "single_end": false - }, - "test.paired_end.recalibrated.sorted.cram.crai:md5,14bc3bd5c89cacc8f4541f9062429029" + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.paired_end.sorted.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + + ], + "2": [ + + ], + "3": [ + "versions.yml:md5,802c9776d9c5e95314e888cf18e96d77" + ], + "bai": [ + [ + { + "id": "test", + "single_end": false + }, + "test.paired_end.sorted.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "crai": [ + + ], + "csi": [ + + ], + "versions": [ + "versions.yml:md5,802c9776d9c5e95314e888cf18e96d77" ] - ] + } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.04.3" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-02-12T18:41:38.446424" + "timestamp": "2024-07-22T16:51:34.807525" }, - "bai": { + "csi": { "content": [ + "test.paired_end.sorted.bam.csi", [ - [ - { - "id": "test", - "single_end": false - }, - "test.paired_end.sorted.bam.bai:md5,704c10dd1326482448ca3073fdebc2f4" - ] + "versions.yml:md5,802c9776d9c5e95314e888cf18e96d77" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.04.3" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-02-12T18:40:46.579747" + "timestamp": "2024-07-22T16:52:55.688799" }, - "bai_versions": { + "crai": { "content": [ - [ - "versions.yml:md5,802c9776d9c5e95314e888cf18e96d77" - ] + { + "0": [ + + ], + "1": [ + + ], + "2": [ + [ + { + "id": "test", + "single_end": false + }, + "test.paired_end.recalibrated.sorted.cram.crai:md5,14bc3bd5c89cacc8f4541f9062429029" + ] + ], + "3": [ + "versions.yml:md5,802c9776d9c5e95314e888cf18e96d77" + ], + "bai": [ + + ], + "crai": [ + [ + { + "id": "test", + "single_end": false + }, + "test.paired_end.recalibrated.sorted.cram.crai:md5,14bc3bd5c89cacc8f4541f9062429029" + ] + ], + "csi": [ + + ], + "versions": [ + "versions.yml:md5,802c9776d9c5e95314e888cf18e96d77" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T16:51:17.609533" + }, + "bai": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.paired_end.sorted.bam.bai:md5,704c10dd1326482448ca3073fdebc2f4" + ] + ], + "1": [ + + ], + "2": [ + + ], + "3": [ + "versions.yml:md5,802c9776d9c5e95314e888cf18e96d77" + ], + "bai": [ + [ + { + "id": "test", + "single_end": false + }, + "test.paired_end.sorted.bam.bai:md5,704c10dd1326482448ca3073fdebc2f4" + ] + ], + "crai": [ + + ], + "csi": [ + + ], + "versions": [ + "versions.yml:md5,802c9776d9c5e95314e888cf18e96d77" + ] + } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-05-28T15:41:57.929287369" + "timestamp": "2024-07-22T16:51:04.16585" } } \ No newline at end of file diff --git a/modules/nf-core/samtools/sort/main.nf b/modules/nf-core/samtools/sort/main.nf index 596c6f7e9..8e019099c 100644 --- a/modules/nf-core/samtools/sort/main.nf +++ b/modules/nf-core/samtools/sort/main.nf @@ -50,10 +50,20 @@ process SAMTOOLS_SORT { """ stub: + def args = task.ext.args ?: '' def prefix = task.ext.prefix ?: "${meta.id}" + def extension = args.contains("--output-fmt sam") ? "sam" : + args.contains("--output-fmt cram") ? "cram" : + "bam" """ - touch ${prefix}.bam - touch ${prefix}.bam.csi + touch ${prefix}.${extension} + if [ "${extension}" == "bam" ]; + then + touch ${prefix}.${extension}.csi + elif [ "${extension}" == "cram" ]; + then + touch ${prefix}.${extension}.crai + fi cat <<-END_VERSIONS > versions.yml "${task.process}": diff --git a/modules/nf-core/samtools/sort/tests/main.nf.test b/modules/nf-core/samtools/sort/tests/main.nf.test index cb97ca66b..41c2fca7f 100644 --- a/modules/nf-core/samtools/sort/tests/main.nf.test +++ b/modules/nf-core/samtools/sort/tests/main.nf.test @@ -28,16 +28,16 @@ nextflow_process { { assert process.success }, { assert snapshot( process.out.bam, - process.out.csi.collect { it.collect { it instanceof Map ? it : file(it).name } } - ).match("test_bam") - } + process.out.csi.collect { it.collect { it instanceof Map ? it : file(it).name } }, + process.out.versions + ).match()} ) } } test("cram") { - config "./nextflow.config" + config "./nextflow_cram.config" when { process { @@ -58,23 +58,20 @@ nextflow_process { assertAll ( { assert process.success }, { assert snapshot( - process.out.bam, - process.out.csi.collect { it.collect { it instanceof Map ? it : file(it).name } } - ).match("test_cram") - } + process.out.cram.collect { it.collect { it instanceof Map ? it : file(it).name } }, + process.out.crai.collect { it.collect { it instanceof Map ? it : file(it).name } }, + process.out.versions + ).match()} ) } } - test("bam_stub") { + test("bam - stub") { - config "./nextflow.config" options "-stub" + config "./nextflow.config" when { - params { - outdir = "$outputDir" - } process { """ input[0] = Channel.of([ @@ -92,8 +89,35 @@ nextflow_process { then { assertAll ( { assert process.success }, - { assert snapshot(file(process.out.bam[0][1]).name).match("bam_stub_bam") }, - { assert snapshot(process.out.versions).match("bam_stub_versions") } + { assert snapshot(process.out).match() } + ) + } + } + + test("cram - stub") { + + options "-stub" + config "./nextflow_cram.config" + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram', checkIfExists: true) + ]) + input[1] = Channel.of([ + [ id:'fasta' ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } ) } } diff --git a/modules/nf-core/samtools/sort/tests/main.nf.test.snap b/modules/nf-core/samtools/sort/tests/main.nf.test.snap index 5a27de1d1..da38d5d15 100644 --- a/modules/nf-core/samtools/sort/tests/main.nf.test.snap +++ b/modules/nf-core/samtools/sort/tests/main.nf.test.snap @@ -7,54 +7,159 @@ "id": "test", "single_end": false }, - "test.sorted.bam:md5,21c992d59615936b99f2ad008aa54400" + "test.sorted.cram" ] + ], + [ + [ + { + "id": "test", + "single_end": false + }, + "test.sorted.cram.crai" + ] + ], + [ + "versions.yml:md5,7a360de20e1d7a6f15a5e8fbe0a9c062" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-05-31T08:13:54.512837189" + "timestamp": "2024-07-22T17:19:37.196205" }, - "bam_stub_bam": { + "bam - stub": { "content": [ - "test.sorted.bam" + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.sorted.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + + ], + "2": [ + + ], + "3": [ + [ + { + "id": "test", + "single_end": false + }, + "test.sorted.bam.csi:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "4": [ + "versions.yml:md5,7a360de20e1d7a6f15a5e8fbe0a9c062" + ], + "bam": [ + [ + { + "id": "test", + "single_end": false + }, + "test.sorted.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "crai": [ + + ], + "cram": [ + + ], + "csi": [ + [ + { + "id": "test", + "single_end": false + }, + "test.sorted.bam.csi:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,7a360de20e1d7a6f15a5e8fbe0a9c062" + ] + } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-05-31T07:29:00.761845507" + "timestamp": "2024-07-22T15:54:46.580756" }, - "test_cram": { + "cram - stub": { "content": [ - [ - [ - { - "id": "test", - "single_end": false - }, - "test.sorted.bam:md5,22b2093be34a7637f5fbc84272b89d06" - ] - ], - [ - [ - { - "id": "test", - "single_end": false - }, - "test.sorted.bam.csi" + { + "0": [ + + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.sorted.cram:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + [ + { + "id": "test", + "single_end": false + }, + "test.sorted.cram.crai:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + + ], + "4": [ + "versions.yml:md5,7a360de20e1d7a6f15a5e8fbe0a9c062" + ], + "bam": [ + + ], + "crai": [ + [ + { + "id": "test", + "single_end": false + }, + "test.sorted.cram.crai:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "cram": [ + [ + { + "id": "test", + "single_end": false + }, + "test.sorted.cram:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "csi": [ + + ], + "versions": [ + "versions.yml:md5,7a360de20e1d7a6f15a5e8fbe0a9c062" ] - ] + } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-05-31T09:16:51.924951855" + "timestamp": "2024-07-22T15:57:30.505698" }, - "test_bam": { + "bam": { "content": [ [ [ @@ -73,42 +178,15 @@ }, "test.sorted.bam.csi" ] - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" - }, - "timestamp": "2024-05-31T08:28:12.15952312" - }, - "bam_stub_versions": { - "content": [ + ], [ "versions.yml:md5,7a360de20e1d7a6f15a5e8fbe0a9c062" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" - }, - "timestamp": "2024-05-31T07:29:00.765038811" - }, - "bam": { - "content": [ - [ - [ - { - "id": "test", - "single_end": false - }, - "test.sorted.bam:md5,21c992d59615936b99f2ad008aa54400" - ] - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-05-31T08:13:48.538030517" + "timestamp": "2024-07-22T15:54:25.872954" } } \ No newline at end of file diff --git a/modules/nf-core/samtools/sort/tests/nextflow_cram.config b/modules/nf-core/samtools/sort/tests/nextflow_cram.config new file mode 100644 index 000000000..3a8c0188b --- /dev/null +++ b/modules/nf-core/samtools/sort/tests/nextflow_cram.config @@ -0,0 +1,8 @@ +process { + + withName: SAMTOOLS_SORT { + ext.prefix = { "${meta.id}.sorted" } + ext.args = "--write-index --output-fmt cram" + } + +} diff --git a/modules/nf-core/samtools/stats/tests/main.nf.test b/modules/nf-core/samtools/stats/tests/main.nf.test index a28964666..6416ae127 100644 --- a/modules/nf-core/samtools/stats/tests/main.nf.test +++ b/modules/nf-core/samtools/stats/tests/main.nf.test @@ -7,9 +7,6 @@ nextflow_process { test("bam") { when { - params { - outdir = "$outputDir" - } process { """ input[0] = Channel.of([ @@ -33,9 +30,59 @@ nextflow_process { test("cram") { when { - params { - outdir = "$outputDir" + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.recalibrated.sorted.cram', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.recalibrated.sorted.cram.crai', checkIfExists: true) + ]) + input[1] = Channel.of([ + [ id:'genome' ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll( + {assert process.success}, + {assert snapshot(process.out).match()} + ) + } + } + + test("bam - stub") { + + options "-stub" + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true) + ]) + input[1] = [[],[]] + """ } + } + + then { + assertAll( + {assert process.success}, + {assert snapshot(process.out).match()} + ) + } + } + + test("cram - stub") { + + options "-stub" + + when { process { """ input[0] = Channel.of([ @@ -45,7 +92,7 @@ nextflow_process { ]) input[1] = Channel.of([ [ id:'genome' ], // meta map - file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta', checkIfExists: true) ]) """ } diff --git a/modules/nf-core/samtools/stats/tests/main.nf.test.snap b/modules/nf-core/samtools/stats/tests/main.nf.test.snap index 2747fd6c6..3828f3788 100644 --- a/modules/nf-core/samtools/stats/tests/main.nf.test.snap +++ b/modules/nf-core/samtools/stats/tests/main.nf.test.snap @@ -29,10 +29,80 @@ } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-05-28T15:45:24.403941966" + "timestamp": "2024-07-22T14:20:24.885816" + }, + "bam - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.stats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + "versions.yml:md5,b3b70b126f867fdbb7dcea5e36e49d4a" + ], + "stats": [ + [ + { + "id": "test", + "single_end": false + }, + "test.stats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,b3b70b126f867fdbb7dcea5e36e49d4a" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T14:20:39.310713" + }, + "cram - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.stats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + "versions.yml:md5,b3b70b126f867fdbb7dcea5e36e49d4a" + ], + "stats": [ + [ + { + "id": "test", + "single_end": false + }, + "test.stats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,b3b70b126f867fdbb7dcea5e36e49d4a" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T14:21:04.771199" }, "bam": { "content": [ @@ -64,9 +134,9 @@ } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-05-28T15:45:06.711251947" + "timestamp": "2024-07-22T14:19:06.645466" } } \ No newline at end of file diff --git a/modules/nf-core/sortmerna/tests/main.nf.test b/modules/nf-core/sortmerna/tests/main.nf.test index 4388cda0c..1954bdfb0 100644 --- a/modules/nf-core/sortmerna/tests/main.nf.test +++ b/modules/nf-core/sortmerna/tests/main.nf.test @@ -5,7 +5,7 @@ nextflow_process { process "SORTMERNA" test("sarscov2 indexing only") { - + config './indexing_only.config' when { diff --git a/modules/nf-core/star/align/main.nf b/modules/nf-core/star/align/main.nf index 8e9c48b1c..ae67e0040 100644 --- a/modules/nf-core/star/align/main.nf +++ b/modules/nf-core/star/align/main.nf @@ -81,6 +81,8 @@ process STAR_ALIGN { stub: def prefix = task.ext.prefix ?: "${meta.id}" """ + echo "" | gzip > ${prefix}.unmapped_1.fastq.gz + echo "" | gzip > ${prefix}.unmapped_2.fastq.gz touch ${prefix}Xd.out.bam touch ${prefix}.Log.final.out touch ${prefix}.Log.out @@ -89,8 +91,6 @@ process STAR_ALIGN { touch ${prefix}.toTranscriptome.out.bam touch ${prefix}.Aligned.unsort.out.bam touch ${prefix}.Aligned.sortedByCoord.out.bam - touch ${prefix}.unmapped_1.fastq.gz - touch ${prefix}.unmapped_2.fastq.gz touch ${prefix}.tab touch ${prefix}.SJ.out.tab touch ${prefix}.ReadsPerGene.out.tab diff --git a/modules/nf-core/star/align/tests/main.nf.test b/modules/nf-core/star/align/tests/main.nf.test index 4cd6f2a52..69f655ef4 100644 --- a/modules/nf-core/star/align/tests/main.nf.test +++ b/modules/nf-core/star/align/tests/main.nf.test @@ -4,27 +4,367 @@ nextflow_process { script "../main.nf" process "STAR_ALIGN" - setup { - run("STAR_GENOMEGENERATE") { - script "../../../star/genomegenerate/main.nf" + test("homo_sapiens - single_end") { + config "./nextflow.config" + + setup { + run("STAR_GENOMEGENERATE") { + script "../../../star/genomegenerate/main.nf" + process { + """ + input[0] = Channel.of([ + [ id:'test_fasta' ], + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) ] + ]) + input[1] = Channel.of([ + [ id:'test_gtf' ], + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true) ] + ]) + """ + } + } + } + + when { process { """ input[0] = Channel.of([ - [ id:'test_fasta' ], - [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) ] + [ id:'test', single_end:true ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_rnaseq_1.fastq.gz', checkIfExists: true) ] ]) - input[1] = Channel.of([ + input[1] = STAR_GENOMEGENERATE.out.index + input[2] = Channel.of([ [ id:'test_gtf' ], [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true) ] ]) + input[3] = false + input[4] = 'illumina' + input[5] = false """ } } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + file(process.out.log_final[0][1]).name, + file(process.out.log_out[0][1]).name, + file(process.out.log_progress[0][1]).name, + process.out.bam, + process.out.bam_sorted, + process.out.bam_transcript, + process.out.bam_unsorted, + process.out.bedgraph, + process.out.fastq, + process.out.junction, + process.out.read_per_gene_tab, + process.out.sam, + process.out.spl_junc_tab, + process.out.tab, + process.out.wig, + process.out.versions + ).match() } + ) + } } - test("homo_sapiens - single_end") { + test("homo_sapiens - paired_end") { + config "./nextflow.config" + + setup { + run("STAR_GENOMEGENERATE") { + script "../../../star/genomegenerate/main.nf" + process { + """ + input[0] = Channel.of([ + [ id:'test_fasta' ], + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) ] + ]) + input[1] = Channel.of([ + [ id:'test_gtf' ], + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true) ] + ]) + """ + } + } + } + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_rnaseq_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_rnaseq_2.fastq.gz', checkIfExists: true) + ] + ]) + input[1] = STAR_GENOMEGENERATE.out.index + input[2] = Channel.of([ + [ id:'test_gtf' ], + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true) ] + ]) + input[3] = false + input[4] = 'illumina' + input[5] = false + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + file(process.out.log_final[0][1]).name, + file(process.out.log_out[0][1]).name, + file(process.out.log_progress[0][1]).name, + process.out.bam, + process.out.bam_sorted, + process.out.bam_transcript, + process.out.bam_unsorted, + process.out.bedgraph, + process.out.fastq, + process.out.junction, + process.out.read_per_gene_tab, + process.out.sam, + process.out.spl_junc_tab, + process.out.tab, + process.out.wig, + process.out.versions + ).match() } + ) + } + } + + test("homo_sapiens - paired_end - arriba") { + config "./nextflow.arriba.config" + + setup { + run("STAR_GENOMEGENERATE") { + script "../../../star/genomegenerate/main.nf" + process { + """ + input[0] = Channel.of([ + [ id:'test_fasta' ], + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) ] + ]) + input[1] = Channel.of([ + [ id:'test_gtf' ], + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true) ] + ]) + """ + } + } + } + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_rnaseq_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_rnaseq_2.fastq.gz', checkIfExists: true) + ] + ]) + input[1] = STAR_GENOMEGENERATE.out.index + input[2] = Channel.of([ + [ id:'test_gtf' ], + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true) ] + ]) + input[3] = false + input[4] = 'illumina' + input[5] = false + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + file(process.out.log_final[0][1]).name, + file(process.out.log_out[0][1]).name, + file(process.out.log_progress[0][1]).name, + process.out.bam, + process.out.bam_sorted, + process.out.bam_transcript, + process.out.bam_unsorted, + process.out.bedgraph, + process.out.fastq, + process.out.junction, + process.out.read_per_gene_tab, + process.out.sam, + process.out.spl_junc_tab, + process.out.tab, + process.out.wig, + process.out.versions + ).match() } + ) + } + } + + test("homo_sapiens - paired_end - starfusion") { + config "./nextflow.starfusion.config" + + setup { + run("STAR_GENOMEGENERATE") { + script "../../../star/genomegenerate/main.nf" + process { + """ + input[0] = Channel.of([ + [ id:'test_fasta' ], + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) ] + ]) + input[1] = Channel.of([ + [ id:'test_gtf' ], + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true) ] + ]) + """ + } + } + } + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_rnaseq_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_rnaseq_2.fastq.gz', checkIfExists: true) + ] + ]) + input[1] = STAR_GENOMEGENERATE.out.index + input[2] = Channel.of([ + [ id:'test_gtf' ], + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true) ] + ]) + input[3] = false + input[4] = 'illumina' + input[5] = false + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + file(process.out.log_final[0][1]).name, + file(process.out.log_out[0][1]).name, + file(process.out.log_progress[0][1]).name, + process.out.bam, + process.out.bam_sorted, + process.out.bam_transcript, + process.out.bam_unsorted, + process.out.bedgraph, + process.out.fastq, + process.out.junction, + process.out.read_per_gene_tab, + process.out.sam, + process.out.spl_junc_tab, + process.out.tab, + process.out.wig, + process.out.versions + ).match() } + ) + } + } + + test("homo_sapiens - paired_end - multiple") { config "./nextflow.config" + setup { + run("STAR_GENOMEGENERATE") { + script "../../../star/genomegenerate/main.nf" + process { + """ + input[0] = Channel.of([ + [ id:'test_fasta' ], + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) ] + ]) + input[1] = Channel.of([ + [ id:'test_gtf' ], + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true) ] + ]) + """ + } + } + } + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_rnaseq_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_rnaseq_2.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_rnaseq_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_rnaseq_2.fastq.gz', checkIfExists: true) + ] + ]) + input[1] = STAR_GENOMEGENERATE.out.index + input[2] = Channel.of([ + [ id:'test_gtf' ], + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true) ] + ]) + input[3] = false + input[4] = 'illumina' + input[5] = false + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + file(process.out.log_final[0][1]).name, + file(process.out.log_out[0][1]).name, + file(process.out.log_progress[0][1]).name, + process.out.bam, + process.out.bam_sorted, + process.out.bam_transcript, + process.out.bam_unsorted, + process.out.bedgraph, + process.out.fastq, + process.out.junction, + process.out.read_per_gene_tab, + process.out.sam, + process.out.spl_junc_tab, + process.out.tab, + process.out.wig, + process.out.versions + ).match() } + ) + } + } + + test("homo_sapiens - single_end - stub") { + options "-stub" + config "./nextflow.config" + + setup { + run("STAR_GENOMEGENERATE") { + script "../../../star/genomegenerate/main.nf" + process { + """ + input[0] = Channel.of([ + [ id:'test_fasta' ], + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) ] + ]) + input[1] = Channel.of([ + [ id:'test_gtf' ], + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true) ] + ]) + """ + } + } + } + when { process { """ @@ -47,29 +387,33 @@ nextflow_process { then { assertAll( { assert process.success }, - { assert snapshot(file(process.out.log_final[0][1]).name).match("homo_sapiens - single_end - log_final") }, - { assert snapshot(file(process.out.log_out[0][1]).name).match("homo_sapiens - single_end - log_out") }, - { assert snapshot(process.out.bam).match("homo_sapiens - single_end - bam") }, - { assert snapshot(process.out.bam_sorted).match("homo_sapiens - single_end - bam_sorted") }, - { assert snapshot(process.out.bam_transcript).match("homo_sapiens - single_end - bam_transcript") }, - { assert snapshot(process.out.bam_unsorted).match("homo_sapiens - single_end - bam_unsorted") }, - { assert snapshot(process.out.bedgraph).match("homo_sapiens - single_end - bedgraph") }, - { assert snapshot(process.out.fastq).match("homo_sapiens - single_end - fastq") }, - { assert snapshot(process.out.junction).match("homo_sapiens - single_end - junction") }, - { assert snapshot(process.out.log_progress).match("homo_sapiens - single_end - log_progress") }, - { assert snapshot(process.out.read_per_gene_tab).match("homo_sapiens - single_end - read_per_gene_tab") }, - { assert snapshot(process.out.sam).match("homo_sapiens - single_end - sam") }, - { assert snapshot(process.out.spl_junc_tab).match("homo_sapiens - single_end - spl_junc_tab") }, - { assert snapshot(process.out.tab).match("homo_sapiens - single_end - tab") }, - { assert snapshot(process.out.wig).match("homo_sapiens - single_end - wig") }, - { assert snapshot(process.out.versions).match("homo_sapiens - single_end - versions") } + { assert snapshot(process.out).match() } ) } } - test("homo_sapiens - paired_end") { + test("homo_sapiens - paired_end - stub") { + options "-stub" config "./nextflow.config" + setup { + run("STAR_GENOMEGENERATE") { + script "../../../star/genomegenerate/main.nf" + process { + """ + input[0] = Channel.of([ + [ id:'test_fasta' ], + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) ] + ]) + input[1] = Channel.of([ + [ id:'test_gtf' ], + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true) ] + ]) + """ + } + } + } + when { process { """ @@ -95,29 +439,33 @@ nextflow_process { then { assertAll( { assert process.success }, - { assert snapshot(file(process.out.log_final[0][1]).name).match("homo_sapiens - paired_end - log_final") }, - { assert snapshot(file(process.out.log_out[0][1]).name).match("homo_sapiens - paired_end - log_out") }, - { assert snapshot(process.out.bam).match("homo_sapiens - paired_end - bam") }, - { assert snapshot(process.out.bam_sorted).match("homo_sapiens - paired_end - bam_sorted") }, - { assert snapshot(process.out.bam_transcript).match("homo_sapiens - paired_end - bam_transcript") }, - { assert snapshot(process.out.bam_unsorted).match("homo_sapiens - paired_end - bam_unsorted") }, - { assert snapshot(process.out.bedgraph).match("homo_sapiens - paired_end - bedgraph") }, - { assert snapshot(process.out.fastq).match("homo_sapiens - paired_end - fastq") }, - { assert snapshot(process.out.junction).match("homo_sapiens - paired_end - junction") }, - { assert snapshot(process.out.log_progress).match("homo_sapiens - paired_end - log_progress") }, - { assert snapshot(process.out.read_per_gene_tab).match("homo_sapiens - paired_end - read_per_gene_tab") }, - { assert snapshot(process.out.sam).match("homo_sapiens - paired_end - sam") }, - { assert snapshot(process.out.spl_junc_tab).match("homo_sapiens - paired_end - spl_junc_tab") }, - { assert snapshot(process.out.tab).match("homo_sapiens - paired_end - tab") }, - { assert snapshot(process.out.wig).match("homo_sapiens - paired_end - wig") }, - { assert snapshot(process.out.versions).match("homo_sapiens - paired_end - versions") } + { assert snapshot(process.out).match() } ) } } - test("homo_sapiens - paired_end - arriba") { + test("homo_sapiens - paired_end - arriba - stub") { + options "-stub" config "./nextflow.arriba.config" + setup { + run("STAR_GENOMEGENERATE") { + script "../../../star/genomegenerate/main.nf" + process { + """ + input[0] = Channel.of([ + [ id:'test_fasta' ], + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) ] + ]) + input[1] = Channel.of([ + [ id:'test_gtf' ], + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true) ] + ]) + """ + } + } + } + when { process { """ @@ -143,29 +491,33 @@ nextflow_process { then { assertAll( { assert process.success }, - { assert snapshot(file(process.out.log_final[0][1]).name).match("homo_sapiens - paired_end - arriba - log_final") }, - { assert snapshot(file(process.out.log_out[0][1]).name).match("homo_sapiens - paired_end - arriba - log_out") }, - { assert snapshot(file(process.out.log_progress[0][1]).name).match("homo_sapiens - paired_end - arriba - log_progress") }, - { assert snapshot(process.out.bam).match("homo_sapiens - paired_end - arriba - bam") }, - { assert snapshot(process.out.bam_sorted).match("homo_sapiens - paired_end - arriba - bam_sorted") }, - { assert snapshot(process.out.bam_transcript).match("homo_sapiens - paired_end - arriba - bam_transcript") }, - { assert snapshot(process.out.bam_unsorted).match("homo_sapiens - paired_end - arriba - bam_unsorted") }, - { assert snapshot(process.out.bedgraph).match("homo_sapiens - paired_end - arriba - bedgraph") }, - { assert snapshot(process.out.fastq).match("homo_sapiens - paired_end - arriba - fastq") }, - { assert snapshot(process.out.junction).match("homo_sapiens - paired_end - arriba - junction") }, - { assert snapshot(process.out.read_per_gene_tab).match("homo_sapiens - paired_end - arriba - read_per_gene_tab") }, - { assert snapshot(process.out.sam).match("homo_sapiens - paired_end - arriba - sam") }, - { assert snapshot(process.out.spl_junc_tab).match("homo_sapiens - paired_end - arriba - spl_junc_tab") }, - { assert snapshot(process.out.tab).match("homo_sapiens - paired_end - arriba - tab") }, - { assert snapshot(process.out.wig).match("homo_sapiens - paired_end - arriba - wig") }, - { assert snapshot(process.out.versions).match("homo_sapiens - paired_end - arriba - versions") } + { assert snapshot(process.out).match() } ) } } - test("homo_sapiens - paired_end - starfusion") { + test("homo_sapiens - paired_end - starfusion - stub") { + options "-stub" config "./nextflow.starfusion.config" + setup { + run("STAR_GENOMEGENERATE") { + script "../../../star/genomegenerate/main.nf" + process { + """ + input[0] = Channel.of([ + [ id:'test_fasta' ], + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) ] + ]) + input[1] = Channel.of([ + [ id:'test_gtf' ], + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true) ] + ]) + """ + } + } + } + when { process { """ @@ -191,29 +543,33 @@ nextflow_process { then { assertAll( { assert process.success }, - { assert snapshot(file(process.out.log_final[0][1]).name).match("homo_sapiens - paired_end - starfusion - log_final") }, - { assert snapshot(file(process.out.log_out[0][1]).name).match("homo_sapiens - paired_end - starfusion - log_out") }, - { assert snapshot(file(process.out.log_progress[0][1]).name).match("homo_sapiens - paired_end - starfusion - log_progress") }, - { assert snapshot(process.out.bam).match("homo_sapiens - paired_end - starfusion - bam") }, - { assert snapshot(process.out.bam_sorted).match("homo_sapiens - paired_end - starfusion - bam_sorted") }, - { assert snapshot(process.out.bam_transcript).match("homo_sapiens - paired_end - starfusion - bam_transcript") }, - { assert snapshot(process.out.bam_unsorted).match("homo_sapiens - paired_end - starfusion - bam_unsorted") }, - { assert snapshot(process.out.bedgraph).match("homo_sapiens - paired_end - starfusion - bedgraph") }, - { assert snapshot(process.out.fastq).match("homo_sapiens - paired_end - starfusion - fastq") }, - { assert snapshot(process.out.junction).match("homo_sapiens - paired_end - starfusion - junction") }, - { assert snapshot(process.out.read_per_gene_tab).match("homo_sapiens - paired_end - starfusion - read_per_gene_tab") }, - { assert snapshot(process.out.sam).match("homo_sapiens - paired_end - starfusion - sam") }, - { assert snapshot(process.out.spl_junc_tab).match("homo_sapiens - paired_end - starfusion - spl_junc_tab") }, - { assert snapshot(process.out.tab).match("homo_sapiens - paired_end - starfusion - tab") }, - { assert snapshot(process.out.wig).match("homo_sapiens - paired_end - starfusion - wig") }, - { assert snapshot(process.out.versions).match("homo_sapiens - paired_end - starfusion - versions") } + { assert snapshot(process.out).match() } ) } } - test("homo_sapiens - paired_end - multiple") { + test("homo_sapiens - paired_end - multiple - stub") { + options "-stub" config "./nextflow.config" + setup { + run("STAR_GENOMEGENERATE") { + script "../../../star/genomegenerate/main.nf" + process { + """ + input[0] = Channel.of([ + [ id:'test_fasta' ], + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) ] + ]) + input[1] = Channel.of([ + [ id:'test_gtf' ], + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true) ] + ]) + """ + } + } + } + when { process { """ @@ -241,22 +597,7 @@ nextflow_process { then { assertAll( { assert process.success }, - { assert snapshot(file(process.out.log_final[0][1]).name).match("homo_sapiens - paired_end - multiple - log_final") }, - { assert snapshot(file(process.out.log_out[0][1]).name).match("homo_sapiens - paired_end - multiple - log_out") }, - { assert snapshot(file(process.out.log_progress[0][1]).name).match("homo_sapiens - paired_end - multiple - log_progress") }, - { assert snapshot(process.out.bam).match("homo_sapiens - paired_end - multiple - bam") }, - { assert snapshot(process.out.bam_sorted).match("homo_sapiens - paired_end - multiple - bam_sorted") }, - { assert snapshot(process.out.bam_transcript).match("homo_sapiens - paired_end - multiple - bam_transcript") }, - { assert snapshot(process.out.bam_unsorted).match("homo_sapiens - paired_end - multiple - bam_unsorted") }, - { assert snapshot(process.out.bedgraph).match("homo_sapiens - paired_end - multiple - bedgraph") }, - { assert snapshot(process.out.fastq).match("homo_sapiens - paired_end - multiple - fastq") }, - { assert snapshot(process.out.junction).match("homo_sapiens - paired_end - multiple - junction") }, - { assert snapshot(process.out.read_per_gene_tab).match("homo_sapiens - paired_end - multiple - read_per_gene_tab") }, - { assert snapshot(process.out.sam).match("homo_sapiens - paired_end - multiple - sam") }, - { assert snapshot(process.out.spl_junc_tab).match("homo_sapiens - paired_end - multiple - spl_junc_tab") }, - { assert snapshot(process.out.tab).match("homo_sapiens - paired_end - multiple - tab") }, - { assert snapshot(process.out.wig).match("homo_sapiens - paired_end - multiple - wig") }, - { assert snapshot(process.out.versions).match("homo_sapiens - paired_end - multiple - versions") } + { assert snapshot(process.out).match() } ) } } diff --git a/modules/nf-core/star/align/tests/main.nf.test.snap b/modules/nf-core/star/align/tests/main.nf.test.snap index 08edb914b..c814eb56c 100644 --- a/modules/nf-core/star/align/tests/main.nf.test.snap +++ b/modules/nf-core/star/align/tests/main.nf.test.snap @@ -1,382 +1,1170 @@ { - "homo_sapiens - paired_end - multiple - bam_sorted": { + "homo_sapiens - single_end - stub": { "content": [ - [ - [ - { - "id": "test", - "single_end": false - }, - "test.Aligned.sortedByCoord.out.bam:md5,ab07c21d63ab0a6c07d171d213c81d5a" + { + "0": [ + [ + { + "id": "test", + "single_end": true + }, + "test.Log.final.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": true + }, + "test.Log.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "10": [ + [ + { + "id": "test", + "single_end": true + }, + "test.SJ.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "11": [ + [ + { + "id": "test", + "single_end": true + }, + "test.ReadsPerGene.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "12": [ + [ + { + "id": "test", + "single_end": true + }, + "test.Chimeric.out.junction:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "13": [ + [ + { + "id": "test", + "single_end": true + }, + "test.out.sam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "14": [ + [ + { + "id": "test", + "single_end": true + }, + "test.Signal.UniqueMultiple.str1.out.wig:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "15": [ + [ + { + "id": "test", + "single_end": true + }, + "test.Signal.UniqueMultiple.str1.out.bg:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + [ + { + "id": "test", + "single_end": true + }, + "test.Log.progress.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + "versions.yml:md5,2e6b6d8809f5a17f38f4d27c45dcb22f" + ], + "4": [ + [ + { + "id": "test", + "single_end": true + }, + [ + "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "testXd.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "5": [ + [ + { + "id": "test", + "single_end": true + }, + [ + "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "6": [ + [ + { + "id": "test", + "single_end": true + }, + "test.toTranscriptome.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "7": [ + [ + { + "id": "test", + "single_end": true + }, + "test.Aligned.unsort.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "8": [ + [ + { + "id": "test", + "single_end": true + }, + [ + "test.unmapped_1.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test.unmapped_2.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "9": [ + [ + { + "id": "test", + "single_end": true + }, + [ + "test.ReadsPerGene.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.SJ.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.tab:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "bam": [ + [ + { + "id": "test", + "single_end": true + }, + [ + "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "testXd.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "bam_sorted": [ + [ + { + "id": "test", + "single_end": true + }, + [ + "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "bam_transcript": [ + [ + { + "id": "test", + "single_end": true + }, + "test.toTranscriptome.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "bam_unsorted": [ + [ + { + "id": "test", + "single_end": true + }, + "test.Aligned.unsort.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "bedgraph": [ + [ + { + "id": "test", + "single_end": true + }, + "test.Signal.UniqueMultiple.str1.out.bg:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "fastq": [ + [ + { + "id": "test", + "single_end": true + }, + [ + "test.unmapped_1.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test.unmapped_2.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "junction": [ + [ + { + "id": "test", + "single_end": true + }, + "test.Chimeric.out.junction:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "log_final": [ + [ + { + "id": "test", + "single_end": true + }, + "test.Log.final.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "log_out": [ + [ + { + "id": "test", + "single_end": true + }, + "test.Log.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "log_progress": [ + [ + { + "id": "test", + "single_end": true + }, + "test.Log.progress.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "read_per_gene_tab": [ + [ + { + "id": "test", + "single_end": true + }, + "test.ReadsPerGene.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "sam": [ + [ + { + "id": "test", + "single_end": true + }, + "test.out.sam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "spl_junc_tab": [ + [ + { + "id": "test", + "single_end": true + }, + "test.SJ.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "tab": [ + [ + { + "id": "test", + "single_end": true + }, + [ + "test.ReadsPerGene.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.SJ.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.tab:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "versions": [ + "versions.yml:md5,2e6b6d8809f5a17f38f4d27c45dcb22f" + ], + "wig": [ + [ + { + "id": "test", + "single_end": true + }, + "test.Signal.UniqueMultiple.str1.out.wig:md5,d41d8cd98f00b204e9800998ecf8427e" + ] ] - ] + } ], - "timestamp": "2023-12-04T18:01:19.968225733" + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T15:16:04.712114" }, - "homo_sapiens - paired_end - multiple - wig": { + "homo_sapiens - paired_end - arriba - stub": { "content": [ - [ - - ] + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Log.final.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Log.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "10": [ + [ + { + "id": "test", + "single_end": false + }, + "test.SJ.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "11": [ + [ + { + "id": "test", + "single_end": false + }, + "test.ReadsPerGene.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "12": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Chimeric.out.junction:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "13": [ + [ + { + "id": "test", + "single_end": false + }, + "test.out.sam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "14": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Signal.UniqueMultiple.str1.out.wig:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "15": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Signal.UniqueMultiple.str1.out.bg:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Log.progress.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + "versions.yml:md5,2e6b6d8809f5a17f38f4d27c45dcb22f" + ], + "4": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "testXd.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "5": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "6": [ + [ + { + "id": "test", + "single_end": false + }, + "test.toTranscriptome.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "7": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Aligned.unsort.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "8": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.unmapped_1.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test.unmapped_2.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "9": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.ReadsPerGene.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.SJ.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.tab:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "bam": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "testXd.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "bam_sorted": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "bam_transcript": [ + [ + { + "id": "test", + "single_end": false + }, + "test.toTranscriptome.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "bam_unsorted": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Aligned.unsort.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "bedgraph": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Signal.UniqueMultiple.str1.out.bg:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "fastq": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.unmapped_1.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test.unmapped_2.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "junction": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Chimeric.out.junction:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "log_final": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Log.final.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "log_out": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Log.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "log_progress": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Log.progress.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "read_per_gene_tab": [ + [ + { + "id": "test", + "single_end": false + }, + "test.ReadsPerGene.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "sam": [ + [ + { + "id": "test", + "single_end": false + }, + "test.out.sam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "spl_junc_tab": [ + [ + { + "id": "test", + "single_end": false + }, + "test.SJ.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "tab": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.ReadsPerGene.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.SJ.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.tab:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "versions": [ + "versions.yml:md5,2e6b6d8809f5a17f38f4d27c45dcb22f" + ], + "wig": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Signal.UniqueMultiple.str1.out.wig:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + } ], - "timestamp": "2023-11-23T13:29:01.857804" + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T15:16:28.874293" }, - "homo_sapiens - paired_end - arriba - tab": { + "homo_sapiens - single_end": { "content": [ + "test.Log.final.out", + "test.Log.out", + "test.Log.progress.out", [ [ { "id": "test", - "single_end": false + "single_end": true }, - "test.SJ.out.tab:md5,5155c9fd1f787ad6d7d80987fb06219c" + "test.Aligned.sortedByCoord.out.bam:md5,c6cfaccaf91bc7fdabed3cfe236d4535" ] - ] - ], - "timestamp": "2023-12-04T17:56:12.347549723" - }, - "homo_sapiens - single_end - wig": { - "content": [ + ], [ - - ] - ], - "timestamp": "2023-11-23T13:22:55.24701" - }, - "homo_sapiens - paired_end - sam": { - "content": [ + [ + { + "id": "test", + "single_end": true + }, + "test.Aligned.sortedByCoord.out.bam:md5,c6cfaccaf91bc7fdabed3cfe236d4535" + ] + ], [ - ] - ], - "timestamp": "2023-11-23T13:23:33.383818" - }, - "homo_sapiens - paired_end - arriba - versions": { - "content": [ + ], [ - "versions.yml:md5,2e6b6d8809f5a17f38f4d27c45dcb22f" - ] - ], - "timestamp": "2023-12-04T17:56:12.431212643" - }, - "homo_sapiens - paired_end - multiple - bedgraph": { - "content": [ + + ], [ [ { "id": "test", - "single_end": false + "single_end": true }, [ - "test.Signal.Unique.str1.out.bg:md5,d7bf8b70b436ca048a62513e1d0ece3a", - "test.Signal.UniqueMultiple.str1.out.bg:md5,686d58493b9eb445b56ace4d67f76ef6" + "test.Signal.Unique.str1.out.bg:md5,c56fc1472776fb927eaf62d973da5f9a", + "test.Signal.UniqueMultiple.str1.out.bg:md5,e93373cf6f2a2a9506e2efdb260cdd4f" ] ] - ] - ], - "timestamp": "2023-12-04T18:01:20.07119229" - }, - "homo_sapiens - paired_end - read_per_gene_tab": { - "content": [ + ], [ - ] - ], - "timestamp": "2023-11-23T13:23:33.368841" - }, - "homo_sapiens - paired_end - arriba - bedgraph": { - "content": [ + ], [ - ] - ], - "timestamp": "2023-11-23T13:25:07.102537" - }, - "homo_sapiens - single_end - junction": { - "content": [ + ], [ - ] - ], - "timestamp": "2023-11-23T13:22:55.185369" - }, - "homo_sapiens - paired_end - arriba - spl_junc_tab": { - "content": [ + ], + [ + + ], [ [ { "id": "test", - "single_end": false + "single_end": true }, - "test.SJ.out.tab:md5,5155c9fd1f787ad6d7d80987fb06219c" + "test.SJ.out.tab:md5,75a516ab950fb958f40b29996474949c" ] - ] - ], - "timestamp": "2023-12-04T17:56:12.268388251" - }, - "homo_sapiens - single_end - sam": { - "content": [ + ], [ - - ] - ], - "timestamp": "2023-11-23T13:22:55.216183" - }, - "homo_sapiens - paired_end - fastq": { - "content": [ + [ + { + "id": "test", + "single_end": true + }, + "test.SJ.out.tab:md5,75a516ab950fb958f40b29996474949c" + ] + ], [ - ] - ], - "timestamp": "2023-11-23T13:23:33.327236" - }, - "homo_sapiens - single_end - versions": { - "content": [ + ], [ "versions.yml:md5,2e6b6d8809f5a17f38f4d27c45dcb22f" ] ], - "timestamp": "2023-12-04T17:53:26.664210196" - }, - "homo_sapiens - paired_end - multiple - log_out": { - "content": [ - "test.Log.out" - ], - "timestamp": "2023-11-23T13:29:01.022176" - }, - "homo_sapiens - paired_end - arriba - fastq": { - "content": [ - [ - - ] - ], - "timestamp": "2023-11-23T13:25:07.15277" - }, - "homo_sapiens - paired_end - multiple - junction": { - "content": [ - [ - - ] - ], - "timestamp": "2023-11-23T13:29:01.52923" + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T18:02:34.35338" }, - "homo_sapiens - paired_end - multiple - spl_junc_tab": { + "homo_sapiens - paired_end": { "content": [ + "test.Log.final.out", + "test.Log.out", + "test.Log.progress.out", [ [ { "id": "test", "single_end": false }, - "test.SJ.out.tab:md5,069877e053714e23010fe4e1c003b4a2" + "test.Aligned.sortedByCoord.out.bam:md5,b9ee1c607e07323bc1652ef3babb543f" ] - ] - ], - "timestamp": "2023-12-04T18:01:20.189486201" - }, - "homo_sapiens - paired_end - starfusion - log_final": { - "content": [ - "test.Log.final.out" - ], - "timestamp": "2023-11-23T13:27:55.905883" - }, - "homo_sapiens - paired_end - starfusion - fastq": { - "content": [ - [ - - ] - ], - "timestamp": "2023-11-23T13:27:56.192302" - }, - "homo_sapiens - paired_end - multiple - sam": { - "content": [ - [ - - ] - ], - "timestamp": "2023-11-23T13:29:01.661837" - }, - "homo_sapiens - paired_end - multiple - log_final": { - "content": [ - "test.Log.final.out" - ], - "timestamp": "2023-11-23T13:29:00.966417" - }, - "homo_sapiens - paired_end - starfusion - bam": { - "content": [ + ], [ [ { "id": "test", "single_end": false }, - "test.Aligned.out.bam:md5,bcad07b838f6762fc01eea52b5cd3f84" + "test.Aligned.sortedByCoord.out.bam:md5,b9ee1c607e07323bc1652ef3babb543f" ] - ] - ], - "timestamp": "2023-12-04T17:59:58.53235164" - }, - "homo_sapiens - paired_end - arriba - junction": { - "content": [ + ], [ - ] - ], - "timestamp": "2023-11-23T13:25:07.202776" - }, - "homo_sapiens - single_end - bedgraph": { - "content": [ + ], + [ + + ], [ [ { "id": "test", - "single_end": true + "single_end": false }, [ - "test.Signal.Unique.str1.out.bg:md5,c56fc1472776fb927eaf62d973da5f9a", - "test.Signal.UniqueMultiple.str1.out.bg:md5,e93373cf6f2a2a9506e2efdb260cdd4f" + "test.Signal.Unique.str1.out.bg:md5,d7bf8b70b436ca048a62513e1d0ece3a", + "test.Signal.UniqueMultiple.str1.out.bg:md5,686d58493b9eb445b56ace4d67f76ef6" ] ] - ] - ], - "timestamp": "2023-12-04T17:53:26.394863748" - }, - "homo_sapiens - paired_end - arriba - read_per_gene_tab": { - "content": [ + ], [ - ] - ], - "timestamp": "2023-11-23T13:25:07.251962" - }, - "homo_sapiens - paired_end - starfusion - bam_sorted": { - "content": [ + ], [ - ] - ], - "timestamp": "2023-11-23T13:27:56.040843" - }, - "homo_sapiens - single_end - bam_unsorted": { - "content": [ + ], [ - ] - ], - "timestamp": "2023-11-23T13:22:55.154172" - }, - "homo_sapiens - paired_end - bam": { - "content": [ + ], + [ + + ], [ [ { "id": "test", "single_end": false }, - "test.Aligned.sortedByCoord.out.bam:md5,b9ee1c607e07323bc1652ef3babb543f" + "test.SJ.out.tab:md5,844af19ab0fc8cd9a3f75228445aca0d" ] - ] - ], - "timestamp": "2023-12-04T17:54:11.934832258" - }, - "homo_sapiens - paired_end - arriba - bam_transcript": { - "content": [ + ], + [ + [ + { + "id": "test", + "single_end": false + }, + "test.SJ.out.tab:md5,844af19ab0fc8cd9a3f75228445aca0d" + ] + ], [ - ] - ], - "timestamp": "2023-11-23T13:25:06.998817" - }, - "homo_sapiens - paired_end - log_out": { - "content": [ - "test.Log.out" - ], - "timestamp": "2023-11-23T13:23:33.259699" - }, - "homo_sapiens - paired_end - arriba - log_out": { - "content": [ - "test.Log.out" - ], - "timestamp": "2023-11-23T13:25:06.849451" - }, - "homo_sapiens - paired_end - multiple - versions": { - "content": [ + ], [ "versions.yml:md5,2e6b6d8809f5a17f38f4d27c45dcb22f" ] ], - "timestamp": "2023-12-04T18:01:20.393705142" + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T18:03:16.701923" }, - "homo_sapiens - paired_end - starfusion - bam_transcript": { + "homo_sapiens - paired_end - multiple - stub": { "content": [ - [ - - ] + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Log.final.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Log.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "10": [ + [ + { + "id": "test", + "single_end": false + }, + "test.SJ.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "11": [ + [ + { + "id": "test", + "single_end": false + }, + "test.ReadsPerGene.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "12": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Chimeric.out.junction:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "13": [ + [ + { + "id": "test", + "single_end": false + }, + "test.out.sam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "14": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Signal.UniqueMultiple.str1.out.wig:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "15": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Signal.UniqueMultiple.str1.out.bg:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Log.progress.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + "versions.yml:md5,2e6b6d8809f5a17f38f4d27c45dcb22f" + ], + "4": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "testXd.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "5": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "6": [ + [ + { + "id": "test", + "single_end": false + }, + "test.toTranscriptome.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "7": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Aligned.unsort.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "8": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.unmapped_1.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test.unmapped_2.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "9": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.ReadsPerGene.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.SJ.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.tab:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "bam": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "testXd.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "bam_sorted": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "bam_transcript": [ + [ + { + "id": "test", + "single_end": false + }, + "test.toTranscriptome.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "bam_unsorted": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Aligned.unsort.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "bedgraph": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Signal.UniqueMultiple.str1.out.bg:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "fastq": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.unmapped_1.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test.unmapped_2.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "junction": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Chimeric.out.junction:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "log_final": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Log.final.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "log_out": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Log.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "log_progress": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Log.progress.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "read_per_gene_tab": [ + [ + { + "id": "test", + "single_end": false + }, + "test.ReadsPerGene.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "sam": [ + [ + { + "id": "test", + "single_end": false + }, + "test.out.sam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "spl_junc_tab": [ + [ + { + "id": "test", + "single_end": false + }, + "test.SJ.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "tab": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.ReadsPerGene.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.SJ.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.tab:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "versions": [ + "versions.yml:md5,2e6b6d8809f5a17f38f4d27c45dcb22f" + ], + "wig": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Signal.UniqueMultiple.str1.out.wig:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + } ], - "timestamp": "2023-11-23T13:27:56.082408" + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T15:16:51.360287" }, - "homo_sapiens - paired_end - starfusion - tab": { + "homo_sapiens - paired_end - multiple": { "content": [ + "test.Log.final.out", + "test.Log.out", + "test.Log.progress.out", [ [ { "id": "test", "single_end": false }, - "test.SJ.out.tab:md5,19c3faa1bfa9a0cc5e4c45f17065b53a" + "test.Aligned.sortedByCoord.out.bam:md5,ab07c21d63ab0a6c07d171d213c81d5a" ] - ] - ], - "timestamp": "2023-12-04T17:59:58.818041322" - }, - "homo_sapiens - single_end - fastq": { - "content": [ + ], + [ + [ + { + "id": "test", + "single_end": false + }, + "test.Aligned.sortedByCoord.out.bam:md5,ab07c21d63ab0a6c07d171d213c81d5a" + ] + ], [ - ] - ], - "timestamp": "2023-11-23T13:22:55.175307" - }, - "homo_sapiens - paired_end - tab": { - "content": [ + ], + [ + + ], [ [ { "id": "test", "single_end": false }, - "test.SJ.out.tab:md5,844af19ab0fc8cd9a3f75228445aca0d" + [ + "test.Signal.Unique.str1.out.bg:md5,d7bf8b70b436ca048a62513e1d0ece3a", + "test.Signal.UniqueMultiple.str1.out.bg:md5,686d58493b9eb445b56ace4d67f76ef6" + ] ] - ] - ], - "timestamp": "2023-12-04T17:54:12.255481058" - }, - "homo_sapiens - paired_end - starfusion - bedgraph": { - "content": [ + ], [ - ] - ], - "timestamp": "2023-11-23T13:27:56.155413" - }, - "homo_sapiens - single_end - bam_transcript": { - "content": [ + ], [ - ] - ], - "timestamp": "2023-11-23T13:22:55.144852" - }, - "homo_sapiens - paired_end - versions": { - "content": [ + ], [ - "versions.yml:md5,2e6b6d8809f5a17f38f4d27c45dcb22f" - ] - ], - "timestamp": "2023-12-04T17:54:12.343840482" - }, - "homo_sapiens - paired_end - multiple - tab": { - "content": [ + + ], + [ + + ], [ [ { @@ -385,385 +1173,801 @@ }, "test.SJ.out.tab:md5,069877e053714e23010fe4e1c003b4a2" ] - ] - ], - "timestamp": "2023-12-04T18:01:20.291692062" - }, - "homo_sapiens - single_end - bam": { - "content": [ + ], [ [ { "id": "test", - "single_end": true + "single_end": false }, - "test.Aligned.sortedByCoord.out.bam:md5,c6cfaccaf91bc7fdabed3cfe236d4535" + "test.SJ.out.tab:md5,069877e053714e23010fe4e1c003b4a2" ] - ] - ], - "timestamp": "2023-12-04T17:53:26.265642675" - }, - "homo_sapiens - paired_end - arriba - wig": { - "content": [ + ], [ + ], + [ + "versions.yml:md5,2e6b6d8809f5a17f38f4d27c45dcb22f" ] ], - "timestamp": "2023-11-23T13:25:07.444214" + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T13:13:28.987438" }, - "homo_sapiens - paired_end - log_progress": { + "homo_sapiens - paired_end - stub": { "content": [ - [ - [ - { - "id": "test", - "single_end": false - }, - "test.Log.progress.out:md5,b2bd061d6cbaaf3d6d3b1fed547f69b8" + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Log.final.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Log.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "10": [ + [ + { + "id": "test", + "single_end": false + }, + "test.SJ.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "11": [ + [ + { + "id": "test", + "single_end": false + }, + "test.ReadsPerGene.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "12": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Chimeric.out.junction:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "13": [ + [ + { + "id": "test", + "single_end": false + }, + "test.out.sam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "14": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Signal.UniqueMultiple.str1.out.wig:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "15": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Signal.UniqueMultiple.str1.out.bg:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Log.progress.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + "versions.yml:md5,2e6b6d8809f5a17f38f4d27c45dcb22f" + ], + "4": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "testXd.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "5": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "6": [ + [ + { + "id": "test", + "single_end": false + }, + "test.toTranscriptome.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "7": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Aligned.unsort.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "8": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.unmapped_1.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test.unmapped_2.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "9": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.ReadsPerGene.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.SJ.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.tab:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "bam": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "testXd.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "bam_sorted": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "bam_transcript": [ + [ + { + "id": "test", + "single_end": false + }, + "test.toTranscriptome.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "bam_unsorted": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Aligned.unsort.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "bedgraph": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Signal.UniqueMultiple.str1.out.bg:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "fastq": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.unmapped_1.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test.unmapped_2.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "junction": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Chimeric.out.junction:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "log_final": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Log.final.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "log_out": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Log.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "log_progress": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Log.progress.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "read_per_gene_tab": [ + [ + { + "id": "test", + "single_end": false + }, + "test.ReadsPerGene.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "sam": [ + [ + { + "id": "test", + "single_end": false + }, + "test.out.sam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "spl_junc_tab": [ + [ + { + "id": "test", + "single_end": false + }, + "test.SJ.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "tab": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.ReadsPerGene.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.SJ.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.tab:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "versions": [ + "versions.yml:md5,2e6b6d8809f5a17f38f4d27c45dcb22f" + ], + "wig": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Signal.UniqueMultiple.str1.out.wig:md5,d41d8cd98f00b204e9800998ecf8427e" + ] ] - ] - ], - "timestamp": "2023-12-04T17:54:12.126063825" - }, - "homo_sapiens - paired_end - arriba - log_final": { - "content": [ - "test.Log.final.out" - ], - "timestamp": "2023-11-23T13:25:06.829799" - }, - "homo_sapiens - paired_end - bam_unsorted": { - "content": [ - [ - - ] - ], - "timestamp": "2023-11-23T13:23:33.300509" - }, - "homo_sapiens - paired_end - arriba - sam": { - "content": [ - [ - - ] + } ], - "timestamp": "2023-11-23T13:25:07.300383" + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T15:16:16.798018" }, - "homo_sapiens - paired_end - multiple - bam": { + "homo_sapiens - paired_end - starfusion": { "content": [ + "test.Log.final.out", + "test.Log.out", + "test.Log.progress.out", [ [ { "id": "test", "single_end": false }, - "test.Aligned.sortedByCoord.out.bam:md5,ab07c21d63ab0a6c07d171d213c81d5a" + "test.Aligned.out.bam:md5,bcad07b838f6762fc01eea52b5cd3f84" ] - ] - ], - "timestamp": "2023-12-04T18:01:19.851247126" - }, - "homo_sapiens - paired_end - multiple - fastq": { - "content": [ + ], [ - ] - ], - "timestamp": "2023-11-23T13:29:01.462257" - }, - "homo_sapiens - single_end - bam_sorted": { - "content": [ - [ - [ - { - "id": "test", - "single_end": true - }, - "test.Aligned.sortedByCoord.out.bam:md5,c6cfaccaf91bc7fdabed3cfe236d4535" - ] - ] - ], - "timestamp": "2023-12-04T17:53:26.335457371" - }, - "homo_sapiens - paired_end - arriba - bam_sorted": { - "content": [ + ], [ - ] - ], - "timestamp": "2023-11-23T13:25:06.94699" - }, - "homo_sapiens - paired_end - starfusion - junction": { - "content": [ - [ - [ - { - "id": "test", - "single_end": false - }, - "test.Chimeric.out.junction:md5,c10ef219f4a30e83711b995bc5e40dba" - ] - ] - ], - "timestamp": "2023-12-04T17:59:58.641115828" - }, - "homo_sapiens - single_end - tab": { - "content": [ + ], [ - [ - { - "id": "test", - "single_end": true - }, - "test.SJ.out.tab:md5,75a516ab950fb958f40b29996474949c" - ] - ] - ], - "timestamp": "2023-12-04T17:53:26.580593434" - }, - "homo_sapiens - paired_end - starfusion - versions": { - "content": [ + + ], [ - "versions.yml:md5,2e6b6d8809f5a17f38f4d27c45dcb22f" - ] - ], - "timestamp": "2023-12-04T17:59:58.907317103" - }, - "homo_sapiens - paired_end - multiple - bam_unsorted": { - "content": [ + + ], [ - ] - ], - "timestamp": "2023-11-23T13:29:01.330463" - }, - "homo_sapiens - paired_end - arriba - log_progress": { - "content": [ - "test.Log.progress.out" - ], - "timestamp": "2023-11-23T13:25:06.86866" - }, - "homo_sapiens - paired_end - bedgraph": { - "content": [ + ], [ [ { "id": "test", "single_end": false }, - [ - "test.Signal.Unique.str1.out.bg:md5,d7bf8b70b436ca048a62513e1d0ece3a", - "test.Signal.UniqueMultiple.str1.out.bg:md5,686d58493b9eb445b56ace4d67f76ef6" - ] + "test.Chimeric.out.junction:md5,c10ef219f4a30e83711b995bc5e40dba" ] - ] - ], - "timestamp": "2023-12-04T17:54:12.064121304" - }, - "homo_sapiens - paired_end - starfusion - bam_unsorted": { - "content": [ - [ - - ] - ], - "timestamp": "2023-11-23T13:27:56.118974" - }, - "homo_sapiens - paired_end - starfusion - read_per_gene_tab": { - "content": [ + ], [ - ] - ], - "timestamp": "2023-11-23T13:27:56.264699" - }, - "homo_sapiens - paired_end - multiple - log_progress": { - "content": [ - "test.Log.progress.out" - ], - "timestamp": "2023-11-23T13:29:01.076947" - }, - "homo_sapiens - paired_end - arriba - bam_unsorted": { - "content": [ + ], [ - ] - ], - "timestamp": "2023-11-23T13:25:07.050409" - }, - "homo_sapiens - paired_end - bam_sorted": { - "content": [ + ], [ [ { "id": "test", "single_end": false }, - "test.Aligned.sortedByCoord.out.bam:md5,b9ee1c607e07323bc1652ef3babb543f" + "test.SJ.out.tab:md5,19c3faa1bfa9a0cc5e4c45f17065b53a" ] - ] - ], - "timestamp": "2023-12-04T17:54:12.002180537" - }, - "homo_sapiens - single_end - spl_junc_tab": { - "content": [ + ], [ [ { "id": "test", - "single_end": true + "single_end": false }, - "test.SJ.out.tab:md5,75a516ab950fb958f40b29996474949c" + "test.SJ.out.tab:md5,19c3faa1bfa9a0cc5e4c45f17065b53a" ] + ], + [ + + ], + [ + "versions.yml:md5,2e6b6d8809f5a17f38f4d27c45dcb22f" ] ], - "timestamp": "2023-12-04T17:53:26.50932751" + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T13:10:55.371956" }, - "homo_sapiens - paired_end - starfusion - spl_junc_tab": { + "homo_sapiens - paired_end - arriba": { "content": [ + "test.Log.final.out", + "test.Log.out", + "test.Log.progress.out", [ [ { "id": "test", "single_end": false }, - "test.SJ.out.tab:md5,19c3faa1bfa9a0cc5e4c45f17065b53a" + "test.Aligned.out.bam:md5,c1b1747f5873f2d17762725636e891d5" ] - ] - ], - "timestamp": "2023-12-04T17:59:58.731699486" - }, - "homo_sapiens - single_end - log_out": { - "content": [ - "test.Log.out" - ], - "timestamp": "2023-11-23T13:22:55.126286" - }, - "homo_sapiens - paired_end - log_final": { - "content": [ - "test.Log.final.out" - ], - "timestamp": "2023-11-23T13:23:33.253884" - }, - "homo_sapiens - single_end - log_final": { - "content": [ - "test.Log.final.out" - ], - "timestamp": "2023-11-23T13:22:55.11799" - }, - "homo_sapiens - paired_end - bam_transcript": { - "content": [ + ], [ - ] - ], - "timestamp": "2023-11-23T13:23:33.287684" - }, - "homo_sapiens - paired_end - starfusion - log_progress": { - "content": [ - "test.Log.progress.out" - ], - "timestamp": "2023-11-23T13:27:55.971484" - }, - "homo_sapiens - paired_end - multiple - bam_transcript": { - "content": [ + ], [ - ] - ], - "timestamp": "2023-11-23T13:29:01.264176" - }, - "homo_sapiens - paired_end - multiple - read_per_gene_tab": { - "content": [ + ], [ - ] - ], - "timestamp": "2023-11-23T13:29:01.596406" - }, - "homo_sapiens - single_end - read_per_gene_tab": { - "content": [ + ], [ - ] - ], - "timestamp": "2023-11-23T13:22:55.205936" - }, - "homo_sapiens - paired_end - junction": { - "content": [ + ], [ - ] - ], - "timestamp": "2023-11-23T13:23:33.340653" - }, - "homo_sapiens - paired_end - spl_junc_tab": { - "content": [ + ], [ - [ - { - "id": "test", - "single_end": false - }, - "test.SJ.out.tab:md5,844af19ab0fc8cd9a3f75228445aca0d" - ] - ] - ], - "timestamp": "2023-12-04T17:54:12.185730856" - }, - "homo_sapiens - paired_end - starfusion - sam": { - "content": [ + + ], [ - ] - ], - "timestamp": "2023-11-23T13:27:56.300637" - }, - "homo_sapiens - paired_end - arriba - bam": { - "content": [ + ], + [ + + ], [ [ { "id": "test", "single_end": false }, - "test.Aligned.out.bam:md5,c1b1747f5873f2d17762725636e891d5" + "test.SJ.out.tab:md5,5155c9fd1f787ad6d7d80987fb06219c" ] - ] - ], - "timestamp": "2023-12-04T17:56:12.190560178" - }, - "homo_sapiens - single_end - log_progress": { - "content": [ + ], [ [ { "id": "test", - "single_end": true + "single_end": false }, - "test.Log.progress.out:md5,b2bd061d6cbaaf3d6d3b1fed547f69b8" + "test.SJ.out.tab:md5,5155c9fd1f787ad6d7d80987fb06219c" ] - ] - ], - "timestamp": "2023-12-04T17:53:26.450352138" - }, - "homo_sapiens - paired_end - starfusion - wig": { - "content": [ + ], [ - ] - ], - "timestamp": "2023-11-23T13:27:56.422018" - }, - "homo_sapiens - paired_end - wig": { - "content": [ + ], [ - + "versions.yml:md5,2e6b6d8809f5a17f38f4d27c45dcb22f" ] ], - "timestamp": "2023-11-23T13:23:33.429457" + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T13:05:10.7534" }, - "homo_sapiens - paired_end - starfusion - log_out": { + "homo_sapiens - paired_end - starfusion - stub": { "content": [ - "test.Log.out" + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Log.final.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Log.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "10": [ + [ + { + "id": "test", + "single_end": false + }, + "test.SJ.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "11": [ + [ + { + "id": "test", + "single_end": false + }, + "test.ReadsPerGene.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "12": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Chimeric.out.junction:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "13": [ + [ + { + "id": "test", + "single_end": false + }, + "test.out.sam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "14": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Signal.UniqueMultiple.str1.out.wig:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "15": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Signal.UniqueMultiple.str1.out.bg:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Log.progress.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + "versions.yml:md5,2e6b6d8809f5a17f38f4d27c45dcb22f" + ], + "4": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "testXd.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "5": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "6": [ + [ + { + "id": "test", + "single_end": false + }, + "test.toTranscriptome.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "7": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Aligned.unsort.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "8": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.unmapped_1.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test.unmapped_2.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "9": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.ReadsPerGene.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.SJ.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.tab:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "bam": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "testXd.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "bam_sorted": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "bam_transcript": [ + [ + { + "id": "test", + "single_end": false + }, + "test.toTranscriptome.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "bam_unsorted": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Aligned.unsort.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "bedgraph": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Signal.UniqueMultiple.str1.out.bg:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "fastq": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.unmapped_1.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test.unmapped_2.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "junction": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Chimeric.out.junction:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "log_final": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Log.final.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "log_out": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Log.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "log_progress": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Log.progress.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "read_per_gene_tab": [ + [ + { + "id": "test", + "single_end": false + }, + "test.ReadsPerGene.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "sam": [ + [ + { + "id": "test", + "single_end": false + }, + "test.out.sam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "spl_junc_tab": [ + [ + { + "id": "test", + "single_end": false + }, + "test.SJ.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "tab": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.ReadsPerGene.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.SJ.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.tab:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "versions": [ + "versions.yml:md5,2e6b6d8809f5a17f38f4d27c45dcb22f" + ], + "wig": [ + [ + { + "id": "test", + "single_end": false + }, + "test.Signal.UniqueMultiple.str1.out.wig:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + } ], - "timestamp": "2023-11-23T13:27:55.93945" + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T15:16:40.64399" } } \ No newline at end of file diff --git a/modules/nf-core/star/genomegenerate/tests/main.nf.test b/modules/nf-core/star/genomegenerate/tests/main.nf.test index 3467a3567..fed98212d 100644 --- a/modules/nf-core/star/genomegenerate/tests/main.nf.test +++ b/modules/nf-core/star/genomegenerate/tests/main.nf.test @@ -24,15 +24,15 @@ nextflow_process { then { assertAll( { assert process.success }, - { assert snapshot(file(process.out.index[0][1]).listFiles().collect { it.getName() }.sort().toString()).match("fasta_gtf_index") }, - { assert snapshot(process.out.versions).match("fasta_gtf_versions") } + { assert snapshot( + file(process.out.index[0][1]).listFiles().collect { it.getName() }.sort().toString(), + process.out.versions) + .match() } ) } } - test("fasta_gtf_stub") { - - options '-stub' + test("fasta") { when { process { @@ -41,10 +41,7 @@ nextflow_process { [ id:'test_fasta' ], [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) ] ]) - input[1] = Channel.of([ - [ id:'test_gtf' ], - [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true) ] - ]) + input[1] = Channel.of([ [], [] ]) """ } } @@ -52,13 +49,17 @@ nextflow_process { then { assertAll( { assert process.success }, - { assert snapshot(file(process.out.index[0][1]).listFiles().collect { it.getName() }.sort().toString()).match("fasta_gtf_stub_index") }, - { assert snapshot(process.out.versions).match("fasta_gtf_stub_versions") } + { assert snapshot( + file(process.out.index[0][1]).listFiles().collect { it.getName() }.sort().toString(), + process.out.versions + ).match() } ) } } - test("fasta") { + test("fasta_gtf_stub") { + + options '-stub' when { process { @@ -67,7 +68,10 @@ nextflow_process { [ id:'test_fasta' ], [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) ] ]) - input[1] = Channel.of([ [], [] ]) + input[1] = Channel.of([ + [ id:'test_gtf' ], + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true) ] + ]) """ } } @@ -75,11 +79,9 @@ nextflow_process { then { assertAll( { assert process.success }, - { assert snapshot(file(process.out.index[0][1]).listFiles().collect { it.getName() }.sort().toString()).match("fasta_index") }, - { assert snapshot(process.out.versions).match("fasta_versions") } + { assert snapshot(process.out).match() } ) } - } test("fasta_stub") { @@ -101,11 +103,8 @@ nextflow_process { then { assertAll( { assert process.success }, - { assert snapshot(file(process.out.index[0][1]).listFiles().collect { it.getName() }.sort().toString()).match("fasta_stub_index") }, - { assert snapshot(process.out.versions).match("fasta_stub_versions") } + { assert snapshot(process.out).match() } ) } - } - } diff --git a/modules/nf-core/star/genomegenerate/tests/main.nf.test.snap b/modules/nf-core/star/genomegenerate/tests/main.nf.test.snap index 5653d6e6c..207f4b4f5 100644 --- a/modules/nf-core/star/genomegenerate/tests/main.nf.test.snap +++ b/modules/nf-core/star/genomegenerate/tests/main.nf.test.snap @@ -1,90 +1,148 @@ { - "fasta_gtf_versions": { + "fasta_gtf": { "content": [ + "[Genome, Log.out, SA, SAindex, chrLength.txt, chrName.txt, chrNameLength.txt, chrStart.txt, exonGeTrInfo.tab, exonInfo.tab, geneInfo.tab, genomeParameters.txt, sjdbInfo.txt, sjdbList.fromGTF.out.tab, sjdbList.out.tab, transcriptInfo.tab]", [ "versions.yml:md5,46b8f1f34bb7f23892cd1eb249ed4d7f" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.04.3" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-02-01T15:54:31.798555" + "timestamp": "2024-07-22T14:55:35.478401" }, - "fasta_stub_versions": { + "fasta_gtf_stub": { "content": [ - [ - "versions.yml:md5,46b8f1f34bb7f23892cd1eb249ed4d7f" - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.04.3" - }, - "timestamp": "2024-02-01T15:55:07.521209" - }, - "fasta_gtf_stub_index": { - "content": [ - "[Genome, Log.out, SA, SAindex, chrLength.txt, chrName.txt, chrNameLength.txt, chrStart.txt, exonGeTrInfo.tab, exonInfo.tab, geneInfo.tab, genomeParameters.txt, sjdbInfo.txt, sjdbList.fromGTF.out.tab, sjdbList.out.tab, transcriptInfo.tab]" - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.04.3" - }, - "timestamp": "2024-02-01T15:54:46.478098" - }, - "fasta_gtf_stub_versions": { - "content": [ - [ - "versions.yml:md5,46b8f1f34bb7f23892cd1eb249ed4d7f" - ] + { + "0": [ + [ + { + "id": "test_fasta" + }, + [ + "Genome:md5,d41d8cd98f00b204e9800998ecf8427e", + "Log.out:md5,d41d8cd98f00b204e9800998ecf8427e", + "SA:md5,d41d8cd98f00b204e9800998ecf8427e", + "SAindex:md5,d41d8cd98f00b204e9800998ecf8427e", + "chrLength.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "chrName.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "chrNameLength.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "chrStart.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "exonGeTrInfo.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "exonInfo.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "geneInfo.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "genomeParameters.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "sjdbInfo.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "sjdbList.fromGTF.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "sjdbList.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "transcriptInfo.tab:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "1": [ + "versions.yml:md5,46b8f1f34bb7f23892cd1eb249ed4d7f" + ], + "index": [ + [ + { + "id": "test_fasta" + }, + [ + "Genome:md5,d41d8cd98f00b204e9800998ecf8427e", + "Log.out:md5,d41d8cd98f00b204e9800998ecf8427e", + "SA:md5,d41d8cd98f00b204e9800998ecf8427e", + "SAindex:md5,d41d8cd98f00b204e9800998ecf8427e", + "chrLength.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "chrName.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "chrNameLength.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "chrStart.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "exonGeTrInfo.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "exonInfo.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "geneInfo.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "genomeParameters.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "sjdbInfo.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "sjdbList.fromGTF.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "sjdbList.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "transcriptInfo.tab:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "versions": [ + "versions.yml:md5,46b8f1f34bb7f23892cd1eb249ed4d7f" + ] + } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.04.3" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-02-01T15:54:46.491657" + "timestamp": "2024-07-22T14:55:57.247585" }, - "fasta_index": { + "fasta_stub": { "content": [ - "[Genome, Log.out, SA, SAindex, chrLength.txt, chrName.txt, chrNameLength.txt, chrStart.txt, genomeParameters.txt]" + { + "0": [ + [ + { + "id": "test_fasta" + }, + [ + "Genome:md5,d41d8cd98f00b204e9800998ecf8427e", + "Log.out:md5,d41d8cd98f00b204e9800998ecf8427e", + "SA:md5,d41d8cd98f00b204e9800998ecf8427e", + "SAindex:md5,d41d8cd98f00b204e9800998ecf8427e", + "chrLength.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "chrName.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "chrNameLength.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "chrStart.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "genomeParameters.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "1": [ + "versions.yml:md5,46b8f1f34bb7f23892cd1eb249ed4d7f" + ], + "index": [ + [ + { + "id": "test_fasta" + }, + [ + "Genome:md5,d41d8cd98f00b204e9800998ecf8427e", + "Log.out:md5,d41d8cd98f00b204e9800998ecf8427e", + "SA:md5,d41d8cd98f00b204e9800998ecf8427e", + "SAindex:md5,d41d8cd98f00b204e9800998ecf8427e", + "chrLength.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "chrName.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "chrNameLength.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "chrStart.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "genomeParameters.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "versions": [ + "versions.yml:md5,46b8f1f34bb7f23892cd1eb249ed4d7f" + ] + } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.04.3" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-02-01T15:54:57.552329" + "timestamp": "2024-07-22T14:56:07.01742" }, - "fasta_versions": { + "fasta": { "content": [ + "[Genome, Log.out, SA, SAindex, chrLength.txt, chrName.txt, chrNameLength.txt, chrStart.txt, genomeParameters.txt]", [ "versions.yml:md5,46b8f1f34bb7f23892cd1eb249ed4d7f" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.04.3" - }, - "timestamp": "2024-02-01T15:54:57.560541" - }, - "fasta_gtf_index": { - "content": [ - "[Genome, Log.out, SA, SAindex, chrLength.txt, chrName.txt, chrNameLength.txt, chrStart.txt, exonGeTrInfo.tab, exonInfo.tab, geneInfo.tab, genomeParameters.txt, sjdbInfo.txt, sjdbList.fromGTF.out.tab, sjdbList.out.tab, transcriptInfo.tab]" - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.04.3" - }, - "timestamp": "2024-02-01T15:54:31.786814" - }, - "fasta_stub_index": { - "content": [ - "[Genome, Log.out, SA, SAindex, chrLength.txt, chrName.txt, chrNameLength.txt, chrStart.txt, genomeParameters.txt]" - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.04.3" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-02-01T15:55:07.517472" + "timestamp": "2024-07-22T14:55:45.48784" } } \ No newline at end of file diff --git a/modules/nf-core/stringtie/stringtie/tests/main.nf.test b/modules/nf-core/stringtie/stringtie/tests/main.nf.test index 68baaf289..dc315a314 100644 --- a/modules/nf-core/stringtie/stringtie/tests/main.nf.test +++ b/modules/nf-core/stringtie/stringtie/tests/main.nf.test @@ -3,11 +3,10 @@ nextflow_process { name "Test Process STRINGTIE_STRINGTIE" script "../main.nf" process "STRINGTIE_STRINGTIE" + config "./nextflow.config" test("sarscov2 [bam] - forward strandedness") { - config "./nextflow.config" - when { process { """ @@ -23,17 +22,17 @@ nextflow_process { then { assertAll( { assert process.success }, - { assert snapshot(process.out.transcript_gtf).match("fs_transcript_gtf") }, - { assert snapshot(process.out.abundance).match("fs_abundance") }, - { assert snapshot(process.out.versions).match("fs_versions") } + { assert snapshot( + process.out.abundance, + process.out.transcript_gtf, + process.out.versions + ).match() } ) } } test("sarscov2 [bam] - forward strandedness + reference annotation") { - config "./nextflow.config" - when { process { """ @@ -49,18 +48,18 @@ nextflow_process { then { assertAll( { assert process.success }, - { assert snapshot(process.out.transcript_gtf).match("fs_gtf_transcript_gtf") }, - { assert snapshot(process.out.abundance).match("fs_gtf_abundance") }, - { assert snapshot(process.out.ballgown).match("fs_gtf_ballgown") }, - { assert snapshot(process.out.versions).match("fs_gtf_versions") } + { assert snapshot( + process.out.abundance, + process.out.ballgown, + process.out.transcript_gtf, + process.out.versions + ).match() } ) } } test("sarscov2 [bam] - reverse strandedness") { - config "./nextflow.config" - when { process { """ @@ -76,16 +75,117 @@ nextflow_process { then { assertAll( { assert process.success }, - { assert snapshot(process.out.transcript_gtf).match("rs_transcript_gtf") }, - { assert snapshot(process.out.abundance).match("rs_abundance") }, - { assert snapshot(process.out.versions).match("rs_versions") } + { assert snapshot( + process.out.abundance, + process.out.transcript_gtf, + process.out.versions + ).match() } ) } } test("sarscov2 [bam] - reverse strandedness + reference annotation") { - config "./nextflow.config" + when { + process { + """ + input[0] = [ + [ id:'test', strandedness:'reverse' ], // meta map + [ file(params.modules_testdata_base_path + "genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam", checkIfExists: true) ] + ] + input[1] = file(params.modules_testdata_base_path + "genomics/sarscov2/genome/genome.gtf", checkIfExists: true) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + process.out.abundance, + process.out.ballgown, + process.out.transcript_gtf, + process.out.versions + ).match() } + ) + } + } + + test("sarscov2 [bam] - forward strandedness - stub") { + + options "-stub" + + when { + process { + """ + input[0] = [ + [ id:'test', strandedness:'forward' ], // meta map + [ file(params.modules_testdata_base_path + "genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam", checkIfExists: true) ] + ] + input[1] = [] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("sarscov2 [bam] - forward strandedness + reference annotation - stub") { + + options "-stub" + + when { + process { + """ + input[0] = [ + [ id:'test', strandedness:'forward' ], // meta map + [ file(params.modules_testdata_base_path + "genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam", checkIfExists: true) ] + ] + input[1] = file(params.modules_testdata_base_path + "genomics/sarscov2/genome/genome.gtf", checkIfExists: true) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("sarscov2 [bam] - reverse strandedness - stub") { + + options "-stub" + + when { + process { + """ + input[0] = [ + [ id:'test', strandedness:'reverse' ], // meta map + [ file(params.modules_testdata_base_path + "genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam", checkIfExists: true) ] + ] + input[1] = [] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("sarscov2 [bam] - reverse strandedness + reference annotation - stub") { + + options "-stub" when { process { @@ -102,10 +202,7 @@ nextflow_process { then { assertAll( { assert process.success }, - { assert snapshot(process.out.transcript_gtf).match("rs_gtf_transcript_gtf") }, - { assert snapshot(process.out.abundance).match("rs_gtf_abundance") }, - { assert snapshot(process.out.ballgown).match("rs_gtf_ballgown") }, - { assert snapshot(process.out.versions).match("rs_gtf_versions") } + { assert snapshot(process.out).match() } ) } } diff --git a/modules/nf-core/stringtie/stringtie/tests/main.nf.test.snap b/modules/nf-core/stringtie/stringtie/tests/main.nf.test.snap index bf7516364..124dd4cbe 100644 --- a/modules/nf-core/stringtie/stringtie/tests/main.nf.test.snap +++ b/modules/nf-core/stringtie/stringtie/tests/main.nf.test.snap @@ -1,5 +1,5 @@ { - "fs_abundance": { + "sarscov2 [bam] - forward strandedness + reference annotation": { "content": [ [ [ @@ -7,49 +7,44 @@ "id": "test", "strandedness": "forward" }, - "test.gene.abundance.txt:md5,d6f5c8cadb8458f1df0427cf790246e3" + "test.gene.abundance.txt:md5,7d8bce7f2a922e367cedccae7267c22e" ] - ] - ], - "timestamp": "2023-11-23T13:55:41.032044613" - }, - "fs_transcript_gtf": { - "content": [ + ], [ [ { "id": "test", "strandedness": "forward" }, - "test.transcripts.gtf:md5,569137af5be452413086b50653a97203" + [ + "e2t.ctab:md5,e981c0038295ae54b63cedb1083f1540", + "e_data.ctab:md5,6b4cf69bc03f3f69890f972a0e8b7471", + "i2t.ctab:md5,8a117c8aa4334b4c2d4711932b006fb4", + "i_data.ctab:md5,be3abe09740603213f83d50dcf81427f", + "t_data.ctab:md5,3b66c065da73ae0dd41cc332eff6a818" + ] ] - ] - ], - "timestamp": "2023-11-23T13:55:41.017978904" - }, - "rs_abundance": { - "content": [ + ], [ [ { "id": "test", - "strandedness": "reverse" + "strandedness": "forward" }, - "test.gene.abundance.txt:md5,d6f5c8cadb8458f1df0427cf790246e3" + "test.transcripts.gtf:md5,f56cf8aba2c4a5673bc7963ba5f12d04" ] - ] - ], - "timestamp": "2023-11-23T13:56:13.601112933" - }, - "fs_gtf_versions": { - "content": [ + ], [ "versions.yml:md5,3410e8ac349d18c85ddee89337851d38" ] ], - "timestamp": "2023-11-23T13:56:00.523797974" + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T12:33:44.299962" }, - "fs_gtf_transcript_gtf": { + "sarscov2 [bam] - forward strandedness": { "content": [ [ [ @@ -57,50 +52,395 @@ "id": "test", "strandedness": "forward" }, - "test.transcripts.gtf:md5,f56cf8aba2c4a5673bc7963ba5f12d04" + "test.gene.abundance.txt:md5,d6f5c8cadb8458f1df0427cf790246e3" + ] + ], + [ + [ + { + "id": "test", + "strandedness": "forward" + }, + "test.transcripts.gtf:md5,569137af5be452413086b50653a97203" ] + ], + [ + "versions.yml:md5,3410e8ac349d18c85ddee89337851d38" ] ], - "timestamp": "2023-11-23T13:56:00.475164879" + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T12:33:35.177738" }, - "rs_versions": { + "sarscov2 [bam] - forward strandedness - stub": { "content": [ - [ - "versions.yml:md5,3410e8ac349d18c85ddee89337851d38" - ] + { + "0": [ + [ + { + "id": "test", + "strandedness": "forward" + }, + "test.transcripts.gtf:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "strandedness": "forward" + }, + "test.gene.abundance.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + [ + { + "id": "test", + "strandedness": "forward" + }, + "test.coverage.gtf:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + [ + { + "id": "test", + "strandedness": "forward" + }, + "test.ballgown:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "4": [ + "versions.yml:md5,3410e8ac349d18c85ddee89337851d38" + ], + "abundance": [ + [ + { + "id": "test", + "strandedness": "forward" + }, + "test.gene.abundance.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "ballgown": [ + [ + { + "id": "test", + "strandedness": "forward" + }, + "test.ballgown:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "coverage_gtf": [ + [ + { + "id": "test", + "strandedness": "forward" + }, + "test.coverage.gtf:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "transcript_gtf": [ + [ + { + "id": "test", + "strandedness": "forward" + }, + "test.transcripts.gtf:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,3410e8ac349d18c85ddee89337851d38" + ] + } ], - "timestamp": "2023-11-23T13:56:13.623892691" + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T12:36:32.885078" }, - "rs_gtf_transcript_gtf": { + "sarscov2 [bam] - forward strandedness + reference annotation - stub": { "content": [ - [ - [ - { - "id": "test", - "strandedness": "reverse" - }, - "test.transcripts.gtf:md5,bb346053a8c156b803b055133376c7fa" + { + "0": [ + [ + { + "id": "test", + "strandedness": "forward" + }, + "test.transcripts.gtf:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "strandedness": "forward" + }, + "test.gene.abundance.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + [ + { + "id": "test", + "strandedness": "forward" + }, + "test.coverage.gtf:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + [ + { + "id": "test", + "strandedness": "forward" + }, + "test.ballgown:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "4": [ + "versions.yml:md5,3410e8ac349d18c85ddee89337851d38" + ], + "abundance": [ + [ + { + "id": "test", + "strandedness": "forward" + }, + "test.gene.abundance.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "ballgown": [ + [ + { + "id": "test", + "strandedness": "forward" + }, + "test.ballgown:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "coverage_gtf": [ + [ + { + "id": "test", + "strandedness": "forward" + }, + "test.coverage.gtf:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "transcript_gtf": [ + [ + { + "id": "test", + "strandedness": "forward" + }, + "test.transcripts.gtf:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,3410e8ac349d18c85ddee89337851d38" ] - ] + } ], - "timestamp": "2023-11-23T13:56:22.693599559" + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T12:36:43.325777" }, - "fs_gtf_abundance": { + "sarscov2 [bam] - reverse strandedness + reference annotation - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "strandedness": "reverse" + }, + "test.transcripts.gtf:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "strandedness": "reverse" + }, + "test.gene.abundance.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + [ + { + "id": "test", + "strandedness": "reverse" + }, + "test.coverage.gtf:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + [ + { + "id": "test", + "strandedness": "reverse" + }, + "test.ballgown:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "4": [ + "versions.yml:md5,3410e8ac349d18c85ddee89337851d38" + ], + "abundance": [ + [ + { + "id": "test", + "strandedness": "reverse" + }, + "test.gene.abundance.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "ballgown": [ + [ + { + "id": "test", + "strandedness": "reverse" + }, + "test.ballgown:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "coverage_gtf": [ + [ + { + "id": "test", + "strandedness": "reverse" + }, + "test.coverage.gtf:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "transcript_gtf": [ + [ + { + "id": "test", + "strandedness": "reverse" + }, + "test.transcripts.gtf:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,3410e8ac349d18c85ddee89337851d38" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T12:37:06.085936" + }, + "sarscov2 [bam] - reverse strandedness - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "strandedness": "reverse" + }, + "test.transcripts.gtf:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "strandedness": "reverse" + }, + "test.gene.abundance.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + [ + { + "id": "test", + "strandedness": "reverse" + }, + "test.coverage.gtf:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + [ + { + "id": "test", + "strandedness": "reverse" + }, + "test.ballgown:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "4": [ + "versions.yml:md5,3410e8ac349d18c85ddee89337851d38" + ], + "abundance": [ + [ + { + "id": "test", + "strandedness": "reverse" + }, + "test.gene.abundance.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "ballgown": [ + [ + { + "id": "test", + "strandedness": "reverse" + }, + "test.ballgown:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "coverage_gtf": [ + [ + { + "id": "test", + "strandedness": "reverse" + }, + "test.coverage.gtf:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "transcript_gtf": [ + [ + { + "id": "test", + "strandedness": "reverse" + }, + "test.transcripts.gtf:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,3410e8ac349d18c85ddee89337851d38" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T12:36:53.837578" + }, + "sarscov2 [bam] - reverse strandedness + reference annotation": { "content": [ [ [ { "id": "test", - "strandedness": "forward" + "strandedness": "reverse" }, - "test.gene.abundance.txt:md5,7d8bce7f2a922e367cedccae7267c22e" + "test.gene.abundance.txt:md5,7385b870b955dae2c2ab78a70cf05cce" ] - ] - ], - "timestamp": "2023-11-23T13:56:00.482135418" - }, - "rs_gtf_ballgown": { - "content": [ + ], [ [ { @@ -115,72 +455,54 @@ "t_data.ctab:md5,3b66c065da73ae0dd41cc332eff6a818" ] ] - ] - ], - "timestamp": "2023-11-23T13:56:22.715698347" - }, - "rs_transcript_gtf": { - "content": [ + ], [ [ { "id": "test", "strandedness": "reverse" }, - "test.transcripts.gtf:md5,31c34aec2bf36bb0ea3c16c2afeeeb1f" + "test.transcripts.gtf:md5,bb346053a8c156b803b055133376c7fa" ] - ] - ], - "timestamp": "2023-11-23T13:56:13.590054035" - }, - "rs_gtf_versions": { - "content": [ + ], [ "versions.yml:md5,3410e8ac349d18c85ddee89337851d38" ] ], - "timestamp": "2023-11-23T13:56:22.725513476" + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T12:34:03.114695" }, - "fs_gtf_ballgown": { + "sarscov2 [bam] - reverse strandedness": { "content": [ [ [ { "id": "test", - "strandedness": "forward" + "strandedness": "reverse" }, - [ - "e2t.ctab:md5,e981c0038295ae54b63cedb1083f1540", - "e_data.ctab:md5,6b4cf69bc03f3f69890f972a0e8b7471", - "i2t.ctab:md5,8a117c8aa4334b4c2d4711932b006fb4", - "i_data.ctab:md5,be3abe09740603213f83d50dcf81427f", - "t_data.ctab:md5,3b66c065da73ae0dd41cc332eff6a818" - ] + "test.gene.abundance.txt:md5,d6f5c8cadb8458f1df0427cf790246e3" ] - ] - ], - "timestamp": "2023-11-23T13:56:00.494299817" - }, - "fs_versions": { - "content": [ - [ - "versions.yml:md5,3410e8ac349d18c85ddee89337851d38" - ] - ], - "timestamp": "2023-11-23T13:55:41.049417582" - }, - "rs_gtf_abundance": { - "content": [ + ], [ [ { "id": "test", "strandedness": "reverse" }, - "test.gene.abundance.txt:md5,7385b870b955dae2c2ab78a70cf05cce" + "test.transcripts.gtf:md5,31c34aec2bf36bb0ea3c16c2afeeeb1f" ] + ], + [ + "versions.yml:md5,3410e8ac349d18c85ddee89337851d38" ] ], - "timestamp": "2023-11-23T13:56:22.701059059" + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T12:33:52.874479" } -} +} \ No newline at end of file diff --git a/modules/nf-core/summarizedexperiment/summarizedexperiment/tests/main.nf.test.snap b/modules/nf-core/summarizedexperiment/summarizedexperiment/tests/main.nf.test.snap index 6989f937e..1460532c7 100644 --- a/modules/nf-core/summarizedexperiment/summarizedexperiment/tests/main.nf.test.snap +++ b/modules/nf-core/summarizedexperiment/summarizedexperiment/tests/main.nf.test.snap @@ -12,9 +12,9 @@ ], "meta": { "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nextflow": "24.04.3" }, - "timestamp": "2024-02-09T13:57:39.545403663" + "timestamp": "2024-07-11T16:41:31.796715" }, "gene_log_single_matrix_stub": { "content": [ @@ -29,9 +29,9 @@ ], "meta": { "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nextflow": "24.04.3" }, - "timestamp": "2024-02-09T13:58:23.258210775" + "timestamp": "2024-07-11T16:42:47.12955" }, "versions_single_matrix": { "content": [ @@ -58,9 +58,9 @@ ], "meta": { "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nextflow": "24.04.3" }, - "timestamp": "2024-02-09T13:57:52.234643863" + "timestamp": "2024-07-11T16:41:54.028064" }, "gene_log_multi_matrix_rowdata": { "content": "7c35131fdd46dcdba6c71f7f11d5b2c7", @@ -78,9 +78,9 @@ ], "meta": { "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nextflow": "24.04.3" }, - "timestamp": "2024-03-08T14:46:04.546156" + "timestamp": "2024-07-11T16:41:54.080728" }, "versions_multi_matrix_stub": { "content": [ @@ -90,9 +90,9 @@ ], "meta": { "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nextflow": "24.04.3" }, - "timestamp": "2024-03-08T14:46:21.128541" + "timestamp": "2024-07-11T16:42:21.425746" }, "versions_multi_matrix_rowdata_coldata_stub": { "content": [ @@ -102,9 +102,9 @@ ], "meta": { "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nextflow": "24.04.3" }, - "timestamp": "2024-03-08T14:45:43.440258" + "timestamp": "2024-07-11T16:41:31.837174" }, "gene_log_multi_matrix": { "content": "7c35131fdd46dcdba6c71f7f11d5b2c7", @@ -127,9 +127,9 @@ ], "meta": { "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nextflow": "24.04.3" }, - "timestamp": "2024-02-09T13:58:07.904228634" + "timestamp": "2024-07-11T16:42:21.370562" }, "gene_log_single_matrix": { "content": "7c35131fdd46dcdba6c71f7f11d5b2c7", @@ -147,9 +147,9 @@ ], "meta": { "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nextflow": "24.04.3" }, - "timestamp": "2024-03-08T14:46:37.670798" + "timestamp": "2024-07-11T16:42:47.173221" }, "versions_multi_matrix_rowdata": { "content": [ diff --git a/modules/nf-core/ucsc/bedgraphtobigwig/tests/main.nf.test b/modules/nf-core/ucsc/bedgraphtobigwig/tests/main.nf.test index 61beea6b5..d5dbe4a37 100644 --- a/modules/nf-core/ucsc/bedgraphtobigwig/tests/main.nf.test +++ b/modules/nf-core/ucsc/bedgraphtobigwig/tests/main.nf.test @@ -5,11 +5,7 @@ nextflow_process { process "UCSC_BEDGRAPHTOBIGWIG" test("Should run without failures") { - when { - params { - outdir = "$outputDir" - } process { """ input[0] = Channel.of([ @@ -27,7 +23,27 @@ nextflow_process { { assert snapshot(process.out).match() } ) } - } + test("stub") { + options "-stub" + when { + process { + """ + input[0] = Channel.of([ + [ id:'test' ], // meta map + file(params.modules_testdata_base_path + "genomics/sarscov2/illumina/bedgraph/test.bedgraph", checkIfExists: true) + ]) + input[1] = Channel.of(file(params.modules_testdata_base_path + "genomics/sarscov2/genome/genome.sizes", checkIfExists: true)) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } } diff --git a/modules/nf-core/ucsc/bedgraphtobigwig/tests/main.nf.test.snap b/modules/nf-core/ucsc/bedgraphtobigwig/tests/main.nf.test.snap index 526f0e261..7b0181583 100644 --- a/modules/nf-core/ucsc/bedgraphtobigwig/tests/main.nf.test.snap +++ b/modules/nf-core/ucsc/bedgraphtobigwig/tests/main.nf.test.snap @@ -1,4 +1,37 @@ { + "stub": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "test.bigWig:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + "versions.yml:md5,93b027527145a243903a3c687c3453b8" + ], + "bigwig": [ + [ + { + "id": "test" + }, + "test.bigWig:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,93b027527145a243903a3c687c3453b8" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T12:06:05.176746" + }, "Should run without failures": { "content": [ { @@ -27,9 +60,9 @@ } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2023-10-18T04:06:47.826602" + "timestamp": "2024-07-22T12:05:56.658148" } } \ No newline at end of file diff --git a/modules/nf-core/umitools/dedup/main.nf b/modules/nf-core/umitools/dedup/main.nf index b2d11ebf5..1e2a2aae0 100644 --- a/modules/nf-core/umitools/dedup/main.nf +++ b/modules/nf-core/umitools/dedup/main.nf @@ -47,6 +47,7 @@ process UMITOOLS_DEDUP { """ stub: + prefix = task.ext.prefix ?: "${meta.id}" """ touch ${prefix}.bam touch ${prefix}.log diff --git a/modules/nf-core/umitools/dedup/tests/main.nf.test b/modules/nf-core/umitools/dedup/tests/main.nf.test index 018bd293d..883e2d9d7 100644 --- a/modules/nf-core/umitools/dedup/tests/main.nf.test +++ b/modules/nf-core/umitools/dedup/tests/main.nf.test @@ -26,8 +26,9 @@ nextflow_process { assertAll( { assert process.success }, { assert path("${process.out.log[0][1]}").exists() }, - { assert snapshot(process.out.bam).match("se no stats - bam") }, - { assert snapshot(process.out.versions).match("se no stats - versions") } + { assert snapshot( + bam(process.out.bam[0][1]).getSamLinesMD5(), + process.out.versions).match() } ) } } @@ -54,8 +55,9 @@ nextflow_process { assertAll( { assert process.success }, { assert path("${process.out.log[0][1]}").exists() }, - { assert snapshot(process.out.bam).match("pe no stats - bam") }, - { assert snapshot(process.out.versions).match("pe no stats - versions") } + { assert snapshot( + process.out.bam, + process.out.versions).match() } ) } } @@ -82,11 +84,99 @@ nextflow_process { assertAll( { assert process.success }, { assert path("${process.out.log[0][1]}").exists() }, - { assert snapshot(process.out.bam).match("pe - bam") }, - { assert snapshot(process.out.tsv_edit_distance).match("pe - tsv_edit_distance") }, - { assert snapshot(process.out.tsv_per_umi).match("pe - tsv_per_umi") }, - { assert snapshot(process.out.tsv_umi_per_position).match("pe - tsv_umi_per_position") }, - { assert snapshot(process.out.versions).match("pe - versions") } + { assert snapshot( + process.out.bam, + process.out.tsv_edit_distance, + process.out.tsv_per_umi, + process.out.tsv_umi_per_position, + process.out.versions).match() } + ) + } + } + + test("se - no stats - stub") { + + options "-stub" + + config "./nextflow.config" + + when { + process { + """ + get_output_stats = false + + input[0] = [ + [ id:'test', single_end:true ], // meta map + file(params.modules_testdata_base_path + "genomics/sarscov2/illumina/bam/test.single_end.sorted.bam", checkIfExists: true), + file(params.modules_testdata_base_path + "genomics/sarscov2/illumina/bam/test.single_end.sorted.bam.bai", checkIfExists: true) + ] + input[1] = get_output_stats + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out.bam).match() } + ) + } + } + + test("pe - no stats - stub") { + + options "-stub" + + config "./nextflow.config" + + when { + process { + """ + get_output_stats = false + + input[0] = [ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + "genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam", checkIfExists: true), + file(params.modules_testdata_base_path + "genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam.bai", checkIfExists: true) + ] + input[1] = get_output_stats + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out.bam).match() } + ) + } + } + + test("pe - with stats - stub") { + + options "-stub" + + config "./nextflow.config" + + when { + process { + """ + get_output_stats = true + + input[0] = [ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + "genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam", checkIfExists: true), + file(params.modules_testdata_base_path + "genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam.bai", checkIfExists: true) + ] + input[1] = get_output_stats + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out.bam).match() } ) } } diff --git a/modules/nf-core/umitools/dedup/tests/main.nf.test.snap b/modules/nf-core/umitools/dedup/tests/main.nf.test.snap index bc3c8693c..f7f4e94f1 100644 --- a/modules/nf-core/umitools/dedup/tests/main.nf.test.snap +++ b/modules/nf-core/umitools/dedup/tests/main.nf.test.snap @@ -1,5 +1,5 @@ { - "pe no stats - bam": { + "pe - no stats - stub": { "content": [ [ [ @@ -7,17 +7,17 @@ "id": "test", "single_end": false }, - "test.dedup.bam:md5,350e942a0d45e8356fa24bc8c47dc1ed" + "test.dedup.bam:md5,d41d8cd98f00b204e9800998ecf8427e" ] ] ], "meta": { "nf-test": "0.8.4", - "nextflow": "24.01.0" + "nextflow": "24.04.2" }, - "timestamp": "2024-03-04T17:41:38.139428" + "timestamp": "2024-07-03T11:40:46.802233" }, - "pe - tsv_per_umi": { + "pe - with stats - stub": { "content": [ [ [ @@ -25,18 +25,27 @@ "id": "test", "single_end": false }, - "test.dedup_per_umi.tsv:md5,8e6783a4a79437b095f095f2aefe7c01" + "test.dedup.bam:md5,d41d8cd98f00b204e9800998ecf8427e" ] ] ], "meta": { "nf-test": "0.8.4", - "nextflow": "24.01.0" + "nextflow": "24.04.2" }, - "timestamp": "2024-03-04T17:41:56.21078" + "timestamp": "2024-07-03T11:40:59.501624" }, - "pe - tsv_edit_distance": { + "pe - with stats": { "content": [ + [ + [ + { + "id": "test", + "single_end": false + }, + "test.dedup.bam:md5,350e942a0d45e8356fa24bc8c47dc1ed" + ] + ], [ [ { @@ -45,16 +54,16 @@ }, "test.dedup_edit_distance.tsv:md5,65186b0964e2f8d970cc04d736d8b119" ] - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-04T17:41:56.203654" - }, - "pe - tsv_umi_per_position": { - "content": [ + ], + [ + [ + { + "id": "test", + "single_end": false + }, + "test.dedup_per_umi.tsv:md5,8e6783a4a79437b095f095f2aefe7c01" + ] + ], [ [ { @@ -63,15 +72,18 @@ }, "test.dedup_per_umi_per_position.tsv:md5,9386db4a104b8e4e32f3ca4a84efa4ac" ] + ], + [ + "versions.yml:md5,e2f5146464c09bf7ae98c85ea5410e50" ] ], "meta": { "nf-test": "0.8.4", - "nextflow": "24.01.0" + "nextflow": "24.04.2" }, - "timestamp": "2024-03-04T17:41:56.217525" + "timestamp": "2024-07-03T11:27:24.231325" }, - "se no stats - bam": { + "se - no stats - stub": { "content": [ [ [ @@ -79,41 +91,30 @@ "id": "test", "single_end": true }, - "test.dedup.bam:md5,c9da2ee4f07f5c6922251bd01d6bcb01" + "test.dedup.bam:md5,d41d8cd98f00b204e9800998ecf8427e" ] ] ], "meta": { "nf-test": "0.8.4", - "nextflow": "24.01.0" + "nextflow": "24.04.2" }, - "timestamp": "2024-03-04T17:41:16.383148" + "timestamp": "2024-07-03T11:40:34.598176" }, - "se no stats - versions": { + "se - no stats": { "content": [ + "a114abd9fccce6fe2869852b5cd18964", [ "versions.yml:md5,e2f5146464c09bf7ae98c85ea5410e50" ] ], "meta": { "nf-test": "0.8.4", - "nextflow": "24.01.0" + "nextflow": "24.04.2" }, - "timestamp": "2024-03-04T17:41:16.391241" + "timestamp": "2024-07-03T13:45:48.553561" }, - "pe - versions": { - "content": [ - [ - "versions.yml:md5,e2f5146464c09bf7ae98c85ea5410e50" - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-04T17:41:56.226748" - }, - "pe - bam": { + "pe - no stats": { "content": [ [ [ @@ -123,24 +124,15 @@ }, "test.dedup.bam:md5,350e942a0d45e8356fa24bc8c47dc1ed" ] - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-04T17:41:56.19652" - }, - "pe no stats - versions": { - "content": [ + ], [ "versions.yml:md5,e2f5146464c09bf7ae98c85ea5410e50" ] ], "meta": { "nf-test": "0.8.4", - "nextflow": "24.01.0" + "nextflow": "24.04.2" }, - "timestamp": "2024-03-04T17:41:38.157629" + "timestamp": "2024-07-03T11:27:06.957467" } } \ No newline at end of file diff --git a/modules/nf-core/untar/environment.yml b/modules/nf-core/untar/environment.yml index 0c9cbb101..4f498244a 100644 --- a/modules/nf-core/untar/environment.yml +++ b/modules/nf-core/untar/environment.yml @@ -1,11 +1,9 @@ name: untar - channels: - conda-forge - bioconda - defaults - dependencies: - conda-forge::grep=3.11 - - conda-forge::sed=4.7 + - conda-forge::sed=4.8 - conda-forge::tar=1.34 diff --git a/modules/nf-core/untar/main.nf b/modules/nf-core/untar/main.nf index 8a75bb957..9bd8f5546 100644 --- a/modules/nf-core/untar/main.nf +++ b/modules/nf-core/untar/main.nf @@ -4,8 +4,8 @@ process UNTAR { conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/ubuntu:20.04' : - 'nf-core/ubuntu:20.04' }" + 'https://depot.galaxyproject.org/singularity/ubuntu:22.04' : + 'nf-core/ubuntu:22.04' }" input: tuple val(meta), path(archive) @@ -52,8 +52,29 @@ process UNTAR { stub: prefix = task.ext.prefix ?: ( meta.id ? "${meta.id}" : archive.toString().replaceFirst(/\.[^\.]+(.gz)?$/, "")) """ - mkdir $prefix - touch ${prefix}/file.txt + mkdir ${prefix} + ## Dry-run untaring the archive to get the files and place all in prefix + if [[ \$(tar -taf ${archive} | grep -o -P "^.*?\\/" | uniq | wc -l) -eq 1 ]]; then + for i in `tar -tf ${archive}`; + do + if [[ \$(echo "\${i}" | grep -E "/\$") == "" ]]; + then + touch \${i} + else + mkdir -p \${i} + fi + done + else + for i in `tar -tf ${archive}`; + do + if [[ \$(echo "\${i}" | grep -E "/\$") == "" ]]; + then + touch ${prefix}/\${i} + else + mkdir -p ${prefix}/\${i} + fi + done + fi cat <<-END_VERSIONS > versions.yml "${task.process}": diff --git a/modules/nf-core/untar/tests/main.nf.test b/modules/nf-core/untar/tests/main.nf.test index 2740dfbcf..f556118ff 100644 --- a/modules/nf-core/untar/tests/main.nf.test +++ b/modules/nf-core/untar/tests/main.nf.test @@ -17,10 +17,9 @@ nextflow_process { then { assertAll ( { assert process.success }, - { assert snapshot(process.out.untar).match("test_untar") }, + { assert snapshot(process.out).match() }, ) } - } test("test_untar_onlyfiles") { @@ -36,10 +35,48 @@ nextflow_process { then { assertAll ( { assert process.success }, - { assert snapshot(process.out.untar).match("test_untar_onlyfiles") }, + { assert snapshot(process.out).match() }, ) } + } + + test("test_untar - stub") { + options "-stub" + + when { + process { + """ + input[0] = [ [], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/db/kraken2.tar.gz', checkIfExists: true) ] + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() }, + ) + } } + test("test_untar_onlyfiles - stub") { + + options "-stub" + + when { + process { + """ + input[0] = [ [], file(params.modules_testdata_base_path + 'generic/tar/hello.tar.gz', checkIfExists: true) ] + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() }, + ) + } + } } diff --git a/modules/nf-core/untar/tests/main.nf.test.snap b/modules/nf-core/untar/tests/main.nf.test.snap index 64550292f..ceb91b792 100644 --- a/modules/nf-core/untar/tests/main.nf.test.snap +++ b/modules/nf-core/untar/tests/main.nf.test.snap @@ -1,42 +1,158 @@ { "test_untar_onlyfiles": { "content": [ - [ - [ + { + "0": [ [ - - ], + [ + + ], + [ + "hello.txt:md5,e59ff97941044f85df5297e1c302d260" + ] + ] + ], + "1": [ + "versions.yml:md5,6063247258c56fd271d076bb04dd7536" + ], + "untar": [ + [ + [ + + ], + [ + "hello.txt:md5,e59ff97941044f85df5297e1c302d260" + ] + ] + ], + "versions": [ + "versions.yml:md5,6063247258c56fd271d076bb04dd7536" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-10T12:04:28.231047" + }, + "test_untar_onlyfiles - stub": { + "content": [ + { + "0": [ + [ + [ + + ], + [ + "hello.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "1": [ + "versions.yml:md5,6063247258c56fd271d076bb04dd7536" + ], + "untar": [ [ - "hello.txt:md5,e59ff97941044f85df5297e1c302d260" + [ + + ], + [ + "hello.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] ] + ], + "versions": [ + "versions.yml:md5,6063247258c56fd271d076bb04dd7536" ] - ] + } ], "meta": { "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nextflow": "24.04.3" }, - "timestamp": "2024-02-28T11:49:41.320643" + "timestamp": "2024-07-10T12:04:45.773103" + }, + "test_untar - stub": { + "content": [ + { + "0": [ + [ + [ + + ], + [ + "hash.k2d:md5,d41d8cd98f00b204e9800998ecf8427e", + "opts.k2d:md5,d41d8cd98f00b204e9800998ecf8427e", + "taxo.k2d:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "1": [ + "versions.yml:md5,6063247258c56fd271d076bb04dd7536" + ], + "untar": [ + [ + [ + + ], + [ + "hash.k2d:md5,d41d8cd98f00b204e9800998ecf8427e", + "opts.k2d:md5,d41d8cd98f00b204e9800998ecf8427e", + "taxo.k2d:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "versions": [ + "versions.yml:md5,6063247258c56fd271d076bb04dd7536" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-10T12:04:36.777441" }, "test_untar": { "content": [ - [ - [ + { + "0": [ [ - - ], + [ + + ], + [ + "hash.k2d:md5,8b8598468f54a7087c203ad0190555d9", + "opts.k2d:md5,a033d00cf6759407010b21700938f543", + "taxo.k2d:md5,094d5891cdccf2f1468088855c214b2c" + ] + ] + ], + "1": [ + "versions.yml:md5,6063247258c56fd271d076bb04dd7536" + ], + "untar": [ [ - "hash.k2d:md5,8b8598468f54a7087c203ad0190555d9", - "opts.k2d:md5,a033d00cf6759407010b21700938f543", - "taxo.k2d:md5,094d5891cdccf2f1468088855c214b2c" + [ + + ], + [ + "hash.k2d:md5,8b8598468f54a7087c203ad0190555d9", + "opts.k2d:md5,a033d00cf6759407010b21700938f543", + "taxo.k2d:md5,094d5891cdccf2f1468088855c214b2c" + ] ] + ], + "versions": [ + "versions.yml:md5,6063247258c56fd271d076bb04dd7536" ] - ] + } ], "meta": { "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nextflow": "24.04.3" }, - "timestamp": "2024-02-28T11:49:33.795172" + "timestamp": "2024-07-10T12:04:19.377674" } } \ No newline at end of file diff --git a/nf-test.config b/nf-test.config index f126b460a..0f4cac519 100644 --- a/nf-test.config +++ b/nf-test.config @@ -9,4 +9,9 @@ config { configFile "tests/nextflow.config" profile "test" + + // load the necessary plugins + plugins { + load "nft-bam@0.3.0" + } } diff --git a/subworkflows/local/align_star/tests/main.nf.test b/subworkflows/local/align_star/tests/main.nf.test index 2b98dffbf..35b3236e8 100644 --- a/subworkflows/local/align_star/tests/main.nf.test +++ b/subworkflows/local/align_star/tests/main.nf.test @@ -60,24 +60,26 @@ nextflow_workflow { then { assertAll( { assert workflow.success}, - { assert snapshot(file(workflow.out.log_final[0][1]).name).match("without igenomes - log_final") }, - { assert snapshot(file(workflow.out.log_out[0][1]).name).match("without igenomes - log_out") }, - { assert snapshot(workflow.out.bai).match("without igenomes - bai")}, - { assert snapshot(workflow.out.bam).match("without igenomes - bam")}, - { assert snapshot(workflow.out.bam_sorted).match("without igenomes - bam_sorted")}, - { assert snapshot(workflow.out.bam_transcript).match("without igenomes - bam_transcript")}, - { assert snapshot(workflow.out.csi).match("without igenomes - csi")}, - { assert snapshot(workflow.out.log_progress).match("without igenomes - log_progress")}, - { assert snapshot(workflow.out.fastq).match("without igenomes - fastq")}, - { assert snapshot(workflow.out.flagstat).match("without igenomes - flagstat")}, - { assert snapshot(workflow.out.idxstats).match("without igenomes - idxstats")}, - { assert snapshot(workflow.out.orig_bam).match("without igenomes - orig_bam")}, - { assert snapshot(workflow.out.stats).match("without igenomes - stats")}, - { assert snapshot(workflow.out.tab).match("without igenomes - tab")}, - { assert snapshot(workflow.out.versions).match("without igenomes - versions")} + { assert snapshot( + file(workflow.out.log_final[0][1]).name, + file(workflow.out.log_out[0][1]).name, + workflow.out.bai, + workflow.out.bam, + workflow.out.bam_sorted, + workflow.out.bam_transcript, + workflow.out.csi, + workflow.out.log_progress, + workflow.out.fastq, + workflow.out.flagstat, + workflow.out.idxstats, + workflow.out.orig_bam, + workflow.out.stats, + workflow.out.tab, + workflow.out.versions).match()} ) } } + test("star - with igenomes") { setup { @@ -127,23 +129,169 @@ nextflow_workflow { then { assertAll( { assert workflow.success}, - { assert snapshot(file(workflow.out.log_final[0][1]).name).match("with igenomes - log_final") }, - { assert snapshot(file(workflow.out.log_out[0][1]).name).match("with igenomes - log_out") }, - { assert snapshot(workflow.out.bai).match("with igenomes - bai")}, - { assert snapshot(workflow.out.bam).match("with igenomes - bam")}, - { assert snapshot(workflow.out.bam_sorted).match("with igenomes - bam_sorted")}, - { assert snapshot(workflow.out.bam_transcript).match("with igenomes - bam_transcript")}, - { assert snapshot(workflow.out.csi).match("with igenomes - csi")}, - { assert snapshot(workflow.out.log_progress).match("with igenomes - log_progress")}, - { assert snapshot(workflow.out.fastq).match("with igenomes - fastq")}, - { assert snapshot(workflow.out.flagstat).match("with igenomes - flagstat")}, - { assert snapshot(workflow.out.idxstats).match("with igenomes - idxstats")}, - { assert snapshot(workflow.out.orig_bam).match("with igenomes - orig_bam")}, - { assert snapshot(workflow.out.stats).match("with igenomes - stats")}, - { assert snapshot(workflow.out.tab).match("with igenomes - tab")}, - { assert snapshot(workflow.out.versions).match("with igenomes - versions")} + { assert snapshot( + file(workflow.out.log_final[0][1]).name, + file(workflow.out.log_out[0][1]).name, + workflow.out.bai, + workflow.out.bam, + workflow.out.bam_sorted, + workflow.out.bam_transcript, + workflow.out.csi, + workflow.out.log_progress, + workflow.out.fastq, + workflow.out.flagstat, + workflow.out.idxstats, + workflow.out.orig_bam, + workflow.out.stats, + workflow.out.tab, + workflow.out.versions).match()} + ) + } + } + + test("star - no igenomes - stub") { + + options "-stub" + + setup { + run("STAR_GENOMEGENERATE") { + script "../../../../modules/nf-core/star/genomegenerate/main.nf" + process { + """ + input[0] = Channel.of([ + [ id:'test_fasta' ], + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) ] + ]) + input[1] = Channel.of([ + [ id:'test_gtf' ], + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true) ] + ]) + """ + } + } + } + + when { + workflow { + """ + star_ignore_sjdbgtf = false + seq_platform = 'illumina' + seq_center = false + is_aws_igenome = false + + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_rnaseq_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_rnaseq_2.fastq.gz', checkIfExists: true) + ] + ]) + input[1] = STAR_GENOMEGENERATE.out.index + input[2] = Channel.of([ + [ id:'test_gtf' ], + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true) ] + ]) + input[3] = star_ignore_sjdbgtf + input[4] = seq_platform + input[5] = seq_center + input[6] = is_aws_igenome + input[7] = Channel.of([ + [ id:'test_fasta' ], + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) ] + ]) + """ + } + } + + then { + assertAll( + { assert workflow.success}, + { assert snapshot( + workflow.out.bai, + workflow.out.bam, + workflow.out.bam_sorted, + workflow.out.bam_transcript, + workflow.out.csi, + workflow.out.flagstat, + workflow.out.idxstats, + workflow.out.log_final, + workflow.out.log_out, + workflow.out.log_progress, + workflow.out.orig_bam, + workflow.out.stats, + workflow.out.tab, + workflow.out.versions).match()} ) } } + test("star - with igenomes - stub") { + + options "-stub" + + setup { + run("STAR_GENOMEGENERATE_IGENOMES") { + script "../../../../modules/local/star_genomegenerate_igenomes/main.nf" + process { + """ + input[0] = Channel.of([file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)]) + input[1] = Channel.of([file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true)]) + """ + } + } + } + + when { + workflow { + """ + star_ignore_sjdbgtf = false + seq_platform = 'illumina' + seq_center = false + is_aws_igenome = true + + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_rnaseq_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_rnaseq_2.fastq.gz', checkIfExists: true) + ] + ]) + input[1] = STAR_GENOMEGENERATE_IGENOMES.out.index.map{ [ [id:'star'], it ] } + input[2] = Channel.of([ + [ id:'test_gtf' ], + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true) ] + ]) + input[3] = star_ignore_sjdbgtf + input[4] = seq_platform + input[5] = seq_center + input[6] = is_aws_igenome + input[7] = Channel.of([ + [ id:'test_fasta' ], + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) ] + ]) + """ + } + } + + then { + assertAll( + { assert workflow.success}, + { assert snapshot( + workflow.out.bai, + workflow.out.bam, + workflow.out.bam_sorted, + workflow.out.bam_transcript, + workflow.out.csi, + workflow.out.flagstat, + workflow.out.idxstats, + workflow.out.log_final, + workflow.out.log_out, + workflow.out.log_progress, + workflow.out.orig_bam, + workflow.out.stats, + workflow.out.tab, + workflow.out.versions).match()} + ) + } + } } diff --git a/subworkflows/local/align_star/tests/main.nf.test.snap b/subworkflows/local/align_star/tests/main.nf.test.snap index 33f4d772a..e3a4b2e03 100644 --- a/subworkflows/local/align_star/tests/main.nf.test.snap +++ b/subworkflows/local/align_star/tests/main.nf.test.snap @@ -1,6 +1,41 @@ { - "without igenomes - log_progress": { + "star - with igenomes": { "content": [ + "test.Log.final.out", + "test.Log.out", + [ + [ + { + "id": "test", + "single_end": false + }, + "test.bam.bai:md5,8bfbd4094a92ac0de8492d98a471d1b0" + ] + ], + [ + [ + { + "id": "test", + "single_end": false + }, + "test.bam:md5,fc154c31eb4d034ebdb6b1d17c6b45eb" + ] + ], + [ + [ + { + "id": "test", + "single_end": false + }, + "test.Aligned.sortedByCoord.out.bam:md5,b6cec9bba6b04b9b92eddbef128bdfbb" + ] + ], + [ + + ], + [ + + ], [ [ { @@ -9,16 +44,37 @@ }, "test.Log.progress.out:md5,b2bd061d6cbaaf3d6d3b1fed547f69b8" ] - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-07T11:59:42.476234" - }, - "with igenomes - stats": { - "content": [ + ], + [ + + ], + [ + [ + { + "id": "test", + "single_end": false + }, + "test.flagstat:md5,db0e25cd0b37d3030e807846c022199e" + ] + ], + [ + [ + { + "id": "test", + "single_end": false + }, + "test.idxstats:md5,107ca94dd426cc44db316f0d402307c5" + ] + ], + [ + [ + { + "id": "test", + "single_end": false + }, + "test.Aligned.sortedByCoord.out.bam:md5,b6cec9bba6b04b9b92eddbef128bdfbb" + ] + ], [ [ { @@ -27,15 +83,32 @@ }, "test.stats:md5,202e2f234f93b347b6a72d0163773054" ] + ], + [ + [ + { + "id": "test", + "single_end": false + }, + "test.SJ.out.tab:md5,844af19ab0fc8cd9a3f75228445aca0d" + ] + ], + [ + "versions.yml:md5,06693106908e6f8f38a2c30accf7067d", + "versions.yml:md5,369619588c8c294b74dca9058a151b11", + "versions.yml:md5,78069d4515b04251f758ac52a49d9971", + "versions.yml:md5,b6a22ef369a375445a8f9313721b8092", + "versions.yml:md5,e3b043ba840d5bddde92f0bf1c91a5fc", + "versions.yml:md5,feaf798d368c662a7a1cea87a24a7434" ] ], "meta": { "nf-test": "0.8.4", "nextflow": "24.04.2" }, - "timestamp": "2024-07-02T16:51:25.527796" + "timestamp": "2024-07-03T19:13:41.194686" }, - "with igenomes - flagstat": { + "star - no igenomes - stub": { "content": [ [ [ @@ -43,84 +116,122 @@ "id": "test", "single_end": false }, - "test.flagstat:md5,db0e25cd0b37d3030e807846c022199e" + "test.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e" ] - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-07T12:00:35.063991" - }, - "without igenomes - flagstat": { - "content": [ + ], [ [ { "id": "test", "single_end": false }, - "test.flagstat:md5,db0e25cd0b37d3030e807846c022199e" + "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" ] - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-07T11:59:42.500434" - }, - "with igenomes - csi": { - "content": [ + ], + [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + [ + [ + { + "id": "test", + "single_end": false + }, + "test.toTranscriptome.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], [ - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-07T12:00:35.008879" - }, - "without igenomes - stats": { - "content": [ + ], [ [ { "id": "test", "single_end": false }, - "test.stats:md5,202e2f234f93b347b6a72d0163773054" + "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e" ] - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" - }, - "timestamp": "2024-07-02T16:50:30.406405" - }, - "with igenomes - bam_sorted": { - "content": [ + ], [ [ { "id": "test", "single_end": false }, - "test.Aligned.sortedByCoord.out.bam:md5,b6cec9bba6b04b9b92eddbef128bdfbb" + "test.idxstats:md5,d41d8cd98f00b204e9800998ecf8427e" ] - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-07T12:00:34.968826" - }, - "without igenomes - versions": { - "content": [ + ], + [ + [ + { + "id": "test", + "single_end": false + }, + "test.Log.final.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + [ + [ + { + "id": "test", + "single_end": false + }, + "test.Log.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + [ + [ + { + "id": "test", + "single_end": false + }, + "test.Log.progress.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "testXd.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + [ + [ + { + "id": "test", + "single_end": false + }, + "test.stats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.ReadsPerGene.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.SJ.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.tab:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], [ "versions.yml:md5,06693106908e6f8f38a2c30accf7067d", "versions.yml:md5,35c1cc21d26d9d8f00e6ec87e97fb634", @@ -131,95 +242,111 @@ ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-07-02T16:50:30.464346" + "timestamp": "2024-07-22T19:43:30.675108" }, - "without igenomes - bam_transcript": { + "star - no igenomes": { "content": [ + "test.Log.final.out", + "test.Log.out", [ - - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-07T11:59:42.453855" - }, - "without igenomes - idxstats": { - "content": [ + [ + { + "id": "test", + "single_end": false + }, + "test.bam.bai:md5,8bfbd4094a92ac0de8492d98a471d1b0" + ] + ], [ [ { "id": "test", "single_end": false }, - "test.idxstats:md5,107ca94dd426cc44db316f0d402307c5" + "test.bam:md5,e6573d093da6ec95f99c1669eb86bbd6" ] - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-07T11:59:42.511992" - }, - "with igenomes - fastq": { - "content": [ + ], + [ + [ + { + "id": "test", + "single_end": false + }, + "test.Aligned.sortedByCoord.out.bam:md5,b9ee1c607e07323bc1652ef3babb543f" + ] + ], [ - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-07T12:00:35.046516" - }, - "without igenomes - log_out": { - "content": [ - "test.Log.out" - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-07T12:07:26.212398" - }, - "without igenomes - fastq": { - "content": [ + ], [ - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-07T11:59:42.488954" - }, - "without igenomes - csi": { - "content": [ + ], + [ + [ + { + "id": "test", + "single_end": false + }, + "test.Log.progress.out:md5,b2bd061d6cbaaf3d6d3b1fed547f69b8" + ] + ], [ - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-07T11:59:42.464985" - }, - "with igenomes - versions": { - "content": [ + ], + [ + [ + { + "id": "test", + "single_end": false + }, + "test.flagstat:md5,db0e25cd0b37d3030e807846c022199e" + ] + ], + [ + [ + { + "id": "test", + "single_end": false + }, + "test.idxstats:md5,107ca94dd426cc44db316f0d402307c5" + ] + ], + [ + [ + { + "id": "test", + "single_end": false + }, + "test.Aligned.sortedByCoord.out.bam:md5,b9ee1c607e07323bc1652ef3babb543f" + ] + ], + [ + [ + { + "id": "test", + "single_end": false + }, + "test.stats:md5,202e2f234f93b347b6a72d0163773054" + ] + ], + [ + [ + { + "id": "test", + "single_end": false + }, + "test.SJ.out.tab:md5,844af19ab0fc8cd9a3f75228445aca0d" + ] + ], [ "versions.yml:md5,06693106908e6f8f38a2c30accf7067d", + "versions.yml:md5,35c1cc21d26d9d8f00e6ec87e97fb634", "versions.yml:md5,369619588c8c294b74dca9058a151b11", "versions.yml:md5,78069d4515b04251f758ac52a49d9971", "versions.yml:md5,b6a22ef369a375445a8f9313721b8092", - "versions.yml:md5,e3b043ba840d5bddde92f0bf1c91a5fc", "versions.yml:md5,feaf798d368c662a7a1cea87a24a7434" ] ], @@ -227,9 +354,9 @@ "nf-test": "0.8.4", "nextflow": "24.04.2" }, - "timestamp": "2024-07-02T16:51:25.579874" + "timestamp": "2024-07-03T19:12:49.496188" }, - "with igenomes - log_progress": { + "star - with igenomes - stub": { "content": [ [ [ @@ -237,236 +364,135 @@ "id": "test", "single_end": false }, - "test.Log.progress.out:md5,b2bd061d6cbaaf3d6d3b1fed547f69b8" + "test.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e" ] - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-07T12:00:35.028932" - }, - "with igenomes - bam_transcript": { - "content": [ + ], [ - - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-07T12:00:34.989058" - }, - "with igenomes - log_out": { - "content": [ - "test.Log.out" - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-07T12:04:22.59113" - }, - "without igenomes - tab": { - "content": [ + [ + { + "id": "test", + "single_end": false + }, + "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], [ [ { "id": "test", "single_end": false }, - "test.SJ.out.tab:md5,844af19ab0fc8cd9a3f75228445aca0d" + [ + "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] ] - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-07T11:59:42.557135" - }, - "without igenomes - bai": { - "content": [ + ], [ [ { "id": "test", "single_end": false }, - "test.bam.bai:md5,8bfbd4094a92ac0de8492d98a471d1b0" + "test.toTranscriptome.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" ] - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" - }, - "timestamp": "2024-07-02T16:50:30.294108" - }, - "without igenomes - orig_bam": { - "content": [ + ], + [ + + ], [ [ { "id": "test", "single_end": false }, - "test.Aligned.sortedByCoord.out.bam:md5,b9ee1c607e07323bc1652ef3babb543f" + "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e" ] - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-07T11:59:42.523368" - }, - "without igenomes - log_final": { - "content": [ - "test.Log.final.out" - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-07T12:07:26.199" - }, - "without igenomes - bam": { - "content": [ + ], [ [ { "id": "test", "single_end": false }, - "test.bam:md5,e6573d093da6ec95f99c1669eb86bbd6" + "test.idxstats:md5,d41d8cd98f00b204e9800998ecf8427e" ] - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" - }, - "timestamp": "2024-07-02T16:50:30.348908" - }, - "with igenomes - orig_bam": { - "content": [ + ], [ [ { "id": "test", "single_end": false }, - "test.Aligned.sortedByCoord.out.bam:md5,b6cec9bba6b04b9b92eddbef128bdfbb" + "test.Log.final.out:md5,d41d8cd98f00b204e9800998ecf8427e" ] - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-07T12:00:35.100886" - }, - "with igenomes - idxstats": { - "content": [ + ], [ [ { "id": "test", "single_end": false }, - "test.idxstats:md5,107ca94dd426cc44db316f0d402307c5" + "test.Log.out:md5,d41d8cd98f00b204e9800998ecf8427e" ] - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-07T12:00:35.080603" - }, - "with igenomes - tab": { - "content": [ + ], [ [ { "id": "test", "single_end": false }, - "test.SJ.out.tab:md5,844af19ab0fc8cd9a3f75228445aca0d" + "test.Log.progress.out:md5,d41d8cd98f00b204e9800998ecf8427e" ] - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-07T12:00:35.148353" - }, - "with igenomes - bam": { - "content": [ + ], [ [ { "id": "test", "single_end": false }, - "test.bam:md5,fc154c31eb4d034ebdb6b1d17c6b45eb" + [ + "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e", + "testXd.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] ] - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" - }, - "timestamp": "2024-07-02T16:51:25.474137" - }, - "without igenomes - bam_sorted": { - "content": [ + ], [ [ { "id": "test", "single_end": false }, - "test.Aligned.sortedByCoord.out.bam:md5,b9ee1c607e07323bc1652ef3babb543f" + "test.stats:md5,d41d8cd98f00b204e9800998ecf8427e" ] - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-07T11:59:42.442171" - }, - "with igenomes - bai": { - "content": [ + ], [ [ { "id": "test", "single_end": false }, - "test.bam.bai:md5,8bfbd4094a92ac0de8492d98a471d1b0" + [ + "test.ReadsPerGene.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.SJ.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "test.tab:md5,d41d8cd98f00b204e9800998ecf8427e" + ] ] + ], + [ + "versions.yml:md5,06693106908e6f8f38a2c30accf7067d", + "versions.yml:md5,369619588c8c294b74dca9058a151b11", + "versions.yml:md5,78069d4515b04251f758ac52a49d9971", + "versions.yml:md5,b6a22ef369a375445a8f9313721b8092", + "versions.yml:md5,e3b043ba840d5bddde92f0bf1c91a5fc", + "versions.yml:md5,feaf798d368c662a7a1cea87a24a7434" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" - }, - "timestamp": "2024-07-02T16:51:25.407812" - }, - "with igenomes - log_final": { - "content": [ - "test.Log.final.out" - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-03-07T12:04:22.57863" + "timestamp": "2024-07-22T19:43:56.680384" } } \ No newline at end of file diff --git a/subworkflows/local/prepare_genome/tests/main.nf.test b/subworkflows/local/prepare_genome/tests/main.nf.test index 8c5cc5b6b..fd8dc5154 100644 --- a/subworkflows/local/prepare_genome/tests/main.nf.test +++ b/subworkflows/local/prepare_genome/tests/main.nf.test @@ -20,16 +20,16 @@ nextflow_workflow { skip_alignment = false skip_pseudo_alignment = false - input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true) - input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true) - input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true) - input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true) - input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true) - input[5] = null - input[6] = null - input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true) - input[8] = null - input[9] = null + input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true) + input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true) + input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true) + input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true) + input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true) + input[5] = null + input[6] = null + input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true) + input[8] = null + input[9] = null input[10] = file(params.pipelines_testdata_base_path + 'reference/rsem.tar.gz', checkIfExists: true) input[11] = file(params.pipelines_testdata_base_path + 'reference/salmon.tar.gz', checkIfExists: true) input[12] = null @@ -154,16 +154,16 @@ nextflow_workflow { skip_alignment = false skip_pseudo_alignment = false - input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true) - input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true) - input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true) - input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true) - input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true) - input[5] = null - input[6] = null - input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true) - input[8] = null - input[9] = null + input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true) + input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true) + input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true) + input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true) + input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true) + input[5] = null + input[6] = null + input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true) + input[8] = null + input[9] = null input[10] = file(params.pipelines_testdata_base_path + 'reference/rsem.tar.gz', checkIfExists: true) input[11] = file(params.pipelines_testdata_base_path + 'reference/salmon.tar.gz', checkIfExists: true) input[12] = null @@ -221,16 +221,16 @@ nextflow_workflow { skip_alignment = false skip_pseudo_alignment = false - input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true) - input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true) - input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true) - input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true) - input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true) - input[5] = null - input[6] = null - input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true) - input[8] = null - input[9] = null + input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true) + input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true) + input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true) + input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true) + input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true) + input[5] = null + input[6] = null + input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true) + input[8] = null + input[9] = null input[10] = file(params.pipelines_testdata_base_path + 'reference/rsem.tar.gz', checkIfExists: true) input[11] = file(params.pipelines_testdata_base_path + 'reference/salmon.tar.gz', checkIfExists: true) input[12] = null @@ -288,16 +288,16 @@ nextflow_workflow { skip_alignment = true skip_pseudo_alignment = false - input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true) - input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true) - input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true) - input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true) - input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true) - input[5] = null - input[6] = null - input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true) - input[8] = null - input[9] = null + input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true) + input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true) + input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true) + input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true) + input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true) + input[5] = null + input[6] = null + input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true) + input[8] = null + input[9] = null input[10] = file(params.pipelines_testdata_base_path + 'reference/rsem.tar.gz', checkIfExists: true) input[11] = file(params.pipelines_testdata_base_path + 'reference/salmon.tar.gz', checkIfExists: true) input[12] = null @@ -340,7 +340,7 @@ nextflow_workflow { } } - test("skip_psuedo_alignment") { + test("skip_pseudo_alignment") { when { workflow { @@ -355,16 +355,16 @@ nextflow_workflow { skip_alignment = false skip_pseudo_alignment = true - input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true) - input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true) - input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true) - input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true) - input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true) - input[5] = null - input[6] = null - input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true) - input[8] = null - input[9] = null + input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true) + input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true) + input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true) + input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true) + input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true) + input[5] = null + input[6] = null + input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true) + input[8] = null + input[9] = null input[10] = file(params.pipelines_testdata_base_path + 'reference/rsem.tar.gz', checkIfExists: true) input[11] = file(params.pipelines_testdata_base_path + 'reference/salmon.tar.gz', checkIfExists: true) input[12] = null @@ -556,11 +556,11 @@ nextflow_workflow { skip_alignment = false skip_pseudo_alignment = false - input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true) - input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true) - input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true) - input[3] = false - input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true) + input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true) + input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true) + input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true) + input[3] = false + input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true) input[5] = null input[6] = null input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true) @@ -623,11 +623,11 @@ nextflow_workflow { skip_alignment = false skip_pseudo_alignment = false - input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true) - input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true) - input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true) - input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true) - input[4] = false + input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true) + input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true) + input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true) + input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true) + input[4] = false input[5] = null input[6] = null input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true) @@ -690,16 +690,16 @@ nextflow_workflow { skip_alignment = false skip_pseudo_alignment = false - input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true) - input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true) - input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true) - input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true) - input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true) - input[5] = file(params.pipelines_testdata_base_path + 'reference/ngscheckmate.bed', checkIfExists: true) - input[6] = null - input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true) - input[8] = null - input[9] = null + input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true) + input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true) + input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true) + input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true) + input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true) + input[5] = file(params.pipelines_testdata_base_path + 'reference/ngscheckmate.bed', checkIfExists: true) + input[6] = null + input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true) + input[8] = null + input[9] = null input[10] = file(params.pipelines_testdata_base_path + 'reference/rsem.tar.gz', checkIfExists: true) input[11] = file(params.pipelines_testdata_base_path + 'reference/salmon.tar.gz', checkIfExists: true) input[12] = null @@ -877,6 +877,7 @@ nextflow_workflow { } test("hisat2_index = false") { + when { workflow { """ @@ -957,16 +958,16 @@ nextflow_workflow { skip_alignment = false skip_pseudo_alignment = false - input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true) - input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true) - input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true) - input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true) - input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true) - input[5] = null - input[6] = null - input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true) - input[8] = null - input[9] = null + input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true) + input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true) + input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true) + input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true) + input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true) + input[5] = null + input[6] = null + input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true) + input[8] = null + input[9] = null input[10] = file(params.pipelines_testdata_base_path + 'reference/rsem.tar.gz', checkIfExists: true) input[11] = file(params.pipelines_testdata_base_path + 'reference/salmon.tar.gz', checkIfExists: true) input[12] = null @@ -1024,16 +1025,16 @@ nextflow_workflow { skip_alignment = false skip_pseudo_alignment = false - input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true) - input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true) - input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true) - input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true) - input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true) - input[5] = null - input[6] = null - input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true) - input[8] = null - input[9] = null + input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true) + input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true) + input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true) + input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true) + input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true) + input[5] = null + input[6] = null + input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true) + input[8] = null + input[9] = null input[10] = file(params.pipelines_testdata_base_path + 'reference/rsem.tar.gz', checkIfExists: true) input[11] = file(params.pipelines_testdata_base_path + 'reference/salmon.tar.gz', checkIfExists: true) input[12] = null @@ -1091,16 +1092,16 @@ nextflow_workflow { skip_alignment = false skip_pseudo_alignment = false - input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true) - input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true) - input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true) - input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true) - input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true) - input[5] = null - input[6] = null - input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true) - input[8] = null - input[9] = null + input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true) + input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true) + input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true) + input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true) + input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true) + input[5] = null + input[6] = null + input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true) + input[8] = null + input[9] = null input[10] = file(params.pipelines_testdata_base_path + 'reference/rsem.tar.gz', checkIfExists: true) input[11] = file(params.pipelines_testdata_base_path + 'reference/salmon.tar.gz', checkIfExists: true) input[12] = null @@ -1158,16 +1159,16 @@ nextflow_workflow { skip_alignment = false skip_pseudo_alignment = false - input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true) - input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true) - input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true) - input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true) - input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true) - input[5] = null - input[6] = null - input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true) - input[8] = null - input[9] = null + input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true) + input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true) + input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true) + input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true) + input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true) + input[5] = null + input[6] = null + input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true) + input[8] = null + input[9] = null input[10] = file(params.pipelines_testdata_base_path + 'reference/rsem.tar.gz', checkIfExists: true) input[11] = file(params.pipelines_testdata_base_path + 'reference/salmon.tar.gz', checkIfExists: true) input[12] = null @@ -1225,16 +1226,16 @@ nextflow_workflow { skip_alignment = true skip_pseudo_alignment = false - input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true) - input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true) - input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true) - input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true) - input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true) - input[5] = null - input[6] = null - input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true) - input[8] = null - input[9] = null + input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true) + input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true) + input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true) + input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true) + input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true) + input[5] = null + input[6] = null + input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true) + input[8] = null + input[9] = null input[10] = file(params.pipelines_testdata_base_path + 'reference/rsem.tar.gz', checkIfExists: true) input[11] = file(params.pipelines_testdata_base_path + 'reference/salmon.tar.gz', checkIfExists: true) input[12] = null @@ -1292,16 +1293,16 @@ nextflow_workflow { skip_alignment = false skip_pseudo_alignment = true - input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true) - input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true) - input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true) - input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true) - input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true) - input[5] = null - input[6] = null - input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true) - input[8] = null - input[9] = null + input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true) + input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true) + input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true) + input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true) + input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true) + input[5] = null + input[6] = null + input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true) + input[8] = null + input[9] = null input[10] = file(params.pipelines_testdata_base_path + 'reference/rsem.tar.gz', checkIfExists: true) input[11] = file(params.pipelines_testdata_base_path + 'reference/salmon.tar.gz', checkIfExists: true) input[12] = null @@ -1344,4 +1345,1353 @@ nextflow_workflow { } } + test("default options - stub") { + + options "-stub" + + when { + workflow { + """ + gencode = false + featurecounts_group_type = 'gene_biotype' + aligner = 'star_salmon,star_rsem,hisat2' + pseudo_aligner = 'salmon,kallisto' + skip_gtf_filter = false + skip_bbsplit = false + skip_sortmerna = true + skip_alignment = false + skip_pseudo_alignment = false + + input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true) + input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true) + input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true) + input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true) + input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true) + input[5] = null + input[6] = null + input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true) + input[8] = null + input[9] = null + input[10] = file(params.pipelines_testdata_base_path + 'reference/rsem.tar.gz', checkIfExists: true) + input[11] = file(params.pipelines_testdata_base_path + 'reference/salmon.tar.gz', checkIfExists: true) + input[12] = null + input[13] = file(params.pipelines_testdata_base_path + 'reference/hisat2.tar.gz', checkIfExists: true) + input[14] = null + input[15] = null + input[16] = gencode + input[17] = featurecounts_group_type + input[18] = aligner + input[19] = pseudo_aligner + input[20] = skip_gtf_filter + input[21] = skip_bbsplit + input[22] = skip_sortmerna + input[23] = skip_alignment + input[24] = skip_pseudo_alignment + """ + } + } + + then { + assertAll( + { assert workflow.success}, + { assert snapshot( + workflow.out.chrom_sizes, + workflow.out.fai, + workflow.out.fasta, + workflow.out.gene_bed, + workflow.out.gtf, + workflow.out.hisat2_index, + workflow.out.kallisto_index, + workflow.out.rsem_index, + workflow.out.salmon_index, + workflow.out.sortmerna_index, + workflow.out.splicesites, + workflow.out.star_index, + workflow.out.transcript_fasta, + workflow.out.versions + ).match() } + ) + } + } + + test("gencode = false - stub") { + + options "-stub" + + when { + workflow { + """ + gencode = false + featurecounts_group_type = 'gene_biotype' + aligner = 'star_salmon,star_rsem,hisat2' + pseudo_aligner = 'salmon,kallisto' + skip_gtf_filter = false + skip_bbsplit = false + skip_sortmerna = true + skip_alignment = false + skip_pseudo_alignment = false + + input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true) + input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true) + input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true) + input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true) + input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true) + input[5] = null + input[6] = null + input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true) + input[8] = null + input[9] = null + input[10] = file(params.pipelines_testdata_base_path + 'reference/rsem.tar.gz', checkIfExists: true) + input[11] = file(params.pipelines_testdata_base_path + 'reference/salmon.tar.gz', checkIfExists: true) + input[12] = null + input[13] = file(params.pipelines_testdata_base_path + 'reference/hisat2.tar.gz', checkIfExists: true) + input[14] = null + input[15] = null + input[16] = gencode + input[17] = featurecounts_group_type + input[18] = aligner + input[19] = pseudo_aligner + input[20] = skip_gtf_filter + input[21] = skip_bbsplit + input[22] = skip_sortmerna + input[23] = skip_alignment + input[24] = skip_pseudo_alignment + """ + } + } + + then { + assertAll( + { assert workflow.success}, + { assert snapshot( + workflow.out.chrom_sizes, + workflow.out.fai, + workflow.out.fasta, + workflow.out.gene_bed, + workflow.out.gtf, + workflow.out.hisat2_index, + workflow.out.kallisto_index, + workflow.out.rsem_index, + workflow.out.salmon_index, + workflow.out.sortmerna_index, + workflow.out.splicesites, + workflow.out.star_index, + workflow.out.transcript_fasta, + workflow.out.versions + ).match() } + ) + } + } + + test("skip_gtf_filter - stub") { + + options "-stub" + + when { + workflow { + """ + gencode = false + featurecounts_group_type = 'gene_biotype' + aligner = 'star_salmon,star_rsem,hisat2' + pseudo_aligner = 'salmon,kallisto' + skip_gtf_filter = true + skip_bbsplit = false + skip_sortmerna = true + skip_alignment = false + skip_pseudo_alignment = false + + input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true) + input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true) + input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true) + input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true) + input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true) + input[5] = null + input[6] = null + input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true) + input[8] = null + input[9] = null + input[10] = file(params.pipelines_testdata_base_path + 'reference/rsem.tar.gz', checkIfExists: true) + input[11] = file(params.pipelines_testdata_base_path + 'reference/salmon.tar.gz', checkIfExists: true) + input[12] = null + input[13] = file(params.pipelines_testdata_base_path + 'reference/hisat2.tar.gz', checkIfExists: true) + input[14] = null + input[15] = null + input[16] = gencode + input[17] = featurecounts_group_type + input[18] = aligner + input[19] = pseudo_aligner + input[20] = skip_gtf_filter + input[21] = skip_bbsplit + input[22] = skip_sortmerna + input[23] = skip_alignment + input[24] = skip_pseudo_alignment + """ + } + } + + then { + assertAll( + { assert workflow.success}, + { assert snapshot( + workflow.out.chrom_sizes, + workflow.out.fai, + workflow.out.fasta, + workflow.out.gene_bed, + workflow.out.gtf, + workflow.out.hisat2_index, + workflow.out.kallisto_index, + workflow.out.rsem_index, + workflow.out.salmon_index, + workflow.out.sortmerna_index, + workflow.out.splicesites, + workflow.out.star_index, + workflow.out.transcript_fasta, + workflow.out.versions + ).match() } + ) + } + } + + test("skip_bbsplit - stub") { + + options "-stub" + + when { + workflow { + """ + gencode = false + featurecounts_group_type = 'gene_biotype' + aligner = 'star_salmon,star_rsem,hisat2' + pseudo_aligner = 'salmon,kallisto' + skip_gtf_filter = false + skip_bbsplit = true + skip_sortmerna = true + skip_alignment = false + skip_pseudo_alignment = false + + input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true) + input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true) + input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true) + input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true) + input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true) + input[5] = null + input[6] = null + input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true) + input[8] = null + input[9] = null + input[10] = file(params.pipelines_testdata_base_path + 'reference/rsem.tar.gz', checkIfExists: true) + input[11] = file(params.pipelines_testdata_base_path + 'reference/salmon.tar.gz', checkIfExists: true) + input[12] = null + input[13] = file(params.pipelines_testdata_base_path + 'reference/hisat2.tar.gz', checkIfExists: true) + input[14] = null + input[15] = null + input[16] = gencode + input[17] = featurecounts_group_type + input[18] = aligner + input[19] = pseudo_aligner + input[20] = skip_gtf_filter + input[21] = skip_bbsplit + input[22] = skip_sortmerna + input[23] = skip_alignment + input[24] = skip_pseudo_alignment + """ + } + } + + then { + assertAll( + { assert workflow.success}, + { assert snapshot(workflow.out).match() } + ) + } + } + + test("skip_alignment - stub") { + + options "-stub" + + when { + workflow { + """ + gencode = false + featurecounts_group_type = 'gene_biotype' + aligner = 'star_salmon,star_rsem,hisat2' + pseudo_aligner = 'salmon,kallisto' + skip_gtf_filter = false + skip_bbsplit = false + skip_sortmerna = true + skip_alignment = true + skip_pseudo_alignment = false + + input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true) + input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true) + input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true) + input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true) + input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true) + input[5] = null + input[6] = null + input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true) + input[8] = null + input[9] = null + input[10] = file(params.pipelines_testdata_base_path + 'reference/rsem.tar.gz', checkIfExists: true) + input[11] = file(params.pipelines_testdata_base_path + 'reference/salmon.tar.gz', checkIfExists: true) + input[12] = null + input[13] = file(params.pipelines_testdata_base_path + 'reference/hisat2.tar.gz', checkIfExists: true) + input[14] = null + input[15] = null + input[16] = gencode + input[17] = featurecounts_group_type + input[18] = aligner + input[19] = pseudo_aligner + input[20] = skip_gtf_filter + input[21] = skip_bbsplit + input[22] = skip_sortmerna + input[23] = skip_alignment + input[24] = skip_pseudo_alignment + """ + } + } + + then { + assertAll( + { assert workflow.success}, + { assert snapshot( + workflow.out.chrom_sizes, + workflow.out.fai, + workflow.out.fasta, + workflow.out.gene_bed, + workflow.out.gtf, + workflow.out.hisat2_index, + workflow.out.kallisto_index, + workflow.out.rsem_index, + workflow.out.salmon_index, + workflow.out.sortmerna_index, + workflow.out.splicesites, + workflow.out.star_index, + workflow.out.transcript_fasta, + workflow.out.versions + ).match() } + ) + } + } + + test("skip_pseudo_alignment - stub") { + + options "-stub" + + when { + workflow { + """ + gencode = false + featurecounts_group_type = 'gene_biotype' + aligner = 'star_salmon,star_rsem,hisat2' + pseudo_aligner = 'salmon,kallisto' + skip_gtf_filter = false + skip_bbsplit = false + skip_sortmerna = true + skip_alignment = false + skip_pseudo_alignment = true + + input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true) + input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true) + input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true) + input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true) + input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true) + input[5] = null + input[6] = null + input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true) + input[8] = null + input[9] = null + input[10] = file(params.pipelines_testdata_base_path + 'reference/rsem.tar.gz', checkIfExists: true) + input[11] = file(params.pipelines_testdata_base_path + 'reference/salmon.tar.gz', checkIfExists: true) + input[12] = null + input[13] = file(params.pipelines_testdata_base_path + 'reference/hisat2.tar.gz', checkIfExists: true) + input[14] = null + input[15] = null + input[16] = gencode + input[17] = featurecounts_group_type + input[18] = aligner + input[19] = pseudo_aligner + input[20] = skip_gtf_filter + input[21] = skip_bbsplit + input[22] = skip_sortmerna + input[23] = skip_alignment + input[24] = skip_pseudo_alignment + """ + } + } + + then { + assertAll( + { assert workflow.success}, + { assert snapshot( + workflow.out.chrom_sizes, + workflow.out.fai, + workflow.out.fasta, + workflow.out.gene_bed, + workflow.out.gtf, + workflow.out.hisat2_index, + workflow.out.kallisto_index, + workflow.out.rsem_index, + workflow.out.salmon_index, + workflow.out.sortmerna_index, + workflow.out.splicesites, + workflow.out.star_index, + workflow.out.transcript_fasta, + workflow.out.versions + ).match() } + ) + } + } + + test("gtf = false - stub") { + + options "-stub" + + when { + workflow { + """ + gencode = true + featurecounts_group_type = 'gene_biotype' + aligner = 'star_salmon,star_rsem,hisat2' + pseudo_aligner = 'salmon,kallisto' + skip_gtf_filter = false + skip_bbsplit = false + skip_sortmerna = true + skip_alignment = false + skip_pseudo_alignment = false + + input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true) + input[1] = false + input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true) + input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true) + input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true) + input[5] = null + input[6] = null + input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true) + input[8] = null + input[9] = null + input[10] = file(params.pipelines_testdata_base_path + 'reference/rsem.tar.gz', checkIfExists: true) + input[11] = file(params.pipelines_testdata_base_path + 'reference/salmon.tar.gz', checkIfExists: true) + input[12] = null + input[13] = file(params.pipelines_testdata_base_path + 'reference/hisat2.tar.gz', checkIfExists: true) + input[14] = null + input[15] = null + input[16] = gencode + input[17] = featurecounts_group_type + input[18] = aligner + input[19] = pseudo_aligner + input[20] = skip_gtf_filter + input[21] = skip_bbsplit + input[22] = skip_sortmerna + input[23] = skip_alignment + input[24] = skip_pseudo_alignment + """ + } + } + + then { + assertAll( + { assert workflow.success}, + { assert snapshot( + workflow.out.chrom_sizes, + workflow.out.fai, + workflow.out.fasta, + workflow.out.gene_bed, + workflow.out.gtf, + workflow.out.hisat2_index, + workflow.out.kallisto_index, + workflow.out.rsem_index, + workflow.out.salmon_index, + workflow.out.sortmerna_index, + workflow.out.splicesites, + workflow.out.star_index, + workflow.out.transcript_fasta, + workflow.out.versions + ).match() } + ) + } + } + + test("gff = false - stub") { + + options "-stub" + + when { + workflow { + """ + gencode = false + featurecounts_group_type = 'gene_biotype' + aligner = 'star_salmon,star_rsem,hisat2' + pseudo_aligner = 'salmon,kallisto' + skip_gtf_filter = false + skip_bbsplit = false + skip_sortmerna = true + skip_alignment = false + skip_pseudo_alignment = false + + input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true) + input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true) + input[2] = false + input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true) + input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true) + input[5] = null + input[6] = null + input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true) + input[8] = null + input[9] = null + input[10] = file(params.pipelines_testdata_base_path + 'reference/rsem.tar.gz', checkIfExists: true) + input[11] = file(params.pipelines_testdata_base_path + 'reference/salmon.tar.gz', checkIfExists: true) + input[12] = null + input[13] = file(params.pipelines_testdata_base_path + 'reference/hisat2.tar.gz', checkIfExists: true) + input[14] = null + input[15] = null + input[16] = gencode + input[17] = featurecounts_group_type + input[18] = aligner + input[19] = pseudo_aligner + input[20] = skip_gtf_filter + input[21] = skip_bbsplit + input[22] = skip_sortmerna + input[23] = skip_alignment + input[24] = skip_pseudo_alignment + """ + } + } + + then { + assertAll( + { assert workflow.success}, + { assert snapshot( + workflow.out.chrom_sizes, + workflow.out.fai, + workflow.out.fasta, + workflow.out.gene_bed, + workflow.out.gtf, + workflow.out.hisat2_index, + workflow.out.kallisto_index, + workflow.out.rsem_index, + workflow.out.salmon_index, + workflow.out.sortmerna_index, + workflow.out.splicesites, + workflow.out.star_index, + workflow.out.transcript_fasta, + workflow.out.versions + ).match() } + ) + } + } + + test("gfp = false - stub") { + + options "-stub" + + when { + workflow { + """ + gencode = false + featurecounts_group_type = 'gene_biotype' + aligner = 'star_salmon,star_rsem,hisat2' + pseudo_aligner = 'salmon,kallisto' + skip_gtf_filter = false + skip_bbsplit = false + skip_sortmerna = true + skip_alignment = false + skip_pseudo_alignment = false + + input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true) + input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true) + input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true) + input[3] = false + input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true) + input[5] = null + input[6] = null + input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true) + input[8] = null + input[9] = null + input[10] = file(params.pipelines_testdata_base_path + 'reference/rsem.tar.gz', checkIfExists: true) + input[11] = file(params.pipelines_testdata_base_path + 'reference/salmon.tar.gz', checkIfExists: true) + input[12] = null + input[13] = file(params.pipelines_testdata_base_path + 'reference/hisat2.tar.gz', checkIfExists: true) + input[14] = null + input[15] = null + input[16] = gencode + input[17] = featurecounts_group_type + input[18] = aligner + input[19] = pseudo_aligner + input[20] = skip_gtf_filter + input[21] = skip_bbsplit + input[22] = skip_sortmerna + input[23] = skip_alignment + input[24] = skip_pseudo_alignment + """ + } + } + + then { + assertAll( + { assert workflow.success}, + { assert snapshot( + workflow.out.chrom_sizes, + workflow.out.fai, + workflow.out.fasta, + workflow.out.gene_bed, + workflow.out.gtf, + workflow.out.hisat2_index, + workflow.out.kallisto_index, + workflow.out.rsem_index, + workflow.out.salmon_index, + workflow.out.sortmerna_index, + workflow.out.splicesites, + workflow.out.star_index, + workflow.out.transcript_fasta, + workflow.out.versions + ).match() } + ) + } + } + + test("transcriptome = false - stub") { + + options "-stub" + + when { + workflow { + """ + gencode = false + featurecounts_group_type = 'gene_biotype' + aligner = 'star_salmon,star_rsem,hisat2' + pseudo_aligner = 'salmon,kallisto' + skip_gtf_filter = false + skip_bbsplit = false + skip_sortmerna = true + skip_alignment = false + skip_pseudo_alignment = false + + input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true) + input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true) + input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true) + input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true) + input[4] = false + input[5] = null + input[6] = null + input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true) + input[8] = null + input[9] = null + input[10] = file(params.pipelines_testdata_base_path + 'reference/rsem.tar.gz', checkIfExists: true) + input[11] = file(params.pipelines_testdata_base_path + 'reference/salmon.tar.gz', checkIfExists: true) + input[12] = null + input[13] = file(params.pipelines_testdata_base_path + 'reference/hisat2.tar.gz', checkIfExists: true) + input[14] = null + input[15] = null + input[16] = gencode + input[17] = featurecounts_group_type + input[18] = aligner + input[19] = pseudo_aligner + input[20] = skip_gtf_filter + input[21] = skip_bbsplit + input[22] = skip_sortmerna + input[23] = skip_alignment + input[24] = skip_pseudo_alignment + """ + } + } + + then { + assertAll( + { assert workflow.success}, + { assert snapshot( + workflow.out.chrom_sizes, + workflow.out.fai, + workflow.out.fasta, + workflow.out.gene_bed, + workflow.out.gtf, + workflow.out.hisat2_index, + workflow.out.kallisto_index, + workflow.out.rsem_index, + workflow.out.salmon_index, + workflow.out.sortmerna_index, + workflow.out.splicesites, + workflow.out.star_index, + workflow.out.transcript_fasta, + workflow.out.versions + ).match() } + ) + } + } + + test("with bed - stub") { + + options "-stub" + + when { + workflow { + """ + gencode = false + featurecounts_group_type = 'gene_biotype' + aligner = 'star_salmon,star_rsem,hisat2' + pseudo_aligner = 'salmon,kallisto' + skip_gtf_filter = false + skip_bbsplit = false + skip_sortmerna = true + skip_alignment = false + skip_pseudo_alignment = false + + input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true) + input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true) + input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true) + input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true) + input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true) + input[5] = file(params.pipelines_testdata_base_path + 'reference/ngscheckmate.bed', checkIfExists: true) + input[6] = null + input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true) + input[8] = null + input[9] = null + input[10] = file(params.pipelines_testdata_base_path + 'reference/rsem.tar.gz', checkIfExists: true) + input[11] = file(params.pipelines_testdata_base_path + 'reference/salmon.tar.gz', checkIfExists: true) + input[12] = null + input[13] = file(params.pipelines_testdata_base_path + 'reference/hisat2.tar.gz', checkIfExists: true) + input[14] = null + input[15] = null + input[16] = gencode + input[17] = featurecounts_group_type + input[18] = aligner + input[19] = pseudo_aligner + input[20] = skip_gtf_filter + input[21] = skip_bbsplit + input[22] = skip_sortmerna + input[23] = skip_alignment + input[24] = skip_pseudo_alignment + """ + } + } + + then { + assertAll( + { assert workflow.success}, + { assert snapshot( + workflow.out.chrom_sizes, + workflow.out.fai, + workflow.out.fasta, + workflow.out.gene_bed, + workflow.out.gtf, + workflow.out.hisat2_index, + workflow.out.kallisto_index, + workflow.out.rsem_index, + workflow.out.salmon_index, + workflow.out.sortmerna_index, + workflow.out.splicesites, + workflow.out.star_index, + workflow.out.transcript_fasta, + workflow.out.versions + ).match() } + ) + } + } + + test("rsem_index = false - stub") { + + options "-stub" + + when { + workflow { + """ + gencode = false + featurecounts_group_type = 'gene_biotype' + aligner = 'star_salmon,star_rsem,hisat2' + pseudo_aligner = 'salmon,kallisto' + skip_gtf_filter = false + skip_bbsplit = false + skip_sortmerna = true + skip_alignment = false + skip_pseudo_alignment = false + + input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true) + input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true) + input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true) + input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true) + input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true) + input[5] = null + input[6] = null + input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true) + input[8] = null + input[9] = null + input[10] = false + input[11] = file(params.pipelines_testdata_base_path + 'reference/salmon.tar.gz', checkIfExists: true) + input[12] = null + input[13] = file(params.pipelines_testdata_base_path + 'reference/hisat2.tar.gz', checkIfExists: true) + input[14] = null + input[15] = null + input[16] = gencode + input[17] = featurecounts_group_type + input[18] = aligner + input[19] = pseudo_aligner + input[20] = skip_gtf_filter + input[21] = skip_bbsplit + input[22] = skip_sortmerna + input[23] = skip_alignment + input[24] = skip_pseudo_alignment + """ + } + } + + then { + assertAll( + { assert workflow.success}, + { assert snapshot( + workflow.out.chrom_sizes, + workflow.out.fai, + workflow.out.fasta, + workflow.out.gene_bed, + workflow.out.gtf, + workflow.out.hisat2_index, + workflow.out.kallisto_index, + workflow.out.rsem_index, + workflow.out.salmon_index, + workflow.out.sortmerna_index, + workflow.out.splicesites, + workflow.out.star_index, + workflow.out.transcript_fasta, + workflow.out.versions + ).match() } + ) + } + } + + test("salmon_index = false - stub") { + + options "-stub" + + when { + workflow { + """ + gencode = false + featurecounts_group_type = 'gene_biotype' + aligner = 'star_salmon,star_rsem,hisat2' + pseudo_aligner = 'salmon,kallisto' + skip_gtf_filter = false + skip_bbsplit = false + skip_sortmerna = true + skip_alignment = false + skip_pseudo_alignment = false + + input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true) + input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true) + input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true) + input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true) + input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true) + input[5] = null + input[6] = null + input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true) + input[8] = null + input[9] = null + input[10] = file(params.pipelines_testdata_base_path + 'reference/rsem.tar.gz', checkIfExists: true) + input[11] = false + input[12] = null + input[13] = file(params.pipelines_testdata_base_path + 'reference/hisat2.tar.gz', checkIfExists: true) + input[14] = null + input[15] = null + input[16] = gencode + input[17] = featurecounts_group_type + input[18] = aligner + input[19] = pseudo_aligner + input[20] = skip_gtf_filter + input[21] = skip_bbsplit + input[22] = skip_sortmerna + input[23] = skip_alignment + input[24] = skip_pseudo_alignment + """ + } + } + + then { + assertAll( + { assert workflow.success}, + { assert snapshot( + workflow.out.chrom_sizes, + workflow.out.fai, + workflow.out.fasta, + workflow.out.gene_bed, + workflow.out.gtf, + workflow.out.hisat2_index, + workflow.out.kallisto_index, + workflow.out.rsem_index, + workflow.out.salmon_index, + workflow.out.sortmerna_index, + workflow.out.splicesites, + workflow.out.star_index, + workflow.out.transcript_fasta, + workflow.out.versions + ).match() } + ) + } + } + + test("hisat2_index = false - stub") { + + options "-stub" + + when { + workflow { + """ + gencode = false + featurecounts_group_type = 'gene_biotype' + aligner = 'star_salmon,star_rsem,hisat2' + pseudo_aligner = 'salmon,kallisto' + skip_gtf_filter = false + skip_bbsplit = false + skip_sortmerna = true + skip_alignment = false + skip_pseudo_alignment = false + + input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true) + input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true) + input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true) + input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true) + input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true) + input[5] = null + input[6] = null + input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true) + input[8] = null + input[9] = null + input[10] = file(params.pipelines_testdata_base_path + 'reference/rsem.tar.gz', checkIfExists: true) + input[11] = false + input[12] = null + input[13] = false + input[14] = null + input[15] = null + input[16] = gencode + input[17] = featurecounts_group_type + input[18] = aligner + input[19] = pseudo_aligner + input[20] = skip_gtf_filter + input[21] = skip_bbsplit + input[22] = skip_sortmerna + input[23] = skip_alignment + input[24] = skip_pseudo_alignment + """ + } + } + + then { + assertAll( + { assert workflow.success}, + { assert snapshot( + workflow.out.chrom_sizes, + workflow.out.fai, + workflow.out.fasta, + workflow.out.gene_bed, + workflow.out.gtf, + workflow.out.hisat2_index, + workflow.out.kallisto_index, + workflow.out.rsem_index, + workflow.out.salmon_index, + workflow.out.sortmerna_index, + workflow.out.splicesites, + workflow.out.star_index, + workflow.out.transcript_fasta, + workflow.out.versions + ).match() } + ) + } + } + + test("gencode = true - stub") { + + options "-stub" + + when { + workflow { + """ + gencode = true + featurecounts_group_type = 'gene_biotype' + aligner = 'star_salmon,star_rsem,hisat2' + pseudo_aligner = 'salmon,kallisto' + skip_gtf_filter = false + skip_bbsplit = false + skip_sortmerna = true + skip_alignment = false + skip_pseudo_alignment = false + + input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true) + input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true) + input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true) + input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true) + input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true) + input[5] = null + input[6] = null + input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true) + input[8] = null + input[9] = null + input[10] = file(params.pipelines_testdata_base_path + 'reference/rsem.tar.gz', checkIfExists: true) + input[11] = file(params.pipelines_testdata_base_path + 'reference/salmon.tar.gz', checkIfExists: true) + input[12] = null + input[13] = file(params.pipelines_testdata_base_path + 'reference/hisat2.tar.gz', checkIfExists: true) + input[14] = null + input[15] = null + input[16] = gencode + input[17] = featurecounts_group_type + input[18] = aligner + input[19] = pseudo_aligner + input[20] = skip_gtf_filter + input[21] = skip_bbsplit + input[22] = skip_sortmerna + input[23] = skip_alignment + input[24] = skip_pseudo_alignment + """ + } + } + + then { + assertAll( + { assert workflow.success}, + { assert snapshot( + workflow.out.chrom_sizes, + workflow.out.fai, + workflow.out.fasta, + workflow.out.gene_bed, + workflow.out.gtf, + workflow.out.hisat2_index, + workflow.out.kallisto_index, + workflow.out.rsem_index, + workflow.out.salmon_index, + workflow.out.sortmerna_index, + workflow.out.splicesites, + workflow.out.star_index, + workflow.out.transcript_fasta, + workflow.out.versions + ).match() } + ) + } + } + + test("featurecounts_group_type = 'gene_type' - stub") { + + options "-stub" + + when { + workflow { + """ + gencode = false + featurecounts_group_type = 'gene_type' + aligner = 'star_salmon,star_rsem,hisat2' + pseudo_aligner = 'salmon,kallisto' + skip_gtf_filter = false + skip_bbsplit = false + skip_sortmerna = true + skip_alignment = false + skip_pseudo_alignment = false + + input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true) + input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true) + input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true) + input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true) + input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true) + input[5] = null + input[6] = null + input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true) + input[8] = null + input[9] = null + input[10] = file(params.pipelines_testdata_base_path + 'reference/rsem.tar.gz', checkIfExists: true) + input[11] = file(params.pipelines_testdata_base_path + 'reference/salmon.tar.gz', checkIfExists: true) + input[12] = null + input[13] = file(params.pipelines_testdata_base_path + 'reference/hisat2.tar.gz', checkIfExists: true) + input[14] = null + input[15] = null + input[16] = gencode + input[17] = featurecounts_group_type + input[18] = aligner + input[19] = pseudo_aligner + input[20] = skip_gtf_filter + input[21] = skip_bbsplit + input[22] = skip_sortmerna + input[23] = skip_alignment + input[24] = skip_pseudo_alignment + """ + } + } + + then { + assertAll( + { assert workflow.success}, + { assert snapshot( + workflow.out.chrom_sizes, + workflow.out.fai, + workflow.out.fasta, + workflow.out.gene_bed, + workflow.out.gtf, + workflow.out.hisat2_index, + workflow.out.kallisto_index, + workflow.out.rsem_index, + workflow.out.salmon_index, + workflow.out.sortmerna_index, + workflow.out.splicesites, + workflow.out.star_index, + workflow.out.transcript_fasta, + workflow.out.versions + ).match() } + ) + } + } + + test("skip_gtf_filter = true - stub") { + + options "-stub" + + when { + workflow { + """ + gencode = false + featurecounts_group_type = 'gene_biotype' + aligner = 'star_salmon,star_rsem,hisat2' + pseudo_aligner = 'salmon,kallisto' + skip_gtf_filter = true + skip_bbsplit = false + skip_sortmerna = true + skip_alignment = false + skip_pseudo_alignment = false + + input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true) + input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true) + input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true) + input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true) + input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true) + input[5] = null + input[6] = null + input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true) + input[8] = null + input[9] = null + input[10] = file(params.pipelines_testdata_base_path + 'reference/rsem.tar.gz', checkIfExists: true) + input[11] = file(params.pipelines_testdata_base_path + 'reference/salmon.tar.gz', checkIfExists: true) + input[12] = null + input[13] = file(params.pipelines_testdata_base_path + 'reference/hisat2.tar.gz', checkIfExists: true) + input[14] = null + input[15] = null + input[16] = gencode + input[17] = featurecounts_group_type + input[18] = aligner + input[19] = pseudo_aligner + input[20] = skip_gtf_filter + input[21] = skip_bbsplit + input[22] = skip_sortmerna + input[23] = skip_alignment + input[24] = skip_pseudo_alignment + """ + } + } + + then { + assertAll( + { assert workflow.success}, + { assert snapshot( + workflow.out.chrom_sizes, + workflow.out.fai, + workflow.out.fasta, + workflow.out.gene_bed, + workflow.out.gtf, + workflow.out.hisat2_index, + workflow.out.kallisto_index, + workflow.out.rsem_index, + workflow.out.salmon_index, + workflow.out.sortmerna_index, + workflow.out.splicesites, + workflow.out.star_index, + workflow.out.transcript_fasta, + workflow.out.versions + ).match() } + ) + } + } + + test("skip_bbsplit = true - stub") { + + options "-stub" + + when { + workflow { + """ + gencode = false + featurecounts_group_type = 'gene_biotype' + aligner = 'star_salmon,star_rsem,hisat2' + pseudo_aligner = 'salmon,kallisto' + skip_gtf_filter = false + skip_bbsplit = true + skip_sortmerna = true + skip_alignment = false + skip_pseudo_alignment = false + + input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true) + input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true) + input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true) + input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true) + input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true) + input[5] = null + input[6] = null + input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true) + input[8] = null + input[9] = null + input[10] = file(params.pipelines_testdata_base_path + 'reference/rsem.tar.gz', checkIfExists: true) + input[11] = file(params.pipelines_testdata_base_path + 'reference/salmon.tar.gz', checkIfExists: true) + input[12] = null + input[13] = file(params.pipelines_testdata_base_path + 'reference/hisat2.tar.gz', checkIfExists: true) + input[14] = null + input[15] = null + input[16] = gencode + input[17] = featurecounts_group_type + input[18] = aligner + input[19] = pseudo_aligner + input[20] = skip_gtf_filter + input[21] = skip_bbsplit + input[22] = skip_sortmerna + input[23] = skip_alignment + input[24] = skip_pseudo_alignment + """ + } + } + + then { + assertAll( + { assert workflow.success}, + { assert snapshot(workflow.out).match() } + ) + } + } + + test("skip_alignment = true - stub") { + + options "-stub" + + when { + workflow { + """ + gencode = false + featurecounts_group_type = 'gene_biotype' + aligner = 'star_salmon,star_rsem,hisat2' + pseudo_aligner = 'salmon,kallisto' + skip_gtf_filter = false + skip_bbsplit = false + skip_sortmerna = true + skip_alignment = true + skip_pseudo_alignment = false + + input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true) + input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true) + input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true) + input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true) + input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true) + input[5] = null + input[6] = null + input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true) + input[8] = null + input[9] = null + input[10] = file(params.pipelines_testdata_base_path + 'reference/rsem.tar.gz', checkIfExists: true) + input[11] = file(params.pipelines_testdata_base_path + 'reference/salmon.tar.gz', checkIfExists: true) + input[12] = null + input[13] = file(params.pipelines_testdata_base_path + 'reference/hisat2.tar.gz', checkIfExists: true) + input[14] = null + input[15] = null + input[16] = gencode + input[17] = featurecounts_group_type + input[18] = aligner + input[19] = pseudo_aligner + input[20] = skip_gtf_filter + input[21] = skip_bbsplit + input[22] = skip_sortmerna + input[23] = skip_alignment + input[24] = skip_pseudo_alignment + """ + } + } + + then { + assertAll( + { assert workflow.success}, + { assert snapshot( + workflow.out.chrom_sizes, + workflow.out.fai, + workflow.out.fasta, + workflow.out.gene_bed, + workflow.out.gtf, + workflow.out.hisat2_index, + workflow.out.kallisto_index, + workflow.out.rsem_index, + workflow.out.salmon_index, + workflow.out.sortmerna_index, + workflow.out.splicesites, + workflow.out.star_index, + workflow.out.transcript_fasta, + workflow.out.versions + ).match() } + ) + } + } + + test("skip_pseudoalignment = true - stub") { + + options "-stub" + + when { + workflow { + """ + gencode = false + featurecounts_group_type = 'gene_biotype' + aligner = 'star_salmon,star_rsem,hisat2' + pseudo_aligner = 'salmon,kallisto' + skip_gtf_filter = false + skip_bbsplit = false + skip_sortmerna = true + skip_alignment = false + skip_pseudo_alignment = true + + input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true) + input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true) + input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true) + input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true) + input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true) + input[5] = null + input[6] = null + input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true) + input[8] = null + input[9] = null + input[10] = file(params.pipelines_testdata_base_path + 'reference/rsem.tar.gz', checkIfExists: true) + input[11] = file(params.pipelines_testdata_base_path + 'reference/salmon.tar.gz', checkIfExists: true) + input[12] = null + input[13] = file(params.pipelines_testdata_base_path + 'reference/hisat2.tar.gz', checkIfExists: true) + input[14] = null + input[15] = null + input[16] = gencode + input[17] = featurecounts_group_type + input[18] = aligner + input[19] = pseudo_aligner + input[20] = skip_gtf_filter + input[21] = skip_bbsplit + input[22] = skip_sortmerna + input[23] = skip_alignment + input[24] = skip_pseudo_alignment + """ + } + } + + then { + assertAll( + { assert workflow.success}, + { assert snapshot( + workflow.out.chrom_sizes, + workflow.out.fai, + workflow.out.fasta, + workflow.out.gene_bed, + workflow.out.gtf, + workflow.out.hisat2_index, + workflow.out.kallisto_index, + workflow.out.rsem_index, + workflow.out.salmon_index, + workflow.out.sortmerna_index, + workflow.out.splicesites, + workflow.out.star_index, + workflow.out.transcript_fasta, + workflow.out.versions + ).match() } + ) + } + } } diff --git a/subworkflows/local/prepare_genome/tests/main.nf.test.snap b/subworkflows/local/prepare_genome/tests/main.nf.test.snap index 2741bb23d..88d78c211 100644 --- a/subworkflows/local/prepare_genome/tests/main.nf.test.snap +++ b/subworkflows/local/prepare_genome/tests/main.nf.test.snap @@ -1,8 +1,1054 @@ { - "gencode = true": { + "skip_gtf_filter = true - stub": { + "content": [ + [ + "genome_transcriptome.fasta.sizes:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + [ + "genome_transcriptome.fasta.fai:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + [ + "genome_transcriptome.fasta:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + [ + "genome_transcriptome.bed:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + [ + "genome_transcriptome.gtf:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + [ + + ], + [ + + ], + [ + + ], + [ + "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/salmon.tar.gz" + ], + [ + + ], + [ + + ], + [ + + ], + [ + "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/transcriptome.fasta" + ], + [ + "versions.yml:md5,0bc25597acf1d50abf7070d19d311cd7", + "versions.yml:md5,71252f1a221be05593361acccb99506b", + "versions.yml:md5,bc99889446f02427c166b3219b793672", + "versions.yml:md5,cc8f32b7c37c35a075d38cb773004eaa" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-07-04T17:03:34.032908" + }, + "skip_pseudo_alignment - stub": { + "content": [ + [ + "genome_transcriptome.fasta.sizes:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + [ + "genome_transcriptome.fasta.fai:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + [ + "genome_transcriptome.fasta:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + [ + "genome_transcriptome.bed:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + [ + "genome_transcriptome.gtf:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + [ + + ], + [ + + ], + [ + + ], + [ + "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/salmon.tar.gz" + ], + [ + + ], + [ + + ], + [ + + ], + [ + "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/transcriptome.fasta" + ], + [ + "versions.yml:md5,0bc25597acf1d50abf7070d19d311cd7", + "versions.yml:md5,71252f1a221be05593361acccb99506b", + "versions.yml:md5,80e9dd350be8cd4c11909d75c914757a", + "versions.yml:md5,bc99889446f02427c166b3219b793672", + "versions.yml:md5,cc8f32b7c37c35a075d38cb773004eaa" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-07-04T16:59:05.328944" + }, + "skip_gtf_filter": { + "content": [ + [ + "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/transcriptome.fasta" + ], + [ + "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/salmon.tar.gz" + ], + [ + "genome_gfp.fasta:md5,e23e302af63736a199985a169fdac055" + ], + [ + "genome_gfp.gtf:md5,5e63cda3dcafc0d6ad0a738133af9d54" + ], + [ + "genome_gfp.fasta.fai:md5,8fa54c6bd2ea6a369efbb8ab4f30156a" + ], + [ + "genome_gfp.bed:md5,991993ebef1def1d5823632c21177ec3" + ], + [ + "genome_gfp.fasta.sizes:md5,9b755f8f349b14accefb4d859f84de26" + ], + [ + + ], + [ + + ], + [ + + ], + [ + + ], + [ + + ], + [ + + ], + [ + "versions.yml:md5,0bc25597acf1d50abf7070d19d311cd7", + "versions.yml:md5,1cd265cb86a23a27f683ffb2459f37f5", + "versions.yml:md5,71252f1a221be05593361acccb99506b", + "versions.yml:md5,bc99889446f02427c166b3219b793672" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-07-03T19:15:45.003106" + }, + "gencode = false - stub": { + "content": [ + [ + "genome_transcriptome.fasta.sizes:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + [ + "genome_transcriptome.fasta.fai:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + [ + "genome_transcriptome.fasta:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + [ + "genome_transcriptome.bed:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + [ + "genome_transcriptome.gtf:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + [ + + ], + [ + + ], + [ + + ], + [ + "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/salmon.tar.gz" + ], + [ + + ], + [ + + ], + [ + + ], + [ + "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/transcriptome.fasta" + ], + [ + "versions.yml:md5,0bc25597acf1d50abf7070d19d311cd7", + "versions.yml:md5,71252f1a221be05593361acccb99506b", + "versions.yml:md5,80e9dd350be8cd4c11909d75c914757a", + "versions.yml:md5,bc99889446f02427c166b3219b793672", + "versions.yml:md5,cc8f32b7c37c35a075d38cb773004eaa" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-07-04T16:57:20.218814" + }, + "gff = false - stub": { + "content": [ + [ + "genome_transcriptome.fasta.sizes:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + [ + "genome_transcriptome.fasta.fai:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + [ + "genome_transcriptome.fasta:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + [ + "genome_transcriptome.bed:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + [ + "genome_transcriptome.gtf:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + [ + + ], + [ + + ], + [ + + ], + [ + "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/salmon.tar.gz" + ], + [ + + ], + [ + + ], + [ + + ], + [ + "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/transcriptome.fasta" + ], + [ + "versions.yml:md5,0bc25597acf1d50abf7070d19d311cd7", + "versions.yml:md5,71252f1a221be05593361acccb99506b", + "versions.yml:md5,80e9dd350be8cd4c11909d75c914757a", + "versions.yml:md5,bc99889446f02427c166b3219b793672", + "versions.yml:md5,cc8f32b7c37c35a075d38cb773004eaa" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-07-04T16:59:55.589832" + }, + "skip_pseudoalignment = true - stub": { + "content": [ + [ + "genome_transcriptome.fasta.sizes:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + [ + "genome_transcriptome.fasta.fai:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + [ + "genome_transcriptome.fasta:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + [ + "genome_transcriptome.bed:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + [ + "genome_transcriptome.gtf:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + [ + + ], + [ + + ], + [ + + ], + [ + "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/salmon.tar.gz" + ], + [ + + ], + [ + + ], + [ + + ], + [ + "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/transcriptome.fasta" + ], + [ + "versions.yml:md5,0bc25597acf1d50abf7070d19d311cd7", + "versions.yml:md5,71252f1a221be05593361acccb99506b", + "versions.yml:md5,80e9dd350be8cd4c11909d75c914757a", + "versions.yml:md5,bc99889446f02427c166b3219b793672", + "versions.yml:md5,cc8f32b7c37c35a075d38cb773004eaa" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-07-04T17:04:46.509423" + }, + "featurecounts_group_type = 'gene_type' - stub": { + "content": [ + [ + "genome_transcriptome.fasta.sizes:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + [ + "genome_transcriptome.fasta.fai:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + [ + "genome_transcriptome.fasta:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + [ + "genome_transcriptome.bed:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + [ + "genome_transcriptome.gtf:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + [ + + ], + [ + + ], + [ + + ], + [ + "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/salmon.tar.gz" + ], + [ + + ], + [ + + ], + [ + + ], + [ + "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/transcriptome.fasta" + ], + [ + "versions.yml:md5,0bc25597acf1d50abf7070d19d311cd7", + "versions.yml:md5,71252f1a221be05593361acccb99506b", + "versions.yml:md5,80e9dd350be8cd4c11909d75c914757a", + "versions.yml:md5,bc99889446f02427c166b3219b793672", + "versions.yml:md5,cc8f32b7c37c35a075d38cb773004eaa" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-07-04T17:03:09.069637" + }, + "gtf = false": { + "content": [ + [ + "transcriptome.fixed.fa:md5,faf3a64453ae73983bbf2743387fbdf2" + ], + [ + "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/salmon.tar.gz" + ], + [ + "genome_gfp.fasta:md5,e23e302af63736a199985a169fdac055" + ], + [ + "genome_gfp.gtf:md5,68b68c059ba170af3f9d0a5dc1e0c8b8" + ], + [ + "genome_gfp.fasta.fai:md5,8fa54c6bd2ea6a369efbb8ab4f30156a" + ], + [ + "genome_gfp.bed:md5,991993ebef1def1d5823632c21177ec3" + ], + [ + "genome_gfp.fasta.sizes:md5,9b755f8f349b14accefb4d859f84de26" + ], + [ + + ], + [ + + ], + [ + + ], + [ + + ], + [ + + ], + [ + + ], + [ + "versions.yml:md5,0bc25597acf1d50abf7070d19d311cd7", + "versions.yml:md5,1cd265cb86a23a27f683ffb2459f37f5", + "versions.yml:md5,2a3ed31ad34b8864fb9278dcdef596ec", + "versions.yml:md5,71252f1a221be05593361acccb99506b", + "versions.yml:md5,80e9dd350be8cd4c11909d75c914757a", + "versions.yml:md5,961ab91198c4e6ec9d795b95e3f61fda", + "versions.yml:md5,bc99889446f02427c166b3219b793672" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-07-03T19:17:19.742633" + }, + "gfp = false": { + "content": [ + [ + "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/transcriptome.fasta" + ], + [ + "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/salmon.tar.gz" + ], + [ + "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/genome.fasta" + ], + [ + "genome.filtered.gtf:md5,ef6fccd153a21c329670462d602ed2d0" + ], + [ + "genome.fasta.fai:md5,2cd76d936cbfa386b14154506c2041b2" + ], + [ + "genome.filtered.bed:md5,e507dc33673e76c32abe344f4dc07952" + ], + [ + "genome.fasta.sizes:md5,29218009212157c49dbc6596621ec780" + ], + [ + + ], + [ + + ], + [ + + ], + [ + + ], + [ + + ], + [ + + ], + [ + "versions.yml:md5,0bc25597acf1d50abf7070d19d311cd7", + "versions.yml:md5,71252f1a221be05593361acccb99506b", + "versions.yml:md5,80e9dd350be8cd4c11909d75c914757a", + "versions.yml:md5,bc99889446f02427c166b3219b793672" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-07-03T19:18:06.890333" + }, + "skip_bbsplit = true": { + "content": [ + [ + "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/transcriptome.fasta" + ], + [ + "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/salmon.tar.gz" + ], + [ + "genome_gfp.fasta:md5,e23e302af63736a199985a169fdac055" + ], + [ + "genome_gfp.gtf:md5,c98b12c302f15731bfc36bcf297cfe28" + ], + [ + "genome_gfp.fasta.fai:md5,8fa54c6bd2ea6a369efbb8ab4f30156a" + ], + [ + "genome_gfp.bed:md5,991993ebef1def1d5823632c21177ec3" + ], + [ + "genome_gfp.fasta.sizes:md5,9b755f8f349b14accefb4d859f84de26" + ], + [ + + ], + [ + + ], + [ + + ], + [ + + ], + [ + + ], + [ + + ], + [ + "versions.yml:md5,1cd265cb86a23a27f683ffb2459f37f5", + "versions.yml:md5,71252f1a221be05593361acccb99506b", + "versions.yml:md5,80e9dd350be8cd4c11909d75c914757a", + "versions.yml:md5,bc99889446f02427c166b3219b793672" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-07-03T19:21:45.41666" + }, + "salmon_index = false - stub": { + "content": [ + [ + "genome_transcriptome.fasta.sizes:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + [ + "genome_transcriptome.fasta.fai:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + [ + "genome_transcriptome.fasta:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + [ + "genome_transcriptome.bed:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + [ + "genome_transcriptome.gtf:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + [ + + ], + [ + + ], + [ + + ], + [ + + ], + [ + + ], + [ + + ], + [ + + ], + [ + "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/transcriptome.fasta" + ], + [ + "versions.yml:md5,0bc25597acf1d50abf7070d19d311cd7", + "versions.yml:md5,71252f1a221be05593361acccb99506b", + "versions.yml:md5,80e9dd350be8cd4c11909d75c914757a", + "versions.yml:md5,bc99889446f02427c166b3219b793672", + "versions.yml:md5,cc8f32b7c37c35a075d38cb773004eaa" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-07-04T17:01:54.475669" + }, + "skip_alignment": { + "content": [ + [ + "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/transcriptome.fasta" + ], + [ + "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/salmon.tar.gz" + ], + [ + "genome_gfp.fasta:md5,e23e302af63736a199985a169fdac055" + ], + [ + "genome_gfp.gtf:md5,c98b12c302f15731bfc36bcf297cfe28" + ], + [ + "genome_gfp.fasta.fai:md5,8fa54c6bd2ea6a369efbb8ab4f30156a" + ], + [ + "genome_gfp.bed:md5,991993ebef1def1d5823632c21177ec3" + ], + [ + "genome_gfp.fasta.sizes:md5,9b755f8f349b14accefb4d859f84de26" + ], + [ + + ], + [ + + ], + [ + + ], + [ + + ], + [ + + ], + [ + + ], + [ + "versions.yml:md5,0bc25597acf1d50abf7070d19d311cd7", + "versions.yml:md5,1cd265cb86a23a27f683ffb2459f37f5", + "versions.yml:md5,71252f1a221be05593361acccb99506b", + "versions.yml:md5,80e9dd350be8cd4c11909d75c914757a", + "versions.yml:md5,bc99889446f02427c166b3219b793672" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-07-03T19:16:32.139593" + }, + "gfp = false - stub": { + "content": [ + [ + "genome.fasta.sizes:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + [ + "genome.fasta.fai:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + [ + "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/genome.fasta" + ], + [ + "genome.filtered.bed:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + [ + "genome.filtered.gtf:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + [ + + ], + [ + + ], + [ + + ], + [ + "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/salmon.tar.gz" + ], + [ + + ], + [ + + ], + [ + + ], + [ + "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/transcriptome.fasta" + ], + [ + "versions.yml:md5,0bc25597acf1d50abf7070d19d311cd7", + "versions.yml:md5,71252f1a221be05593361acccb99506b", + "versions.yml:md5,80e9dd350be8cd4c11909d75c914757a", + "versions.yml:md5,bc99889446f02427c166b3219b793672" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-07-04T17:00:21.318155" + }, + "gencode = false": { + "content": [ + [ + "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/transcriptome.fasta" + ], + [ + "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/salmon.tar.gz" + ], + [ + "genome_gfp.fasta:md5,e23e302af63736a199985a169fdac055" + ], + [ + "genome_gfp.gtf:md5,c98b12c302f15731bfc36bcf297cfe28" + ], + [ + "genome_gfp.fasta.fai:md5,8fa54c6bd2ea6a369efbb8ab4f30156a" + ], + [ + "genome_gfp.bed:md5,991993ebef1def1d5823632c21177ec3" + ], + [ + "genome_gfp.fasta.sizes:md5,9b755f8f349b14accefb4d859f84de26" + ], + [ + + ], + [ + + ], + [ + + ], + [ + + ], + [ + + ], + [ + + ], + [ + "versions.yml:md5,0bc25597acf1d50abf7070d19d311cd7", + "versions.yml:md5,1cd265cb86a23a27f683ffb2459f37f5", + "versions.yml:md5,71252f1a221be05593361acccb99506b", + "versions.yml:md5,80e9dd350be8cd4c11909d75c914757a", + "versions.yml:md5,bc99889446f02427c166b3219b793672" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-07-03T19:15:21.650799" + }, + "default options": { + "content": [ + [ + "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/transcriptome.fasta" + ], + [ + "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/salmon.tar.gz" + ], + [ + "genome_gfp.fasta:md5,e23e302af63736a199985a169fdac055" + ], + [ + "genome_gfp.gtf:md5,c98b12c302f15731bfc36bcf297cfe28" + ], + [ + "genome_gfp.fasta.fai:md5,8fa54c6bd2ea6a369efbb8ab4f30156a" + ], + [ + "genome_gfp.bed:md5,991993ebef1def1d5823632c21177ec3" + ], + [ + "genome_gfp.fasta.sizes:md5,9b755f8f349b14accefb4d859f84de26" + ], + [ + + ], + [ + + ], + [ + + ], + [ + + ], + [ + + ], + [ + + ], + [ + "versions.yml:md5,0bc25597acf1d50abf7070d19d311cd7", + "versions.yml:md5,1cd265cb86a23a27f683ffb2459f37f5", + "versions.yml:md5,71252f1a221be05593361acccb99506b", + "versions.yml:md5,80e9dd350be8cd4c11909d75c914757a", + "versions.yml:md5,bc99889446f02427c166b3219b793672" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-07-03T19:14:58.879047" + }, + "gencode = true - stub": { + "content": [ + [ + "genome_transcriptome.fasta.sizes:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + [ + "genome_transcriptome.fasta.fai:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + [ + "genome_transcriptome.fasta:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + [ + "genome_transcriptome.bed:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + [ + "genome_transcriptome.gtf:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + [ + + ], + [ + + ], + [ + + ], + [ + "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/salmon.tar.gz" + ], + [ + + ], + [ + + ], + [ + + ], + [ + "transcriptome.fixed.fa:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + [ + "versions.yml:md5,0bc25597acf1d50abf7070d19d311cd7", + "versions.yml:md5,71252f1a221be05593361acccb99506b", + "versions.yml:md5,80e9dd350be8cd4c11909d75c914757a", + "versions.yml:md5,961ab91198c4e6ec9d795b95e3f61fda", + "versions.yml:md5,bc99889446f02427c166b3219b793672", + "versions.yml:md5,cc8f32b7c37c35a075d38cb773004eaa" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-07-04T17:02:45.316528" + }, + "skip_alignment - stub": { + "content": [ + [ + "genome_transcriptome.fasta.sizes:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + [ + "genome_transcriptome.fasta.fai:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + [ + "genome_transcriptome.fasta:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + [ + "genome_transcriptome.bed:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + [ + "genome_transcriptome.gtf:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + [ + + ], + [ + + ], + [ + + ], + [ + "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/salmon.tar.gz" + ], + [ + + ], + [ + + ], + [ + + ], + [ + "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/transcriptome.fasta" + ], + [ + "versions.yml:md5,0bc25597acf1d50abf7070d19d311cd7", + "versions.yml:md5,71252f1a221be05593361acccb99506b", + "versions.yml:md5,80e9dd350be8cd4c11909d75c914757a", + "versions.yml:md5,bc99889446f02427c166b3219b793672", + "versions.yml:md5,cc8f32b7c37c35a075d38cb773004eaa" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-07-04T16:58:40.569654" + }, + "skip_bbsplit = true - stub": { + "content": [ + { + "0": [ + "genome_transcriptome.fasta:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + "1": [ + "genome_transcriptome.gtf:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + "10": [ + + ], + "11": [ + + ], + "12": [ + + ], + "13": [ + "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/salmon.tar.gz" + ], + "14": [ + + ], + "15": [ + "versions.yml:md5,71252f1a221be05593361acccb99506b", + "versions.yml:md5,80e9dd350be8cd4c11909d75c914757a", + "versions.yml:md5,bc99889446f02427c166b3219b793672", + "versions.yml:md5,cc8f32b7c37c35a075d38cb773004eaa" + ], + "2": [ + "genome_transcriptome.fasta.fai:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + "3": [ + "genome_transcriptome.bed:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + "4": [ + "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/transcriptome.fasta" + ], + "5": [ + "genome_transcriptome.fasta.sizes:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + "6": [ + + ], + "7": [ + + ], + "8": [ + + ], + "9": [ + + ], + "bbsplit_index": [ + + ], + "chrom_sizes": [ + "genome_transcriptome.fasta.sizes:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + "fai": [ + "genome_transcriptome.fasta.fai:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + "fasta": [ + "genome_transcriptome.fasta:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + "gene_bed": [ + "genome_transcriptome.bed:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + "gtf": [ + "genome_transcriptome.gtf:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + "hisat2_index": [ + + ], + "kallisto_index": [ + + ], + "rrna_fastas": [ + + ], + "rsem_index": [ + + ], + "salmon_index": [ + "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/salmon.tar.gz" + ], + "sortmerna_index": [ + + ], + "splicesites": [ + + ], + "star_index": [ + + ], + "transcript_fasta": [ + "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/transcriptome.fasta" + ], + "versions": [ + "versions.yml:md5,71252f1a221be05593361acccb99506b", + "versions.yml:md5,80e9dd350be8cd4c11909d75c914757a", + "versions.yml:md5,bc99889446f02427c166b3219b793672", + "versions.yml:md5,cc8f32b7c37c35a075d38cb773004eaa" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T12:56:12.856413" + }, + "transcriptome = false": { "content": [ [ - "transcriptome.fixed.fa:md5,faf3a64453ae73983bbf2743387fbdf2" + "genome.transcripts.fa:md5,b89a3e02ad30ba3fd600f98c8e2f58d4" ], [ "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/salmon.tar.gz" @@ -11,7 +1057,7 @@ "genome_gfp.fasta:md5,e23e302af63736a199985a169fdac055" ], [ - "genome_gfp.gtf:md5,2593a0843dd97f0b7dfb62cdd2c21ab8" + "genome_gfp.gtf:md5,c98b12c302f15731bfc36bcf297cfe28" ], [ "genome_gfp.fasta.fai:md5,8fa54c6bd2ea6a369efbb8ab4f30156a" @@ -45,23 +1091,23 @@ "versions.yml:md5,1cd265cb86a23a27f683ffb2459f37f5", "versions.yml:md5,71252f1a221be05593361acccb99506b", "versions.yml:md5,80e9dd350be8cd4c11909d75c914757a", - "versions.yml:md5,961ab91198c4e6ec9d795b95e3f61fda", + "versions.yml:md5,918fe0b59c0986eb602ace85841c5ab3", "versions.yml:md5,bc99889446f02427c166b3219b793672" ] ], "meta": { "nf-test": "0.8.4", - "nextflow": "24.04.1" + "nextflow": "24.04.2" }, - "timestamp": "2024-06-20T18:17:05.661629" + "timestamp": "2024-07-03T19:18:30.8944" }, - "hisat2_index = false": { + "skip_pseudoalignment = true": { "content": [ [ "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/transcriptome.fasta" ], [ - + "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/salmon.tar.gz" ], [ "genome_gfp.fasta:md5,e23e302af63736a199985a169fdac055" @@ -106,38 +1152,38 @@ ], "meta": { "nf-test": "0.8.4", - "nextflow": "24.04.1" + "nextflow": "24.04.2" }, - "timestamp": "2024-06-20T18:16:45.642259" + "timestamp": "2024-07-03T19:22:33.169752" }, - "featurecounts_group_type = 'gene_type'": { + "skip_gtf_filter - stub": { "content": [ [ - "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/transcriptome.fasta" + "genome_transcriptome.fasta.sizes:md5,d41d8cd98f00b204e9800998ecf8427e" ], [ - "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/salmon.tar.gz" + "genome_transcriptome.fasta.fai:md5,d41d8cd98f00b204e9800998ecf8427e" ], [ - "genome_gfp.fasta:md5,e23e302af63736a199985a169fdac055" + "genome_transcriptome.fasta:md5,d41d8cd98f00b204e9800998ecf8427e" ], [ - "genome_gfp.gtf:md5,2593a0843dd97f0b7dfb62cdd2c21ab8" + "genome_transcriptome.bed:md5,d41d8cd98f00b204e9800998ecf8427e" ], [ - "genome_gfp.fasta.fai:md5,8fa54c6bd2ea6a369efbb8ab4f30156a" + "genome_transcriptome.gtf:md5,d41d8cd98f00b204e9800998ecf8427e" ], [ - "genome_gfp.bed:md5,991993ebef1def1d5823632c21177ec3" + ], [ - "genome_gfp.fasta.sizes:md5,9b755f8f349b14accefb4d859f84de26" + ], [ ], [ - + "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/salmon.tar.gz" ], [ @@ -149,26 +1195,25 @@ ], [ - + "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/transcriptome.fasta" ], [ "versions.yml:md5,0bc25597acf1d50abf7070d19d311cd7", - "versions.yml:md5,1cd265cb86a23a27f683ffb2459f37f5", "versions.yml:md5,71252f1a221be05593361acccb99506b", - "versions.yml:md5,80e9dd350be8cd4c11909d75c914757a", - "versions.yml:md5,bc99889446f02427c166b3219b793672" + "versions.yml:md5,bc99889446f02427c166b3219b793672", + "versions.yml:md5,cc8f32b7c37c35a075d38cb773004eaa" ] ], "meta": { "nf-test": "0.8.4", - "nextflow": "24.04.1" + "nextflow": "24.04.2" }, - "timestamp": "2024-06-20T18:17:22.714024" + "timestamp": "2024-07-04T16:57:47.201179" }, - "skip_gtf_filter": { + "gencode = true": { "content": [ [ - "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/transcriptome.fasta" + "transcriptome.fixed.fa:md5,faf3a64453ae73983bbf2743387fbdf2" ], [ "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/salmon.tar.gz" @@ -177,7 +1222,7 @@ "genome_gfp.fasta:md5,e23e302af63736a199985a169fdac055" ], [ - "genome_gfp.gtf:md5,5e63cda3dcafc0d6ad0a738133af9d54" + "genome_gfp.gtf:md5,2593a0843dd97f0b7dfb62cdd2c21ab8" ], [ "genome_gfp.fasta.fai:md5,8fa54c6bd2ea6a369efbb8ab4f30156a" @@ -210,28 +1255,30 @@ "versions.yml:md5,0bc25597acf1d50abf7070d19d311cd7", "versions.yml:md5,1cd265cb86a23a27f683ffb2459f37f5", "versions.yml:md5,71252f1a221be05593361acccb99506b", + "versions.yml:md5,80e9dd350be8cd4c11909d75c914757a", + "versions.yml:md5,961ab91198c4e6ec9d795b95e3f61fda", "versions.yml:md5,bc99889446f02427c166b3219b793672" ] ], "meta": { "nf-test": "0.8.4", - "nextflow": "24.04.1" + "nextflow": "24.04.2" }, - "timestamp": "2024-06-20T18:13:30.196042" + "timestamp": "2024-07-03T19:20:32.664472" }, - "gtf = false": { + "hisat2_index = false": { "content": [ [ - "transcriptome.fixed.fa:md5,faf3a64453ae73983bbf2743387fbdf2" + "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/transcriptome.fasta" ], [ - "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/salmon.tar.gz" + ], [ "genome_gfp.fasta:md5,e23e302af63736a199985a169fdac055" ], [ - "genome_gfp.gtf:md5,68b68c059ba170af3f9d0a5dc1e0c8b8" + "genome_gfp.gtf:md5,c98b12c302f15731bfc36bcf297cfe28" ], [ "genome_gfp.fasta.fai:md5,8fa54c6bd2ea6a369efbb8ab4f30156a" @@ -263,47 +1310,45 @@ [ "versions.yml:md5,0bc25597acf1d50abf7070d19d311cd7", "versions.yml:md5,1cd265cb86a23a27f683ffb2459f37f5", - "versions.yml:md5,2a3ed31ad34b8864fb9278dcdef596ec", "versions.yml:md5,71252f1a221be05593361acccb99506b", "versions.yml:md5,80e9dd350be8cd4c11909d75c914757a", - "versions.yml:md5,961ab91198c4e6ec9d795b95e3f61fda", "versions.yml:md5,bc99889446f02427c166b3219b793672" ] ], "meta": { "nf-test": "0.8.4", - "nextflow": "24.04.1" + "nextflow": "24.04.2" }, - "timestamp": "2024-06-20T18:14:42.913968" + "timestamp": "2024-07-03T19:20:06.853577" }, - "gfp = false": { + "rsem_index = false - stub": { "content": [ [ - "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/transcriptome.fasta" + "genome_transcriptome.fasta.sizes:md5,d41d8cd98f00b204e9800998ecf8427e" ], [ - "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/salmon.tar.gz" + "genome_transcriptome.fasta.fai:md5,d41d8cd98f00b204e9800998ecf8427e" ], [ - "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/genome.fasta" + "genome_transcriptome.fasta:md5,d41d8cd98f00b204e9800998ecf8427e" ], [ - "genome.filtered.gtf:md5,ef6fccd153a21c329670462d602ed2d0" + "genome_transcriptome.bed:md5,d41d8cd98f00b204e9800998ecf8427e" ], [ - "genome.fasta.fai:md5,2cd76d936cbfa386b14154506c2041b2" + "genome_transcriptome.gtf:md5,d41d8cd98f00b204e9800998ecf8427e" ], [ - "genome.filtered.bed:md5,e507dc33673e76c32abe344f4dc07952" + ], [ - "genome.fasta.sizes:md5,29218009212157c49dbc6596621ec780" + ], [ ], [ - + "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/salmon.tar.gz" ], [ @@ -315,22 +1360,23 @@ ], [ - + "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/transcriptome.fasta" ], [ "versions.yml:md5,0bc25597acf1d50abf7070d19d311cd7", "versions.yml:md5,71252f1a221be05593361acccb99506b", "versions.yml:md5,80e9dd350be8cd4c11909d75c914757a", - "versions.yml:md5,bc99889446f02427c166b3219b793672" + "versions.yml:md5,bc99889446f02427c166b3219b793672", + "versions.yml:md5,cc8f32b7c37c35a075d38cb773004eaa" ] ], "meta": { "nf-test": "0.8.4", - "nextflow": "24.04.1" + "nextflow": "24.04.2" }, - "timestamp": "2024-06-20T18:15:16.551347" + "timestamp": "2024-07-04T17:01:29.423708" }, - "skip_bbsplit": { + "featurecounts_group_type = 'gene_type'": { "content": [ [ "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/transcriptome.fasta" @@ -342,7 +1388,7 @@ "genome_gfp.fasta:md5,e23e302af63736a199985a169fdac055" ], [ - "genome_gfp.gtf:md5,c98b12c302f15731bfc36bcf297cfe28" + "genome_gfp.gtf:md5,2593a0843dd97f0b7dfb62cdd2c21ab8" ], [ "genome_gfp.fasta.fai:md5,8fa54c6bd2ea6a369efbb8ab4f30156a" @@ -372,6 +1418,7 @@ ], [ + "versions.yml:md5,0bc25597acf1d50abf7070d19d311cd7", "versions.yml:md5,1cd265cb86a23a27f683ffb2459f37f5", "versions.yml:md5,71252f1a221be05593361acccb99506b", "versions.yml:md5,80e9dd350be8cd4c11909d75c914757a", @@ -380,11 +1427,65 @@ ], "meta": { "nf-test": "0.8.4", - "nextflow": "24.04.1" + "nextflow": "24.04.2" }, - "timestamp": "2024-06-20T18:13:46.28042" + "timestamp": "2024-07-03T19:20:57.049579" }, - "skip_bbsplit = true": { + "with bed - stub": { + "content": [ + [ + "genome_transcriptome.fasta.sizes:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + [ + "genome_transcriptome.fasta.fai:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + [ + "genome_transcriptome.fasta:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + [ + "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/ngscheckmate.bed" + ], + [ + "genome_transcriptome.gtf:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + [ + + ], + [ + + ], + [ + + ], + [ + "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/salmon.tar.gz" + ], + [ + + ], + [ + + ], + [ + + ], + [ + "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/transcriptome.fasta" + ], + [ + "versions.yml:md5,0bc25597acf1d50abf7070d19d311cd7", + "versions.yml:md5,80e9dd350be8cd4c11909d75c914757a", + "versions.yml:md5,bc99889446f02427c166b3219b793672", + "versions.yml:md5,cc8f32b7c37c35a075d38cb773004eaa" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-07-04T17:01:05.223077" + }, + "skip_pseudo_alignment": { "content": [ [ "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/transcriptome.fasta" @@ -426,6 +1527,7 @@ ], [ + "versions.yml:md5,0bc25597acf1d50abf7070d19d311cd7", "versions.yml:md5,1cd265cb86a23a27f683ffb2459f37f5", "versions.yml:md5,71252f1a221be05593361acccb99506b", "versions.yml:md5,80e9dd350be8cd4c11909d75c914757a", @@ -434,11 +1536,11 @@ ], "meta": { "nf-test": "0.8.4", - "nextflow": "24.04.1" + "nextflow": "24.04.2" }, - "timestamp": "2024-06-20T18:17:57.14732" + "timestamp": "2024-07-03T19:16:56.725751" }, - "with bed": { + "skip_bbsplit": { "content": [ [ "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/transcriptome.fasta" @@ -456,7 +1558,7 @@ "genome_gfp.fasta.fai:md5,8fa54c6bd2ea6a369efbb8ab4f30156a" ], [ - "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/ngscheckmate.bed" + "genome_gfp.bed:md5,991993ebef1def1d5823632c21177ec3" ], [ "genome_gfp.fasta.sizes:md5,9b755f8f349b14accefb4d859f84de26" @@ -480,19 +1582,19 @@ ], [ - "versions.yml:md5,0bc25597acf1d50abf7070d19d311cd7", "versions.yml:md5,1cd265cb86a23a27f683ffb2459f37f5", + "versions.yml:md5,71252f1a221be05593361acccb99506b", "versions.yml:md5,80e9dd350be8cd4c11909d75c914757a", "versions.yml:md5,bc99889446f02427c166b3219b793672" ] ], "meta": { "nf-test": "0.8.4", - "nextflow": "24.04.1" + "nextflow": "24.04.2" }, - "timestamp": "2024-06-20T18:15:52.284517" + "timestamp": "2024-07-03T19:16:08.147358" }, - "skip_alignment": { + "with bed": { "content": [ [ "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/transcriptome.fasta" @@ -510,7 +1612,7 @@ "genome_gfp.fasta.fai:md5,8fa54c6bd2ea6a369efbb8ab4f30156a" ], [ - "genome_gfp.bed:md5,991993ebef1def1d5823632c21177ec3" + "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/ngscheckmate.bed" ], [ "genome_gfp.fasta.sizes:md5,9b755f8f349b14accefb4d859f84de26" @@ -536,45 +1638,44 @@ [ "versions.yml:md5,0bc25597acf1d50abf7070d19d311cd7", "versions.yml:md5,1cd265cb86a23a27f683ffb2459f37f5", - "versions.yml:md5,71252f1a221be05593361acccb99506b", "versions.yml:md5,80e9dd350be8cd4c11909d75c914757a", "versions.yml:md5,bc99889446f02427c166b3219b793672" ] ], "meta": { "nf-test": "0.8.4", - "nextflow": "24.04.1" + "nextflow": "24.04.2" }, - "timestamp": "2024-06-20T18:14:04.612027" + "timestamp": "2024-07-03T19:18:54.706918" }, - "gencode = false": { + "gtf = false - stub": { "content": [ [ - "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/transcriptome.fasta" + "genome_transcriptome.fasta.sizes:md5,d41d8cd98f00b204e9800998ecf8427e" ], [ - "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/salmon.tar.gz" + "genome_transcriptome.fasta.fai:md5,d41d8cd98f00b204e9800998ecf8427e" ], [ - "genome_gfp.fasta:md5,e23e302af63736a199985a169fdac055" + "genome_transcriptome.fasta:md5,d41d8cd98f00b204e9800998ecf8427e" ], [ - "genome_gfp.gtf:md5,c98b12c302f15731bfc36bcf297cfe28" + "genome_transcriptome.bed:md5,d41d8cd98f00b204e9800998ecf8427e" ], [ - "genome_gfp.fasta.fai:md5,8fa54c6bd2ea6a369efbb8ab4f30156a" + "genome_transcriptome.gtf:md5,d41d8cd98f00b204e9800998ecf8427e" ], [ - "genome_gfp.bed:md5,991993ebef1def1d5823632c21177ec3" + ], [ - "genome_gfp.fasta.sizes:md5,9b755f8f349b14accefb4d859f84de26" + ], [ ], [ - + "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/salmon.tar.gz" ], [ @@ -586,21 +1687,23 @@ ], [ - + "transcriptome.fixed.fa:md5,d41d8cd98f00b204e9800998ecf8427e" ], [ "versions.yml:md5,0bc25597acf1d50abf7070d19d311cd7", - "versions.yml:md5,1cd265cb86a23a27f683ffb2459f37f5", + "versions.yml:md5,2a3ed31ad34b8864fb9278dcdef596ec", "versions.yml:md5,71252f1a221be05593361acccb99506b", "versions.yml:md5,80e9dd350be8cd4c11909d75c914757a", - "versions.yml:md5,bc99889446f02427c166b3219b793672" + "versions.yml:md5,961ab91198c4e6ec9d795b95e3f61fda", + "versions.yml:md5,bc99889446f02427c166b3219b793672", + "versions.yml:md5,cc8f32b7c37c35a075d38cb773004eaa" ] ], "meta": { "nf-test": "0.8.4", - "nextflow": "24.04.1" + "nextflow": "24.04.2" }, - "timestamp": "2024-06-20T18:13:13.483047" + "timestamp": "2024-07-04T16:59:30.478197" }, "gff = false": { "content": [ @@ -653,38 +1756,38 @@ ], "meta": { "nf-test": "0.8.4", - "nextflow": "24.04.1" + "nextflow": "24.04.2" }, - "timestamp": "2024-06-20T18:15:00.759762" + "timestamp": "2024-07-03T19:17:45.167724" }, - "default options": { + "default options - stub": { "content": [ [ - "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/transcriptome.fasta" + "genome_transcriptome.fasta.sizes:md5,d41d8cd98f00b204e9800998ecf8427e" ], [ - "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/salmon.tar.gz" + "genome_transcriptome.fasta.fai:md5,d41d8cd98f00b204e9800998ecf8427e" ], [ - "genome_gfp.fasta:md5,e23e302af63736a199985a169fdac055" + "genome_transcriptome.fasta:md5,d41d8cd98f00b204e9800998ecf8427e" ], [ - "genome_gfp.gtf:md5,c98b12c302f15731bfc36bcf297cfe28" + "genome_transcriptome.bed:md5,d41d8cd98f00b204e9800998ecf8427e" ], [ - "genome_gfp.fasta.fai:md5,8fa54c6bd2ea6a369efbb8ab4f30156a" + "genome_transcriptome.gtf:md5,d41d8cd98f00b204e9800998ecf8427e" ], [ - "genome_gfp.bed:md5,991993ebef1def1d5823632c21177ec3" + ], [ - "genome_gfp.fasta.sizes:md5,9b755f8f349b14accefb4d859f84de26" + ], [ ], [ - + "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/salmon.tar.gz" ], [ @@ -696,21 +1799,21 @@ ], [ - + "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/transcriptome.fasta" ], [ "versions.yml:md5,0bc25597acf1d50abf7070d19d311cd7", - "versions.yml:md5,1cd265cb86a23a27f683ffb2459f37f5", "versions.yml:md5,71252f1a221be05593361acccb99506b", "versions.yml:md5,80e9dd350be8cd4c11909d75c914757a", - "versions.yml:md5,bc99889446f02427c166b3219b793672" + "versions.yml:md5,bc99889446f02427c166b3219b793672", + "versions.yml:md5,cc8f32b7c37c35a075d38cb773004eaa" ] ], "meta": { "nf-test": "0.8.4", - "nextflow": "24.04.1" + "nextflow": "24.04.2" }, - "timestamp": "2024-06-20T18:12:54.779065" + "timestamp": "2024-07-04T16:56:58.012938" }, "salmon_index = false": { "content": [ @@ -763,9 +1866,9 @@ ], "meta": { "nf-test": "0.8.4", - "nextflow": "24.04.1" + "nextflow": "24.04.2" }, - "timestamp": "2024-06-20T18:16:27.229869" + "timestamp": "2024-07-03T19:19:42.999843" }, "rsem_index = false": { "content": [ @@ -818,38 +1921,38 @@ ], "meta": { "nf-test": "0.8.4", - "nextflow": "24.04.1" + "nextflow": "24.04.2" }, - "timestamp": "2024-06-20T18:16:09.968836" + "timestamp": "2024-07-03T19:19:19.357926" }, - "skip_psuedo_alignment": { + "skip_alignment = true - stub": { "content": [ [ - "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/transcriptome.fasta" + "genome_transcriptome.fasta.sizes:md5,d41d8cd98f00b204e9800998ecf8427e" ], [ - "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/salmon.tar.gz" + "genome_transcriptome.fasta.fai:md5,d41d8cd98f00b204e9800998ecf8427e" ], [ - "genome_gfp.fasta:md5,e23e302af63736a199985a169fdac055" + "genome_transcriptome.fasta:md5,d41d8cd98f00b204e9800998ecf8427e" ], [ - "genome_gfp.gtf:md5,c98b12c302f15731bfc36bcf297cfe28" + "genome_transcriptome.bed:md5,d41d8cd98f00b204e9800998ecf8427e" ], [ - "genome_gfp.fasta.fai:md5,8fa54c6bd2ea6a369efbb8ab4f30156a" + "genome_transcriptome.gtf:md5,d41d8cd98f00b204e9800998ecf8427e" ], [ - "genome_gfp.bed:md5,991993ebef1def1d5823632c21177ec3" + ], [ - "genome_gfp.fasta.sizes:md5,9b755f8f349b14accefb4d859f84de26" + ], [ ], [ - + "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/salmon.tar.gz" ], [ @@ -861,50 +1964,50 @@ ], [ - + "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/transcriptome.fasta" ], [ "versions.yml:md5,0bc25597acf1d50abf7070d19d311cd7", - "versions.yml:md5,1cd265cb86a23a27f683ffb2459f37f5", "versions.yml:md5,71252f1a221be05593361acccb99506b", "versions.yml:md5,80e9dd350be8cd4c11909d75c914757a", - "versions.yml:md5,bc99889446f02427c166b3219b793672" + "versions.yml:md5,bc99889446f02427c166b3219b793672", + "versions.yml:md5,cc8f32b7c37c35a075d38cb773004eaa" ] ], "meta": { "nf-test": "0.8.4", - "nextflow": "24.04.1" + "nextflow": "24.04.2" }, - "timestamp": "2024-06-20T18:14:22.598093" + "timestamp": "2024-07-04T17:04:20.276533" }, - "transcriptome = false": { + "transcriptome = false - stub": { "content": [ [ - "genome.transcripts.fa:md5,b89a3e02ad30ba3fd600f98c8e2f58d4" + "genome_transcriptome.fasta.sizes:md5,d41d8cd98f00b204e9800998ecf8427e" ], [ - "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/salmon.tar.gz" + "genome_transcriptome.fasta.fai:md5,d41d8cd98f00b204e9800998ecf8427e" ], [ - "genome_gfp.fasta:md5,e23e302af63736a199985a169fdac055" + "genome_transcriptome.fasta:md5,d41d8cd98f00b204e9800998ecf8427e" ], [ - "genome_gfp.gtf:md5,c98b12c302f15731bfc36bcf297cfe28" + "genome_transcriptome.bed:md5,d41d8cd98f00b204e9800998ecf8427e" ], [ - "genome_gfp.fasta.fai:md5,8fa54c6bd2ea6a369efbb8ab4f30156a" + "genome_transcriptome.gtf:md5,d41d8cd98f00b204e9800998ecf8427e" ], [ - "genome_gfp.bed:md5,991993ebef1def1d5823632c21177ec3" + ], [ - "genome_gfp.fasta.sizes:md5,9b755f8f349b14accefb4d859f84de26" + ], [ ], [ - + "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/salmon.tar.gz" ], [ @@ -916,24 +2019,24 @@ ], [ - + "genome.transcripts.fa:md5,d41d8cd98f00b204e9800998ecf8427e" ], [ "versions.yml:md5,0bc25597acf1d50abf7070d19d311cd7", - "versions.yml:md5,1cd265cb86a23a27f683ffb2459f37f5", "versions.yml:md5,71252f1a221be05593361acccb99506b", "versions.yml:md5,80e9dd350be8cd4c11909d75c914757a", "versions.yml:md5,918fe0b59c0986eb602ace85841c5ab3", - "versions.yml:md5,bc99889446f02427c166b3219b793672" + "versions.yml:md5,bc99889446f02427c166b3219b793672", + "versions.yml:md5,cc8f32b7c37c35a075d38cb773004eaa" ] ], "meta": { "nf-test": "0.8.4", - "nextflow": "24.04.1" + "nextflow": "24.04.2" }, - "timestamp": "2024-06-20T18:15:34.269049" + "timestamp": "2024-07-04T17:00:43.920677" }, - "skip_pseudoalignment = true": { + "skip_alignment = true": { "content": [ [ "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/transcriptome.fasta" @@ -984,11 +2087,11 @@ ], "meta": { "nf-test": "0.8.4", - "nextflow": "24.04.1" + "nextflow": "24.04.2" }, - "timestamp": "2024-06-20T18:18:35.783312" + "timestamp": "2024-07-03T19:22:08.9618" }, - "skip_alignment = true": { + "skip_gtf_filter = true": { "content": [ [ "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/transcriptome.fasta" @@ -1000,7 +2103,7 @@ "genome_gfp.fasta:md5,e23e302af63736a199985a169fdac055" ], [ - "genome_gfp.gtf:md5,c98b12c302f15731bfc36bcf297cfe28" + "genome_gfp.gtf:md5,5e63cda3dcafc0d6ad0a738133af9d54" ], [ "genome_gfp.fasta.fai:md5,8fa54c6bd2ea6a369efbb8ab4f30156a" @@ -1033,38 +2136,37 @@ "versions.yml:md5,0bc25597acf1d50abf7070d19d311cd7", "versions.yml:md5,1cd265cb86a23a27f683ffb2459f37f5", "versions.yml:md5,71252f1a221be05593361acccb99506b", - "versions.yml:md5,80e9dd350be8cd4c11909d75c914757a", "versions.yml:md5,bc99889446f02427c166b3219b793672" ] ], "meta": { "nf-test": "0.8.4", - "nextflow": "24.04.1" + "nextflow": "24.04.2" }, - "timestamp": "2024-06-20T18:18:16.883006" + "timestamp": "2024-07-03T19:21:18.583526" }, - "skip_gtf_filter = true": { + "hisat2_index = false - stub": { "content": [ [ - "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/transcriptome.fasta" + "genome_transcriptome.fasta.sizes:md5,d41d8cd98f00b204e9800998ecf8427e" ], [ - "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/salmon.tar.gz" + "genome_transcriptome.fasta.fai:md5,d41d8cd98f00b204e9800998ecf8427e" ], [ - "genome_gfp.fasta:md5,e23e302af63736a199985a169fdac055" + "genome_transcriptome.fasta:md5,d41d8cd98f00b204e9800998ecf8427e" ], [ - "genome_gfp.gtf:md5,5e63cda3dcafc0d6ad0a738133af9d54" + "genome_transcriptome.bed:md5,d41d8cd98f00b204e9800998ecf8427e" ], [ - "genome_gfp.fasta.fai:md5,8fa54c6bd2ea6a369efbb8ab4f30156a" + "genome_transcriptome.gtf:md5,d41d8cd98f00b204e9800998ecf8427e" ], [ - "genome_gfp.bed:md5,991993ebef1def1d5823632c21177ec3" + ], [ - "genome_gfp.fasta.sizes:md5,9b755f8f349b14accefb4d859f84de26" + ], [ @@ -1082,19 +2184,133 @@ ], [ - + "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/transcriptome.fasta" ], [ "versions.yml:md5,0bc25597acf1d50abf7070d19d311cd7", - "versions.yml:md5,1cd265cb86a23a27f683ffb2459f37f5", "versions.yml:md5,71252f1a221be05593361acccb99506b", - "versions.yml:md5,bc99889446f02427c166b3219b793672" + "versions.yml:md5,80e9dd350be8cd4c11909d75c914757a", + "versions.yml:md5,bc99889446f02427c166b3219b793672", + "versions.yml:md5,cc8f32b7c37c35a075d38cb773004eaa" ] ], "meta": { "nf-test": "0.8.4", - "nextflow": "24.04.1" + "nextflow": "24.04.2" + }, + "timestamp": "2024-07-04T17:02:19.539518" + }, + "skip_bbsplit - stub": { + "content": [ + { + "0": [ + "genome_transcriptome.fasta:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + "1": [ + "genome_transcriptome.gtf:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + "10": [ + + ], + "11": [ + + ], + "12": [ + + ], + "13": [ + "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/salmon.tar.gz" + ], + "14": [ + + ], + "15": [ + "versions.yml:md5,71252f1a221be05593361acccb99506b", + "versions.yml:md5,80e9dd350be8cd4c11909d75c914757a", + "versions.yml:md5,bc99889446f02427c166b3219b793672", + "versions.yml:md5,cc8f32b7c37c35a075d38cb773004eaa" + ], + "2": [ + "genome_transcriptome.fasta.fai:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + "3": [ + "genome_transcriptome.bed:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + "4": [ + "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/transcriptome.fasta" + ], + "5": [ + "genome_transcriptome.fasta.sizes:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + "6": [ + + ], + "7": [ + + ], + "8": [ + + ], + "9": [ + + ], + "bbsplit_index": [ + + ], + "chrom_sizes": [ + "genome_transcriptome.fasta.sizes:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + "fai": [ + "genome_transcriptome.fasta.fai:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + "fasta": [ + "genome_transcriptome.fasta:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + "gene_bed": [ + "genome_transcriptome.bed:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + "gtf": [ + "genome_transcriptome.gtf:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + "hisat2_index": [ + + ], + "kallisto_index": [ + + ], + "rrna_fastas": [ + + ], + "rsem_index": [ + + ], + "salmon_index": [ + "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/salmon.tar.gz" + ], + "sortmerna_index": [ + + ], + "splicesites": [ + + ], + "star_index": [ + + ], + "transcript_fasta": [ + "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/transcriptome.fasta" + ], + "versions": [ + "versions.yml:md5,71252f1a221be05593361acccb99506b", + "versions.yml:md5,80e9dd350be8cd4c11909d75c914757a", + "versions.yml:md5,bc99889446f02427c166b3219b793672", + "versions.yml:md5,cc8f32b7c37c35a075d38cb773004eaa" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-06-20T18:17:39.358651" + "timestamp": "2024-07-22T12:50:45.029123" } } \ No newline at end of file diff --git a/subworkflows/local/quantify_rsem/tests/main.nf.test b/subworkflows/local/quantify_rsem/tests/main.nf.test index 818282af3..bba6f4372 100644 --- a/subworkflows/local/quantify_rsem/tests/main.nf.test +++ b/subworkflows/local/quantify_rsem/tests/main.nf.test @@ -39,6 +39,7 @@ nextflow_workflow { assertAll( { assert workflow.success }, { assert snapshot( + file(workflow.out.logs[0][1]).name, workflow.out.counts_gene, workflow.out.counts_transcript, workflow.out.stat, @@ -57,11 +58,48 @@ nextflow_workflow { workflow.out.merged_counts_transcript, workflow.out.merged_tpm_transcript, workflow.out.versions - ).match() - }, - { assert snapshot(file(workflow.out.logs[0][1]).name).match('logs') } + ).match()} ) } } + test("homo_sapiens - stub") { + + options "-stub" + + setup { + run("RSEM_PREPAREREFERENCE") { + script "../../../../modules/nf-core/rsem/preparereference/main.nf" + process { + """ + input[0] = Channel.of(file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)) + input[1] = Channel.of(file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true)) + """ + } + } + } + + when { + workflow { + """ + input[0] = Channel.of([ + [ id:'test', strandedness: 'forward' ], // meta map + [ + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_rnaseq_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_rnaseq_2.fastq.gz', checkIfExists: true) + ] + ]) + input[1] = RSEM_PREPAREREFERENCE.out.index + input[2] = Channel.of([[id:'test'], file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)]) + """ + } + } + + then { + assertAll( + { assert workflow.success }, + { assert snapshot(workflow.out).match()} + ) + } + } } diff --git a/subworkflows/local/quantify_rsem/tests/main.nf.test.snap b/subworkflows/local/quantify_rsem/tests/main.nf.test.snap index e3d6bd183..847be5d62 100644 --- a/subworkflows/local/quantify_rsem/tests/main.nf.test.snap +++ b/subworkflows/local/quantify_rsem/tests/main.nf.test.snap @@ -1,16 +1,282 @@ { - "logs": { + "homo_sapiens - stub": { "content": [ - "test.log" + { + "0": [ + [ + { + "id": "test", + "strandedness": "forward" + }, + "test.genes.results:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "strandedness": "forward" + }, + "test.isoforms.results:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "10": [ + [ + { + "id": "test", + "strandedness": "forward" + }, + "test.stats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "11": [ + [ + { + "id": "test", + "strandedness": "forward" + }, + "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "12": [ + [ + { + "id": "test", + "strandedness": "forward" + }, + "test.idxstats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "13": [ + "rsem.merged.gene_counts.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + "14": [ + "rsem.merged.gene_tpm.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + "15": [ + "rsem.merged.transcript_counts.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + "16": [ + "rsem.merged.transcript_tpm.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + "17": [ + "versions.yml:md5,2aa5252eb2ffb409cf556a165d40f8a9", + "versions.yml:md5,3399809728955f4654ab781f37ea42d3", + "versions.yml:md5,4219f710ca21b71a7c7db6b02ac19bb3", + "versions.yml:md5,912c613bca84f899b3e890985ecc6fc2", + "versions.yml:md5,a4755dd9acbfa60dbc38e172ffda193f", + "versions.yml:md5,ae1676b60b6335fff8f1188288103a1c", + "versions.yml:md5,f645ee5b20a4e89c6ed48fdc27c21791" + ], + "2": [ + [ + { + "id": "test", + "strandedness": "forward" + }, + "test.stat:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + [ + { + "id": "test", + "strandedness": "forward" + }, + "test.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "4": [ + [ + { + "id": "test", + "strandedness": "forward" + }, + "test.STAR.genome.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "5": [ + [ + { + "id": "test", + "strandedness": "forward" + }, + "test.genome.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "6": [ + [ + { + "id": "test", + "strandedness": "forward" + }, + "test.transcript.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "7": [ + [ + { + "id": "test", + "strandedness": "forward" + }, + "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "8": [ + [ + { + "id": "test", + "strandedness": "forward" + }, + "test.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "9": [ + + ], + "bai": [ + [ + { + "id": "test", + "strandedness": "forward" + }, + "test.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "bam": [ + [ + { + "id": "test", + "strandedness": "forward" + }, + "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "bam_genome": [ + [ + { + "id": "test", + "strandedness": "forward" + }, + "test.genome.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "bam_star": [ + [ + { + "id": "test", + "strandedness": "forward" + }, + "test.STAR.genome.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "bam_transcript": [ + [ + { + "id": "test", + "strandedness": "forward" + }, + "test.transcript.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "counts_gene": [ + [ + { + "id": "test", + "strandedness": "forward" + }, + "test.genes.results:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "counts_transcript": [ + [ + { + "id": "test", + "strandedness": "forward" + }, + "test.isoforms.results:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "csi": [ + + ], + "flagstat": [ + [ + { + "id": "test", + "strandedness": "forward" + }, + "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "idxstats": [ + [ + { + "id": "test", + "strandedness": "forward" + }, + "test.idxstats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "logs": [ + [ + { + "id": "test", + "strandedness": "forward" + }, + "test.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "merged_counts_gene": [ + "rsem.merged.gene_counts.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + "merged_counts_transcript": [ + "rsem.merged.transcript_counts.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + "merged_tpm_gene": [ + "rsem.merged.gene_tpm.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + "merged_tpm_transcript": [ + "rsem.merged.transcript_tpm.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + "stat": [ + [ + { + "id": "test", + "strandedness": "forward" + }, + "test.stat:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "stats": [ + [ + { + "id": "test", + "strandedness": "forward" + }, + "test.stats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,2aa5252eb2ffb409cf556a165d40f8a9", + "versions.yml:md5,3399809728955f4654ab781f37ea42d3", + "versions.yml:md5,4219f710ca21b71a7c7db6b02ac19bb3", + "versions.yml:md5,912c613bca84f899b3e890985ecc6fc2", + "versions.yml:md5,a4755dd9acbfa60dbc38e172ffda193f", + "versions.yml:md5,ae1676b60b6335fff8f1188288103a1c", + "versions.yml:md5,f645ee5b20a4e89c6ed48fdc27c21791" + ] + } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-03-07T18:25:31.476361" + "timestamp": "2024-07-22T19:32:06.579549" }, "homo_sapiens": { "content": [ + "test.log", [ [ { @@ -103,8 +369,8 @@ ], "meta": { "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nextflow": "24.04.2" }, - "timestamp": "2024-03-07T18:15:03.001083" + "timestamp": "2024-07-03T19:53:14.561568" } } \ No newline at end of file diff --git a/subworkflows/nf-core/bam_dedup_stats_samtools_umitools/tests/main.nf.test b/subworkflows/nf-core/bam_dedup_stats_samtools_umitools/tests/main.nf.test index cc9c57c04..9d38022b4 100644 --- a/subworkflows/nf-core/bam_dedup_stats_samtools_umitools/tests/main.nf.test +++ b/subworkflows/nf-core/bam_dedup_stats_samtools_umitools/tests/main.nf.test @@ -20,9 +20,6 @@ nextflow_workflow { test("sarscov2_bam_bai") { when { - params { - outdir = "$outputDir" - } workflow { """ val_get_dedup_stats = false @@ -43,12 +40,40 @@ nextflow_workflow { { assert workflow.out.deduplog.get(0).get(1) ==~ ".*.log"}, { assert workflow.out.bam.get(0).get(1) ==~ ".*.bam"}, { assert workflow.out.bai.get(0).get(1) ==~ ".*.bai"}, - { assert snapshot(workflow.out.stats).match("test_bam_dedup_stats_samtools_umitools_stats") }, - { assert snapshot(workflow.out.flagstat).match("test_bam_dedup_stats_samtools_umitools_flagstats") }, - { assert snapshot(workflow.out.idxstats).match("test_bam_dedup_stats_samtools_umitools_idxstats") } + { assert snapshot( + workflow.out.stats, + workflow.out.flagstat, + workflow.out.idxstats, + workflow.out.versions + ).match() } ) } - } + test("sarscov2_bam_bai - stub") { + + options "-stub" + + when { + workflow { + """ + val_get_dedup_stats = false + + input[0] = Channel.of([ + [ id:'test'], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true) + ]) + input[1] = val_get_dedup_stats + """ + } + } + + then { + assertAll( + { assert workflow.success}, + { assert snapshot(workflow.out).match() } + ) + } + } } diff --git a/subworkflows/nf-core/bam_dedup_stats_samtools_umitools/tests/main.nf.test.snap b/subworkflows/nf-core/bam_dedup_stats_samtools_umitools/tests/main.nf.test.snap index 442776f69..4fd70b5f3 100644 --- a/subworkflows/nf-core/bam_dedup_stats_samtools_umitools/tests/main.nf.test.snap +++ b/subworkflows/nf-core/bam_dedup_stats_samtools_umitools/tests/main.nf.test.snap @@ -1,23 +1,14 @@ { - "test_bam_dedup_stats_samtools_umitools_idxstats": { + "sarscov2_bam_bai": { "content": [ [ [ { "id": "test" }, - "test.idxstats:md5,1adb27b52d4d64b826f48b59d61dcd4d" + "test.stats:md5,09d1bd8f10e000921202f7ea1cd0679e" ] - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2023-11-06T09:58:40.394333937" - }, - "test_bam_dedup_stats_samtools_umitools_flagstats": { - "content": [ + ], [ [ { @@ -25,29 +16,154 @@ }, "test.flagstat:md5,0bb716e40fae381b97484b58e0b16efe" ] - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2023-11-06T09:58:40.385185447" - }, - "test_bam_dedup_stats_samtools_umitools_stats": { - "content": [ + ], [ [ { "id": "test" }, - "test.stats:md5,09d1bd8f10e000921202f7ea1cd0679e" + "test.idxstats:md5,1adb27b52d4d64b826f48b59d61dcd4d" ] + ], + [ + "versions.yml:md5,32b4a349a563fb5b01cf0688ae3ca860", + "versions.yml:md5,803d3f4d3992a7a597a09cf330bd46a4", + "versions.yml:md5,9b7824114bf90d4b60110ddaf149f1db", + "versions.yml:md5,f0864f64f8ebb81826a1cf5c14b77e69", + "versions.yml:md5,f4935d4e563646266cc6bb4d75d0fb7d" ] ], "meta": { "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nextflow": "24.04.2" + }, + "timestamp": "2024-07-03T11:53:11.53709" + }, + "sarscov2_bam_bai - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test" + }, + "test.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + [ + { + "id": "test" + }, + "test.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + + ], + "4": [ + [ + { + "id": "test" + }, + "test.stats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "5": [ + [ + { + "id": "test" + }, + "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "6": [ + [ + { + "id": "test" + }, + "test.idxstats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "7": [ + "versions.yml:md5,32b4a349a563fb5b01cf0688ae3ca860", + "versions.yml:md5,803d3f4d3992a7a597a09cf330bd46a4", + "versions.yml:md5,9b7824114bf90d4b60110ddaf149f1db", + "versions.yml:md5,f0864f64f8ebb81826a1cf5c14b77e69", + "versions.yml:md5,f4935d4e563646266cc6bb4d75d0fb7d" + ], + "bai": [ + [ + { + "id": "test" + }, + "test.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "bam": [ + [ + { + "id": "test" + }, + "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "csi": [ + + ], + "deduplog": [ + [ + { + "id": "test" + }, + "test.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "flagstat": [ + [ + { + "id": "test" + }, + "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "idxstats": [ + [ + { + "id": "test" + }, + "test.idxstats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "stats": [ + [ + { + "id": "test" + }, + "test.stats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,32b4a349a563fb5b01cf0688ae3ca860", + "versions.yml:md5,803d3f4d3992a7a597a09cf330bd46a4", + "versions.yml:md5,9b7824114bf90d4b60110ddaf149f1db", + "versions.yml:md5,f0864f64f8ebb81826a1cf5c14b77e69", + "versions.yml:md5,f4935d4e563646266cc6bb4d75d0fb7d" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-05-29T07:36:18.573909434" + "timestamp": "2024-07-22T16:34:35.959581" } -} \ No newline at end of file +} diff --git a/subworkflows/nf-core/bam_dedup_stats_samtools_umitools/tests/tags.yml b/subworkflows/nf-core/bam_dedup_stats_samtools_umitools/tests/tags.yml deleted file mode 100644 index bfd5e023e..000000000 --- a/subworkflows/nf-core/bam_dedup_stats_samtools_umitools/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -subworkflows/bam_dedup_stats_samtools_umitools: - - subworkflows/nf-core/bam_dedup_stats_samtools_umitools/** diff --git a/subworkflows/nf-core/bam_markduplicates_picard/tests/main.nf.test b/subworkflows/nf-core/bam_markduplicates_picard/tests/main.nf.test index 7ecf3fe40..f023a9f7d 100644 --- a/subworkflows/nf-core/bam_markduplicates_picard/tests/main.nf.test +++ b/subworkflows/nf-core/bam_markduplicates_picard/tests/main.nf.test @@ -28,14 +28,15 @@ nextflow_workflow { then { assertAll( { assert workflow.success}, + { assert path(workflow.out.metrics.get(0).get(1)).getText().contains("97") }, { assert snapshot( path(workflow.out.bam[0][1]), path(workflow.out.bai[0][1]), path(workflow.out.flagstat[0][1]), path(workflow.out.idxstats[0][1]), path(workflow.out.stats[0][1]), - ).match("sarscov2 - bam") }, - { assert path(workflow.out.metrics.get(0).get(1)).getText().contains("97") } + workflow.out.versions + ).match() } ) } } @@ -64,16 +65,78 @@ nextflow_workflow { then { assertAll( { assert workflow.success}, + { assert path(workflow.out.metrics.get(0).get(1)).getText().contains("0.999986") }, { assert snapshot( file(workflow.out.cram[0][1]).name, path(workflow.out.crai[0][1]), path(workflow.out.flagstat[0][1]), path(workflow.out.idxstats[0][1]), path(workflow.out.stats[0][1]), - ).match("homo_sapiens - cram") }, - { assert path(workflow.out.metrics.get(0).get(1)).getText().contains("0.999986") } + workflow.out.versions + ).match() } ) } } + test("sarscov2 - bam - stub") { + + options "-stub" + + when { + workflow { + """ + input[0] = Channel.of([ + [ id:'test', single_end: false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true) + ]) + input[1] = Channel.of([ + [ id:'genome' ], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ]) + input[2] = Channel.of([ + [ id:'genome' ], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.fai', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll( + { assert workflow.success}, + { assert snapshot(workflow.out).match() } + ) + } + } + + test("homo_sapiens - cram - stub") { + + options "-stub" + + when { + workflow { + """ + input[0] = Channel.of([ + [ id:'test' ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram', checkIfExists: true) + ]) + input[1] = Channel.of([ + [ id:'genome' ], + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) + ]) + input[2] = Channel.of([ + [ id:'genome' ], + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll( + { assert workflow.success}, + { assert snapshot(workflow.out).match() } + ) + } + } } diff --git a/subworkflows/nf-core/bam_markduplicates_picard/tests/main.nf.test.snap b/subworkflows/nf-core/bam_markduplicates_picard/tests/main.nf.test.snap index 94f8f29c4..32788a18c 100644 --- a/subworkflows/nf-core/bam_markduplicates_picard/tests/main.nf.test.snap +++ b/subworkflows/nf-core/bam_markduplicates_picard/tests/main.nf.test.snap @@ -5,13 +5,310 @@ "test.cram.crai:md5,78d47ba01ac4e05f3ae1e353902a989e", "test.flagstat:md5,93b0ef463df947ede1f42ff60396c34d", "test.idxstats:md5,e179601fa7b8ebce81ac3765206f6c15", - "test.stats:md5,372a7d9d9081aa009b21343a913beb14" + "test.stats:md5,372a7d9d9081aa009b21343a913beb14", + [ + "versions.yml:md5,0d170c963555870ac9a0d438bf6c2f93", + "versions.yml:md5,3729819c49e6d8eed9ada247e5d77de1", + "versions.yml:md5,966dcea920866a87b55e665563864fc9", + "versions.yml:md5,a62ca6eb27e59dd6f03a93fa8656e656", + "versions.yml:md5,fcf804c605f455127f2449403d70390c" + ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-05-29T07:39:18.809130196" + "timestamp": "2024-07-22T19:28:15.15911" + }, + "sarscov2 - bam - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + + ], + "2": [ + [ + { + "id": "test", + "single_end": false + }, + "test.MarkDuplicates.metrics.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + [ + { + "id": "test", + "single_end": false + }, + "test.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "4": [ + + ], + "5": [ + + ], + "6": [ + [ + { + "id": "test", + "single_end": false + }, + "test.stats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "7": [ + [ + { + "id": "test", + "single_end": false + }, + "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "8": [ + [ + { + "id": "test", + "single_end": false + }, + "test.idxstats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "9": [ + "versions.yml:md5,0d170c963555870ac9a0d438bf6c2f93", + "versions.yml:md5,3729819c49e6d8eed9ada247e5d77de1", + "versions.yml:md5,966dcea920866a87b55e665563864fc9", + "versions.yml:md5,a62ca6eb27e59dd6f03a93fa8656e656", + "versions.yml:md5,fcf804c605f455127f2449403d70390c" + ], + "bai": [ + [ + { + "id": "test", + "single_end": false + }, + "test.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "bam": [ + [ + { + "id": "test", + "single_end": false + }, + "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "crai": [ + + ], + "cram": [ + + ], + "csi": [ + + ], + "flagstat": [ + [ + { + "id": "test", + "single_end": false + }, + "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "idxstats": [ + [ + { + "id": "test", + "single_end": false + }, + "test.idxstats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "metrics": [ + [ + { + "id": "test", + "single_end": false + }, + "test.MarkDuplicates.metrics.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "stats": [ + [ + { + "id": "test", + "single_end": false + }, + "test.stats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,0d170c963555870ac9a0d438bf6c2f93", + "versions.yml:md5,3729819c49e6d8eed9ada247e5d77de1", + "versions.yml:md5,966dcea920866a87b55e665563864fc9", + "versions.yml:md5,a62ca6eb27e59dd6f03a93fa8656e656", + "versions.yml:md5,fcf804c605f455127f2449403d70390c" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T19:28:40.128144" + }, + "homo_sapiens - cram - stub": { + "content": [ + { + "0": [ + + ], + "1": [ + [ + { + "id": "test" + }, + "test.cram:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + [ + { + "id": "test" + }, + "test.MarkDuplicates.metrics.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + + ], + "4": [ + [ + { + "id": "test" + }, + "test.cram.crai:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "5": [ + + ], + "6": [ + [ + { + "id": "test" + }, + "test.stats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "7": [ + [ + { + "id": "test" + }, + "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "8": [ + [ + { + "id": "test" + }, + "test.idxstats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "9": [ + "versions.yml:md5,0d170c963555870ac9a0d438bf6c2f93", + "versions.yml:md5,3729819c49e6d8eed9ada247e5d77de1", + "versions.yml:md5,966dcea920866a87b55e665563864fc9", + "versions.yml:md5,a62ca6eb27e59dd6f03a93fa8656e656", + "versions.yml:md5,fcf804c605f455127f2449403d70390c" + ], + "bai": [ + + ], + "bam": [ + + ], + "crai": [ + [ + { + "id": "test" + }, + "test.cram.crai:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "cram": [ + [ + { + "id": "test" + }, + "test.cram:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "csi": [ + + ], + "flagstat": [ + [ + { + "id": "test" + }, + "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "idxstats": [ + [ + { + "id": "test" + }, + "test.idxstats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "metrics": [ + [ + { + "id": "test" + }, + "test.MarkDuplicates.metrics.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "stats": [ + [ + { + "id": "test" + }, + "test.stats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,0d170c963555870ac9a0d438bf6c2f93", + "versions.yml:md5,3729819c49e6d8eed9ada247e5d77de1", + "versions.yml:md5,966dcea920866a87b55e665563864fc9", + "versions.yml:md5,a62ca6eb27e59dd6f03a93fa8656e656", + "versions.yml:md5,fcf804c605f455127f2449403d70390c" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T19:29:04.075263" }, "sarscov2 - bam": { "content": [ @@ -19,12 +316,19 @@ "test.bam.bai:md5,4d3ae8d013444b55e17aa0149a2ab404", "test.flagstat:md5,4f7ffd1e6a5e85524d443209ac97d783", "test.idxstats:md5,df60a8c8d6621100d05178c93fb053a2", - "test.stats:md5,cca83e4fc9406fc3875b5e60055d6574" + "test.stats:md5,cca83e4fc9406fc3875b5e60055d6574", + [ + "versions.yml:md5,0d170c963555870ac9a0d438bf6c2f93", + "versions.yml:md5,3729819c49e6d8eed9ada247e5d77de1", + "versions.yml:md5,966dcea920866a87b55e665563864fc9", + "versions.yml:md5,a62ca6eb27e59dd6f03a93fa8656e656", + "versions.yml:md5,fcf804c605f455127f2449403d70390c" + ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-05-29T07:39:07.280687689" + "timestamp": "2024-07-22T19:27:47.343274" } } \ No newline at end of file diff --git a/subworkflows/nf-core/bam_rseqc/tests/main.nf.test b/subworkflows/nf-core/bam_rseqc/tests/main.nf.test index eb87c27c9..492cfb6fe 100644 --- a/subworkflows/nf-core/bam_rseqc/tests/main.nf.test +++ b/subworkflows/nf-core/bam_rseqc/tests/main.nf.test @@ -25,27 +25,19 @@ nextflow_workflow { then { assertAll( { assert workflow.success}, - { assert snapshot(workflow.out.bamstat_txt).match("bamstat_txt")}, - - { assert snapshot(workflow.out.innerdistance_all.findAll { it[1].endsWith('.pdf') == false }).match("innerdistance_all")}, { assert workflow.out.innerdistance_all.any { it[1].endsWith('.pdf') && file(it[1]).exists() } }, - - { assert snapshot(workflow.out.inferexperiment_txt).match("inferexperiment_txt")}, - - { assert snapshot(workflow.out.junctionannotation_all.findAll { - it[1].endsWith('.xls') == false && - it[1].endsWith('.r') == false }).match("junctionannotation_all")}, - - { assert snapshot(workflow.out.junctionsaturation_all.findAll { it[1].endsWith('.pdf') == false }).match("junctionsaturation_all")}, - { assert workflow.out.junctionsaturation_all.any { it[1].endsWith('.pdf') && file(it[1]).exists() } }, - - { assert snapshot(workflow.out.readdistribution_txt).match("readdistribution_txt")}, - - { assert snapshot(workflow.out.readduplication_all.findAll { it[1].endsWith('.pdf') == false }).match("readduplication_all")}, { assert workflow.out.readduplication_all.any { it[1].endsWith('.pdf') && file(it[1]).exists() } }, - - { assert snapshot(workflow.out.tin_txt).match("tin_txt")}, - { assert snapshot(workflow.out.versions).match("versions")}, + { assert workflow.out.junctionsaturation_all.any { it[1].endsWith('.pdf') && file(it[1]).exists() } }, + { assert snapshot( + workflow.out.bamstat_txt, + workflow.out.innerdistance_all.findAll { it[1].endsWith('.pdf') == false }, + workflow.out.inferexperiment_txt, + workflow.out.junctionannotation_all.findAll { it[1].endsWith('.xls') == false && it[1].endsWith('.r') == false }, + workflow.out.junctionsaturation_all.findAll { it[1].endsWith('.pdf') == false }, + workflow.out.readdistribution_txt, + workflow.out.readduplication_all.findAll { it[1].endsWith('.pdf') == false }, + workflow.out.tin_txt, + workflow.out.versions).match()} ) } } @@ -79,9 +71,64 @@ nextflow_workflow { { assert workflow.out.readdistribution_txt.size() == 0 }, { assert workflow.out.readduplication_all.size() == 0 }, { assert workflow.out.tin_txt.size() == 0 }, - { assert workflow.out.versions.size() == 0 }, + { assert workflow.out.versions.size() == 0 } + ) + } + } + + test("sarscov2 paired-end [bam] - stub") { + + options "-stub" + + when { + workflow { + """ + input[0] = Channel.of([ + [ id:'test' ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true) + ]) + input[1] = Channel.of([ + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/bed/test.bed12', checkIfExists: true) + ]) + input[2] = ['bam_stat', 'inner_distance', 'infer_experiment', 'junction_annotation', 'junction_saturation', 'read_distribution', 'read_duplication', 'tin'] + """ + } + } + + then { + assertAll( + { assert workflow.success}, + { assert snapshot(workflow.out).match()} ) } } + test("sarscov2 paired-end [bam] no modules - stub") { + + options "-stub" + + when { + workflow { + """ + input[0] = Channel.of([ + [ id:'test' ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true) + ]) + input[1] = Channel.of([ + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/bed/test.bed12', checkIfExists: true) + ]) + input[2] = [] + """ + } + } + + then { + assertAll( + { assert workflow.success}, + { assert snapshot(workflow.out).match()} + ) + } + } } diff --git a/subworkflows/nf-core/bam_rseqc/tests/main.nf.test.snap b/subworkflows/nf-core/bam_rseqc/tests/main.nf.test.snap index 8bd21052f..0040810cc 100644 --- a/subworkflows/nf-core/bam_rseqc/tests/main.nf.test.snap +++ b/subworkflows/nf-core/bam_rseqc/tests/main.nf.test.snap @@ -1,5 +1,5 @@ { - "bamstat_txt": { + "sarscov2 paired-end [bam]": { "content": [ [ [ @@ -8,98 +8,57 @@ }, "test.bam_stat.txt:md5,2675857864c1d1139b2a19d25dc36b09" ] - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" - }, - "timestamp": "2023-12-08T14:37:45.671792186" - }, - "readduplication_all": { - "content": [ + ], [ [ { "id": "test" }, - "test.DupRate_plot.r:md5,3c0325095cee4835b921e57d61c23dca" + "test.inner_distance.txt:md5,a1acc9def0f64a5500d4c4cb47cbe32b" ], [ { "id": "test" }, - "test.pos.DupRate.xls:md5,a859bc2031d46bf1cc4336205847caa3" + "test.inner_distance_freq.txt:md5,3fc037501f5899b5da009c8ce02fc25e" ], [ { "id": "test" }, - "test.seq.DupRate.xls:md5,ee8783399eec5a18522a6f08bece338b" + "test.inner_distance_mean.txt:md5,58398b7d5a29a5e564f9e3c50b55996c" + ], + [ + { + "id": "test" + }, + "test.inner_distance_plot.r:md5,5859fbd5b42046d47e8b9aa85077f4ea" ] - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" - }, - "timestamp": "2023-12-08T14:37:45.927253593" - }, - "tin_txt": { - "content": [ + ], [ [ { "id": "test" }, - "test.paired_end.sorted.summary.txt:md5,9d98447e178b89a89f6f5aba7a772fe6" + "test.infer_experiment.txt:md5,f9d0bfc239df637cd8aeda40ade3c59a" ] - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" - }, - "timestamp": "2024-02-06T15:29:37.545261" - }, - "junctionsaturation_all": { - "content": [ + ], [ [ { "id": "test" }, - "test.junctionSaturation_plot.r:md5,caa6e63dcb477aabb169882b2f30dadd" + "test.junction_annotation.log:md5,d75e0f5d62fada8aa9449991b209554c" ] - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" - }, - "timestamp": "2023-12-08T14:37:45.825157699" - }, - "versions": { - "content": [ + ], [ - "versions.yml:md5,60dc1afce7fecb7270e998a00ee393e2", - "versions.yml:md5,9bc3caee6aeb54f23f5296b499546515", - "versions.yml:md5,a25161998ca60d5ce4e9a86abbf1bcb8", - "versions.yml:md5,c175b92f50b5be38a8808cbf7ac7452e", - "versions.yml:md5,ca7e95cf7ff7cff5d052b890729f7ead", - "versions.yml:md5,d03beea3c68934c3f3623a005c1424d2", - "versions.yml:md5,f2f3ecd549045f7595245f904f5d9414", - "versions.yml:md5,fd16f1098b9c285f3ea7bd3daf4e8f10" - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" - }, - "timestamp": "2023-12-14T14:58:10.874440924" - }, - "readdistribution_txt": { - "content": [ + [ + { + "id": "test" + }, + "test.junctionSaturation_plot.r:md5,caa6e63dcb477aabb169882b2f30dadd" + ] + ], [ [ { @@ -107,81 +66,838 @@ }, "test.read_distribution.txt:md5,56893fdc0809d968629a363551a1655f" ] - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" - }, - "timestamp": "2023-12-08T14:37:45.841855468" - }, - "innerdistance_all": { - "content": [ + ], [ [ { "id": "test" }, - "test.inner_distance.txt:md5,a1acc9def0f64a5500d4c4cb47cbe32b" + "test.DupRate_plot.r:md5,3c0325095cee4835b921e57d61c23dca" ], [ { "id": "test" }, - "test.inner_distance_freq.txt:md5,3fc037501f5899b5da009c8ce02fc25e" + "test.pos.DupRate.xls:md5,a859bc2031d46bf1cc4336205847caa3" ], [ { "id": "test" }, - "test.inner_distance_mean.txt:md5,58398b7d5a29a5e564f9e3c50b55996c" - ], + "test.seq.DupRate.xls:md5,ee8783399eec5a18522a6f08bece338b" + ] + ], + [ [ { "id": "test" }, - "test.inner_distance_plot.r:md5,5859fbd5b42046d47e8b9aa85077f4ea" + "test.paired_end.sorted.summary.txt:md5,9d98447e178b89a89f6f5aba7a772fe6" ] + ], + [ + "versions.yml:md5,60dc1afce7fecb7270e998a00ee393e2", + "versions.yml:md5,9bc3caee6aeb54f23f5296b499546515", + "versions.yml:md5,a25161998ca60d5ce4e9a86abbf1bcb8", + "versions.yml:md5,c175b92f50b5be38a8808cbf7ac7452e", + "versions.yml:md5,ca7e95cf7ff7cff5d052b890729f7ead", + "versions.yml:md5,d03beea3c68934c3f3623a005c1424d2", + "versions.yml:md5,f2f3ecd549045f7595245f904f5d9414", + "versions.yml:md5,fd16f1098b9c285f3ea7bd3daf4e8f10" ] ], "meta": { "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nextflow": "24.04.2" }, - "timestamp": "2023-12-08T14:37:45.734509133" + "timestamp": "2024-07-03T12:07:54.452949" }, - "inferexperiment_txt": { + "sarscov2 paired-end [bam] - stub": { "content": [ - [ - [ - { - "id": "test" - }, - "test.infer_experiment.txt:md5,f9d0bfc239df637cd8aeda40ade3c59a" + { + "0": [ + [ + { + "id": "test" + }, + "test.bam_stat.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test" + }, + "test.inner_distance.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + [ + { + "id": "test" + }, + "test.inner_distance_freq.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + [ + { + "id": "test" + }, + "test.inner_distance_mean.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + [ + { + "id": "test" + }, + "test.inner_distance_plot.pdf:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + [ + { + "id": "test" + }, + "test.inner_distance_plot.r:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "10": [ + [ + { + "id": "test" + }, + "test.Interact.bed:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "11": [ + [ + { + "id": "test" + }, + "test.junction.xls:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "12": [ + [ + { + "id": "test" + }, + "test.junction.pdf:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "13": [ + [ + { + "id": "test" + }, + "test.events.pdf:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "14": [ + [ + { + "id": "test" + }, + "test.junction_plot.r:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "15": [ + [ + { + "id": "test" + }, + "test.junction_annotation.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "16": [ + [ + { + "id": "test" + }, + "test.junctionSaturation_plot.pdf:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + [ + { + "id": "test" + }, + "test.junctionSaturation_plot.r:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "17": [ + [ + { + "id": "test" + }, + "test.junctionSaturation_plot.pdf:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "18": [ + [ + { + "id": "test" + }, + "test.junctionSaturation_plot.r:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "19": [ + [ + { + "id": "test" + }, + "test.read_distribution.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + [ + { + "id": "test" + }, + "test.inner_distance.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "20": [ + [ + { + "id": "test" + }, + "test.DupRate_plot.pdf:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + [ + { + "id": "test" + }, + "test.DupRate_plot.r:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + [ + { + "id": "test" + }, + "test.pos.DupRate.xls:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + [ + { + "id": "test" + }, + "test.seq.DupRate.xls:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "21": [ + [ + { + "id": "test" + }, + "test.seq.DupRate.xls:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "22": [ + [ + { + "id": "test" + }, + "test.pos.DupRate.xls:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "23": [ + [ + { + "id": "test" + }, + "test.DupRate_plot.pdf:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "24": [ + [ + { + "id": "test" + }, + "test.DupRate_plot.r:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "25": [ + [ + { + "id": "test" + }, + "test.paired_end.sorted.bam.summary.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "26": [ + "versions.yml:md5,60dc1afce7fecb7270e998a00ee393e2", + "versions.yml:md5,9bc3caee6aeb54f23f5296b499546515", + "versions.yml:md5,a25161998ca60d5ce4e9a86abbf1bcb8", + "versions.yml:md5,c175b92f50b5be38a8808cbf7ac7452e", + "versions.yml:md5,ca7e95cf7ff7cff5d052b890729f7ead", + "versions.yml:md5,d03beea3c68934c3f3623a005c1424d2", + "versions.yml:md5,f2f3ecd549045f7595245f904f5d9414", + "versions.yml:md5,fd16f1098b9c285f3ea7bd3daf4e8f10" + ], + "3": [ + [ + { + "id": "test" + }, + "test.inner_distance_freq.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "4": [ + [ + { + "id": "test" + }, + "test.inner_distance_mean.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "5": [ + [ + { + "id": "test" + }, + "test.inner_distance_plot.pdf:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "6": [ + [ + { + "id": "test" + }, + "test.inner_distance_plot.r:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "7": [ + [ + { + "id": "test" + }, + "test.infer_experiment.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "8": [ + [ + { + "id": "test" + }, + "test.Interact.bed:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + [ + { + "id": "test" + }, + "test.events.pdf:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + [ + { + "id": "test" + }, + "test.junction.bed:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + [ + { + "id": "test" + }, + "test.junction.pdf:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + [ + { + "id": "test" + }, + "test.junction.xls:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + [ + { + "id": "test" + }, + "test.junction_annotation.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + [ + { + "id": "test" + }, + "test.junction_plot.r:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "9": [ + [ + { + "id": "test" + }, + "test.junction.bed:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "bamstat_txt": [ + [ + { + "id": "test" + }, + "test.bam_stat.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "inferexperiment_txt": [ + [ + { + "id": "test" + }, + "test.infer_experiment.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "innerdistance_all": [ + [ + { + "id": "test" + }, + "test.inner_distance.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + [ + { + "id": "test" + }, + "test.inner_distance_freq.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + [ + { + "id": "test" + }, + "test.inner_distance_mean.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + [ + { + "id": "test" + }, + "test.inner_distance_plot.pdf:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + [ + { + "id": "test" + }, + "test.inner_distance_plot.r:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "innerdistance_distance": [ + [ + { + "id": "test" + }, + "test.inner_distance.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "innerdistance_freq": [ + [ + { + "id": "test" + }, + "test.inner_distance_freq.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "innerdistance_mean": [ + [ + { + "id": "test" + }, + "test.inner_distance_mean.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "innerdistance_pdf": [ + [ + { + "id": "test" + }, + "test.inner_distance_plot.pdf:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "innerdistance_rscript": [ + [ + { + "id": "test" + }, + "test.inner_distance_plot.r:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "junctionannotation_all": [ + [ + { + "id": "test" + }, + "test.Interact.bed:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + [ + { + "id": "test" + }, + "test.events.pdf:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + [ + { + "id": "test" + }, + "test.junction.bed:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + [ + { + "id": "test" + }, + "test.junction.pdf:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + [ + { + "id": "test" + }, + "test.junction.xls:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + [ + { + "id": "test" + }, + "test.junction_annotation.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + [ + { + "id": "test" + }, + "test.junction_plot.r:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "junctionannotation_bed": [ + [ + { + "id": "test" + }, + "test.junction.bed:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "junctionannotation_events_pdf": [ + [ + { + "id": "test" + }, + "test.events.pdf:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "junctionannotation_interact_bed": [ + [ + { + "id": "test" + }, + "test.Interact.bed:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "junctionannotation_log": [ + [ + { + "id": "test" + }, + "test.junction_annotation.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "junctionannotation_pdf": [ + [ + { + "id": "test" + }, + "test.junction.pdf:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "junctionannotation_rscript": [ + [ + { + "id": "test" + }, + "test.junction_plot.r:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "junctionannotation_xls": [ + [ + { + "id": "test" + }, + "test.junction.xls:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "junctionsaturation_all": [ + [ + { + "id": "test" + }, + "test.junctionSaturation_plot.pdf:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + [ + { + "id": "test" + }, + "test.junctionSaturation_plot.r:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "junctionsaturation_pdf": [ + [ + { + "id": "test" + }, + "test.junctionSaturation_plot.pdf:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "junctionsaturation_rscript": [ + [ + { + "id": "test" + }, + "test.junctionSaturation_plot.r:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "readdistribution_txt": [ + [ + { + "id": "test" + }, + "test.read_distribution.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "readduplication_all": [ + [ + { + "id": "test" + }, + "test.DupRate_plot.pdf:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + [ + { + "id": "test" + }, + "test.DupRate_plot.r:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + [ + { + "id": "test" + }, + "test.pos.DupRate.xls:md5,d41d8cd98f00b204e9800998ecf8427e" + ], + [ + { + "id": "test" + }, + "test.seq.DupRate.xls:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "readduplication_pdf": [ + [ + { + "id": "test" + }, + "test.DupRate_plot.pdf:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "readduplication_pos_xls": [ + [ + { + "id": "test" + }, + "test.pos.DupRate.xls:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "readduplication_rscript": [ + [ + { + "id": "test" + }, + "test.DupRate_plot.r:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "readduplication_seq_xls": [ + [ + { + "id": "test" + }, + "test.seq.DupRate.xls:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "tin_txt": [ + [ + { + "id": "test" + }, + "test.paired_end.sorted.bam.summary.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,60dc1afce7fecb7270e998a00ee393e2", + "versions.yml:md5,9bc3caee6aeb54f23f5296b499546515", + "versions.yml:md5,a25161998ca60d5ce4e9a86abbf1bcb8", + "versions.yml:md5,c175b92f50b5be38a8808cbf7ac7452e", + "versions.yml:md5,ca7e95cf7ff7cff5d052b890729f7ead", + "versions.yml:md5,d03beea3c68934c3f3623a005c1424d2", + "versions.yml:md5,f2f3ecd549045f7595245f904f5d9414", + "versions.yml:md5,fd16f1098b9c285f3ea7bd3daf4e8f10" ] - ] + } ], "meta": { "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nextflow": "24.04.2" }, - "timestamp": "2024-02-06T15:29:37.537104" + "timestamp": "2024-07-03T12:08:17.304769" }, - "junctionannotation_all": { + "sarscov2 paired-end [bam] no modules - stub": { "content": [ - [ - [ - { - "id": "test" - }, - "test.junction_annotation.log:md5,d75e0f5d62fada8aa9449991b209554c" + { + "0": [ + + ], + "1": [ + + ], + "10": [ + + ], + "11": [ + + ], + "12": [ + + ], + "13": [ + + ], + "14": [ + + ], + "15": [ + + ], + "16": [ + + ], + "17": [ + + ], + "18": [ + + ], + "19": [ + + ], + "2": [ + + ], + "20": [ + + ], + "21": [ + + ], + "22": [ + + ], + "23": [ + + ], + "24": [ + + ], + "25": [ + + ], + "26": [ + + ], + "3": [ + + ], + "4": [ + + ], + "5": [ + + ], + "6": [ + + ], + "7": [ + + ], + "8": [ + + ], + "9": [ + + ], + "bamstat_txt": [ + + ], + "inferexperiment_txt": [ + + ], + "innerdistance_all": [ + + ], + "innerdistance_distance": [ + + ], + "innerdistance_freq": [ + + ], + "innerdistance_mean": [ + + ], + "innerdistance_pdf": [ + + ], + "innerdistance_rscript": [ + + ], + "junctionannotation_all": [ + + ], + "junctionannotation_bed": [ + + ], + "junctionannotation_events_pdf": [ + + ], + "junctionannotation_interact_bed": [ + + ], + "junctionannotation_log": [ + + ], + "junctionannotation_pdf": [ + + ], + "junctionannotation_rscript": [ + + ], + "junctionannotation_xls": [ + + ], + "junctionsaturation_all": [ + + ], + "junctionsaturation_pdf": [ + + ], + "junctionsaturation_rscript": [ + + ], + "readdistribution_txt": [ + + ], + "readduplication_all": [ + + ], + "readduplication_pdf": [ + + ], + "readduplication_pos_xls": [ + + ], + "readduplication_rscript": [ + + ], + "readduplication_seq_xls": [ + + ], + "tin_txt": [ + + ], + "versions": [ + ] - ] + } ], "meta": { "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nextflow": "24.04.2" }, - "timestamp": "2023-12-14T17:42:43.31783911" + "timestamp": "2024-07-03T12:08:24.443731" } } \ No newline at end of file diff --git a/subworkflows/nf-core/bam_sort_stats_samtools/tests/main.nf.test b/subworkflows/nf-core/bam_sort_stats_samtools/tests/main.nf.test index 2045512c8..a21782114 100644 --- a/subworkflows/nf-core/bam_sort_stats_samtools/tests/main.nf.test +++ b/subworkflows/nf-core/bam_sort_stats_samtools/tests/main.nf.test @@ -7,9 +7,6 @@ nextflow_workflow { test("test_bam_sort_stats_samtools_single_end") { when { - params { - outdir = "$outputDir" - } workflow { """ input[0] = Channel.of([ @@ -29,9 +26,11 @@ nextflow_workflow { { assert workflow.success}, { assert workflow.out.bam.get(0).get(1) ==~ ".*.bam"}, { assert workflow.out.bai.get(0).get(1) ==~ ".*.bai"}, - { assert snapshot(workflow.out.stats).match("test_bam_sort_stats_samtools_single_end_stats") }, - { assert snapshot(workflow.out.flagstat).match("test_bam_sort_stats_samtools_single_end_flagstats") }, - { assert snapshot(workflow.out.idxstats).match("test_bam_sort_stats_samtools_single_end_idxstats") } + { assert snapshot( + workflow.out.flagstat, + workflow.out.idxstats, + workflow.out.stats, + workflow.out.versions).match() } ) } } @@ -39,9 +38,6 @@ nextflow_workflow { test("test_bam_sort_stats_samtools_paired_end") { when { - params { - outdir = "$outputDir" - } workflow { """ input[0] = Channel.of([ @@ -61,9 +57,65 @@ nextflow_workflow { { assert workflow.success}, { assert workflow.out.bam.get(0).get(1) ==~ ".*.bam"}, { assert workflow.out.bai.get(0).get(1) ==~ ".*.bai"}, - { assert snapshot(workflow.out.stats).match("test_bam_sort_stats_samtools_paired_end_stats") }, - { assert snapshot(workflow.out.flagstat).match("test_bam_sort_stats_samtools_paired_end_flagstats") }, - { assert snapshot(workflow.out.idxstats).match("test_bam_sort_stats_samtools_paired_end_idxstats") } + { assert snapshot( + workflow.out.flagstat, + workflow.out.idxstats, + workflow.out.stats, + workflow.out.versions).match() } + ) + } + } + + test("test_bam_sort_stats_samtools_single_end - stub") { + + options "-stub" + + when { + workflow { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.single_end.bam', checkIfExists: true) + ]) + input[1] = Channel.of([ + [ id:'genome' ], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll( + { assert workflow.success}, + { assert snapshot(workflow.out).match() } + ) + } + } + + test("test_bam_sort_stats_samtools_paired_end - stub") { + + options "-stub" + + when { + workflow { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.bam', checkIfExists: true) + ]) + input[1] = Channel.of([ + [ id:'genome' ], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll( + { assert workflow.success}, + { assert snapshot(workflow.out).match() } ) } } diff --git a/subworkflows/nf-core/bam_sort_stats_samtools/tests/main.nf.test.snap b/subworkflows/nf-core/bam_sort_stats_samtools/tests/main.nf.test.snap index db063837f..b7f4da177 100644 --- a/subworkflows/nf-core/bam_sort_stats_samtools/tests/main.nf.test.snap +++ b/subworkflows/nf-core/bam_sort_stats_samtools/tests/main.nf.test.snap @@ -1,5 +1,5 @@ { - "test_bam_sort_stats_samtools_paired_end_flagstats": { + "test_bam_sort_stats_samtools_single_end": { "content": [ [ [ @@ -7,36 +7,18 @@ "id": "test", "single_end": false }, - "test.flagstat:md5,4f7ffd1e6a5e85524d443209ac97d783" + "test.flagstat:md5,2191911d72575a2358b08b1df64ccb53" ] - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2023-10-22T20:25:03.687121177" - }, - "test_bam_sort_stats_samtools_paired_end_idxstats": { - "content": [ + ], [ [ { "id": "test", "single_end": false }, - "test.idxstats:md5,df60a8c8d6621100d05178c93fb053a2" + "test.idxstats:md5,613e048487662c694aa4a2f73ca96a20" ] - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2023-10-22T20:25:03.709648916" - }, - "test_bam_sort_stats_samtools_single_end_stats": { - "content": [ + ], [ [ { @@ -45,15 +27,22 @@ }, "test.stats:md5,d32de3b3716a11039cef2367c3c1a56e" ] + ], + [ + "versions.yml:md5,494b5530a1aa29fd5867cf655bebbfe1", + "versions.yml:md5,9fcb0cd845bfb1f89d83201bb20649b4", + "versions.yml:md5,bacc323ec4055d6f69f07a09089772d1", + "versions.yml:md5,ce946e97097c6a9ccf834a3f91f6da30", + "versions.yml:md5,d6c8dae685f1b7d050165fc15c7a20b5" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-05-29T07:47:44.044172487" + "timestamp": "2024-07-22T17:02:44.34964" }, - "test_bam_sort_stats_samtools_paired_end_stats": { + "test_bam_sort_stats_samtools_paired_end": { "content": [ [ [ @@ -61,50 +50,281 @@ "id": "test", "single_end": false }, - "test.stats:md5,cca83e4fc9406fc3875b5e60055d6574" + "test.flagstat:md5,4f7ffd1e6a5e85524d443209ac97d783" ] - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" - }, - "timestamp": "2024-05-29T07:47:51.426232891" - }, - "test_bam_sort_stats_samtools_single_end_idxstats": { - "content": [ + ], [ [ { "id": "test", "single_end": false }, - "test.idxstats:md5,613e048487662c694aa4a2f73ca96a20" + "test.idxstats:md5,df60a8c8d6621100d05178c93fb053a2" ] - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-01-18T17:10:02.84631" - }, - "test_bam_sort_stats_samtools_single_end_flagstats": { - "content": [ + ], [ [ { "id": "test", "single_end": false }, - "test.flagstat:md5,2191911d72575a2358b08b1df64ccb53" + "test.stats:md5,cca83e4fc9406fc3875b5e60055d6574" ] + ], + [ + "versions.yml:md5,494b5530a1aa29fd5867cf655bebbfe1", + "versions.yml:md5,9fcb0cd845bfb1f89d83201bb20649b4", + "versions.yml:md5,bacc323ec4055d6f69f07a09089772d1", + "versions.yml:md5,ce946e97097c6a9ccf834a3f91f6da30", + "versions.yml:md5,d6c8dae685f1b7d050165fc15c7a20b5" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T17:03:02.583095" + }, + "test_bam_sort_stats_samtools_single_end - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + + ], + "3": [ + [ + { + "id": "test", + "single_end": false + }, + "test.stats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "4": [ + [ + { + "id": "test", + "single_end": false + }, + "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "5": [ + [ + { + "id": "test", + "single_end": false + }, + "test.idxstats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "6": [ + "versions.yml:md5,494b5530a1aa29fd5867cf655bebbfe1", + "versions.yml:md5,9fcb0cd845bfb1f89d83201bb20649b4", + "versions.yml:md5,bacc323ec4055d6f69f07a09089772d1", + "versions.yml:md5,ce946e97097c6a9ccf834a3f91f6da30", + "versions.yml:md5,d6c8dae685f1b7d050165fc15c7a20b5" + ], + "bai": [ + [ + { + "id": "test", + "single_end": false + }, + "test.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "bam": [ + [ + { + "id": "test", + "single_end": false + }, + "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "csi": [ + + ], + "flagstat": [ + [ + { + "id": "test", + "single_end": false + }, + "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "idxstats": [ + [ + { + "id": "test", + "single_end": false + }, + "test.idxstats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "stats": [ + [ + { + "id": "test", + "single_end": false + }, + "test.stats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,494b5530a1aa29fd5867cf655bebbfe1", + "versions.yml:md5,9fcb0cd845bfb1f89d83201bb20649b4", + "versions.yml:md5,bacc323ec4055d6f69f07a09089772d1", + "versions.yml:md5,ce946e97097c6a9ccf834a3f91f6da30", + "versions.yml:md5,d6c8dae685f1b7d050165fc15c7a20b5" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T17:03:22.328703" + }, + "test_bam_sort_stats_samtools_paired_end - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + + ], + "3": [ + [ + { + "id": "test", + "single_end": false + }, + "test.stats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "4": [ + [ + { + "id": "test", + "single_end": false + }, + "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "5": [ + [ + { + "id": "test", + "single_end": false + }, + "test.idxstats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "6": [ + "versions.yml:md5,494b5530a1aa29fd5867cf655bebbfe1", + "versions.yml:md5,9fcb0cd845bfb1f89d83201bb20649b4", + "versions.yml:md5,bacc323ec4055d6f69f07a09089772d1", + "versions.yml:md5,ce946e97097c6a9ccf834a3f91f6da30", + "versions.yml:md5,d6c8dae685f1b7d050165fc15c7a20b5" + ], + "bai": [ + [ + { + "id": "test", + "single_end": false + }, + "test.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "bam": [ + [ + { + "id": "test", + "single_end": false + }, + "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "csi": [ + + ], + "flagstat": [ + [ + { + "id": "test", + "single_end": false + }, + "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "idxstats": [ + [ + { + "id": "test", + "single_end": false + }, + "test.idxstats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "stats": [ + [ + { + "id": "test", + "single_end": false + }, + "test.stats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,494b5530a1aa29fd5867cf655bebbfe1", + "versions.yml:md5,9fcb0cd845bfb1f89d83201bb20649b4", + "versions.yml:md5,bacc323ec4055d6f69f07a09089772d1", + "versions.yml:md5,ce946e97097c6a9ccf834a3f91f6da30", + "versions.yml:md5,d6c8dae685f1b7d050165fc15c7a20b5" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-01-18T17:10:02.829756" + "timestamp": "2024-07-22T17:03:38.833662" } } \ No newline at end of file diff --git a/subworkflows/nf-core/bam_stats_samtools/tests/main.nf.test b/subworkflows/nf-core/bam_stats_samtools/tests/main.nf.test index 1eabc2b36..4597aea27 100644 --- a/subworkflows/nf-core/bam_stats_samtools/tests/main.nf.test +++ b/subworkflows/nf-core/bam_stats_samtools/tests/main.nf.test @@ -7,9 +7,6 @@ nextflow_workflow { test("test_bam_stats_samtools_single_end") { when { - params { - outdir = "$outputDir" - } workflow { """ input[0] = Channel.of([ @@ -28,9 +25,11 @@ nextflow_workflow { then { assertAll( { assert workflow.success}, - { assert snapshot(workflow.out.stats).match("test_bam_stats_samtools_single_end_stats") }, - { assert snapshot(workflow.out.flagstat).match("test_bam_stats_samtools_single_end_flagstats") }, - { assert snapshot(workflow.out.idxstats).match("test_bam_stats_samtools_single_end_idxstats") } + { assert snapshot( + workflow.out.flagstat, + workflow.out.idxstats, + workflow.out.stats, + workflow.out.versions).match() } ) } } @@ -38,9 +37,6 @@ nextflow_workflow { test("test_bam_stats_samtools_paired_end") { when { - params { - outdir = "$outputDir" - } workflow { """ input[0] = Channel.of([ @@ -59,9 +55,11 @@ nextflow_workflow { then { assertAll( { assert workflow.success }, - { assert snapshot(workflow.out.stats).match("test_bam_stats_samtools_paired_end_stats") }, - { assert snapshot(workflow.out.flagstat).match("test_bam_stats_samtools_paired_end_flagstats") }, - { assert snapshot(workflow.out.idxstats).match("test_bam_stats_samtools_paired_end_idxstats") } + { assert snapshot( + workflow.out.flagstat, + workflow.out.idxstats, + workflow.out.stats, + workflow.out.versions).match() } ) } } @@ -69,9 +67,6 @@ nextflow_workflow { test("test_bam_stats_samtools_paired_end_cram") { when { - params { - outdir = "$outputDir" - } workflow { """ input[0] = Channel.of([ @@ -90,11 +85,96 @@ nextflow_workflow { then { assertAll( { assert workflow.success}, - { assert snapshot(workflow.out.stats).match("test_bam_stats_samtools_paired_end_cram_stats") }, - { assert snapshot(workflow.out.flagstat).match("test_bam_stats_samtools_paired_end_cram_flagstats") }, - { assert snapshot(workflow.out.idxstats).match("test_bam_stats_samtools_paired_end_cram_idxstats") } + { assert snapshot( + workflow.out.flagstat, + workflow.out.idxstats, + workflow.out.stats, + workflow.out.versions).match() } ) } } + test ("test_bam_stats_samtools_single_end - stub") { + + options "-stub" + + when { + workflow { + """ + input[0] = Channel.of([ + [ id:'test', single_end:true ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.single_end.sorted.bam', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.single_end.sorted.bam.bai', checkIfExists: true) + ]) + input[1] = Channel.of([ + [ id:'genome' ], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll( + { assert workflow.success}, + { assert snapshot(workflow.out).match() } + ) + } + } + + test("test_bam_stats_samtools_paired_end - stub") { + + options "-stub" + + when { + workflow { + """ + input[0] = Channel.of([ + [ id:'test', single_end:true ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true) + ]) + input[1] = Channel.of([ + [ id:'genome' ], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll( + { assert workflow.success }, + { assert snapshot(workflow.out).match() } + ) + } + } + + test("test_bam_stats_samtools_paired_end_cram - stub") { + + options "-stub" + + when { + workflow { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram.crai', checkIfExists: true) + ]) + input[1] = Channel.of([ + [ id:'genome' ], + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll( + { assert workflow.success}, + { assert snapshot(workflow.out).match() } + ) + } + } } diff --git a/subworkflows/nf-core/bam_stats_samtools/tests/main.nf.test.snap b/subworkflows/nf-core/bam_stats_samtools/tests/main.nf.test.snap index c2cb4dec0..a3ddcc5ce 100644 --- a/subworkflows/nf-core/bam_stats_samtools/tests/main.nf.test.snap +++ b/subworkflows/nf-core/bam_stats_samtools/tests/main.nf.test.snap @@ -1,59 +1,230 @@ { - "test_bam_stats_samtools_paired_end_cram_flagstats": { + "test_bam_stats_samtools_paired_end - stub": { "content": [ - [ - [ - { - "id": "test", - "single_end": false - }, - "test.flagstat:md5,a53f3d26e2e9851f7d528442bbfe9781" + { + "0": [ + [ + { + "id": "test", + "single_end": true + }, + "test.stats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": true + }, + "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + [ + { + "id": "test", + "single_end": true + }, + "test.idxstats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + "versions.yml:md5,3c485730f712b115bcdc235e7294133b", + "versions.yml:md5,90f593a26a2d53e0f0345df7888f448e", + "versions.yml:md5,9ae003814e63a0907d52eec64d5d3ca3" + ], + "flagstat": [ + [ + { + "id": "test", + "single_end": true + }, + "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "idxstats": [ + [ + { + "id": "test", + "single_end": true + }, + "test.idxstats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "stats": [ + [ + { + "id": "test", + "single_end": true + }, + "test.stats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,3c485730f712b115bcdc235e7294133b", + "versions.yml:md5,90f593a26a2d53e0f0345df7888f448e", + "versions.yml:md5,9ae003814e63a0907d52eec64d5d3ca3" ] - ] + } ], "meta": { "nf-test": "0.8.4", - "nextflow": "24.01.0" + "nextflow": "24.04.2" }, - "timestamp": "2023-11-06T09:31:26.194017574" + "timestamp": "2024-07-03T12:20:06.699297" }, - "test_bam_stats_samtools_paired_end_stats": { + "test_bam_stats_samtools_single_end - stub": { "content": [ - [ - [ - { - "id": "test", - "single_end": true - }, - "test.stats:md5,7afd486ad6abb9a2a3dac90c99e1d87b" + { + "0": [ + [ + { + "id": "test", + "single_end": true + }, + "test.stats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": true + }, + "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + [ + { + "id": "test", + "single_end": true + }, + "test.idxstats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + "versions.yml:md5,3c485730f712b115bcdc235e7294133b", + "versions.yml:md5,90f593a26a2d53e0f0345df7888f448e", + "versions.yml:md5,9ae003814e63a0907d52eec64d5d3ca3" + ], + "flagstat": [ + [ + { + "id": "test", + "single_end": true + }, + "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "idxstats": [ + [ + { + "id": "test", + "single_end": true + }, + "test.idxstats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "stats": [ + [ + { + "id": "test", + "single_end": true + }, + "test.stats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,3c485730f712b115bcdc235e7294133b", + "versions.yml:md5,90f593a26a2d53e0f0345df7888f448e", + "versions.yml:md5,9ae003814e63a0907d52eec64d5d3ca3" ] - ] + } ], "meta": { "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nextflow": "24.04.2" }, - "timestamp": "2024-05-29T07:46:05.502831991" + "timestamp": "2024-07-03T12:19:57.708621" }, - "test_bam_stats_samtools_paired_end_flagstats": { + "test_bam_stats_samtools_paired_end_cram - stub": { "content": [ - [ - [ - { - "id": "test", - "single_end": true - }, - "test.flagstat:md5,4f7ffd1e6a5e85524d443209ac97d783" + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.stats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + [ + { + "id": "test", + "single_end": false + }, + "test.idxstats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + "versions.yml:md5,3c485730f712b115bcdc235e7294133b", + "versions.yml:md5,90f593a26a2d53e0f0345df7888f448e", + "versions.yml:md5,9ae003814e63a0907d52eec64d5d3ca3" + ], + "flagstat": [ + [ + { + "id": "test", + "single_end": false + }, + "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "idxstats": [ + [ + { + "id": "test", + "single_end": false + }, + "test.idxstats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "stats": [ + [ + { + "id": "test", + "single_end": false + }, + "test.stats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,3c485730f712b115bcdc235e7294133b", + "versions.yml:md5,90f593a26a2d53e0f0345df7888f448e", + "versions.yml:md5,9ae003814e63a0907d52eec64d5d3ca3" ] - ] + } ], "meta": { "nf-test": "0.8.4", - "nextflow": "24.01.0" + "nextflow": "24.04.2" }, - "timestamp": "2024-01-18T17:17:27.717482" + "timestamp": "2024-07-03T12:20:17.051493" }, - "test_bam_stats_samtools_single_end_flagstats": { + "test_bam_stats_samtools_single_end": { "content": [ [ [ @@ -63,34 +234,16 @@ }, "test.flagstat:md5,2191911d72575a2358b08b1df64ccb53" ] - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2023-11-06T09:26:10.340046381" - }, - "test_bam_stats_samtools_paired_end_cram_idxstats": { - "content": [ + ], [ [ { "id": "test", - "single_end": false + "single_end": true }, - "test.idxstats:md5,e179601fa7b8ebce81ac3765206f6c15" + "test.idxstats:md5,613e048487662c694aa4a2f73ca96a20" ] - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2023-11-06T09:31:26.207052003" - }, - "test_bam_stats_samtools_single_end_stats": { - "content": [ + ], [ [ { @@ -99,16 +252,30 @@ }, "test.stats:md5,4a0c429c661d6aa0b60acb9309da642d" ] + ], + [ + "versions.yml:md5,3c485730f712b115bcdc235e7294133b", + "versions.yml:md5,90f593a26a2d53e0f0345df7888f448e", + "versions.yml:md5,9ae003814e63a0907d52eec64d5d3ca3" ] ], "meta": { "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nextflow": "24.04.2" }, - "timestamp": "2024-05-29T07:45:59.612412212" + "timestamp": "2024-07-03T12:19:25.801394" }, - "test_bam_stats_samtools_paired_end_idxstats": { + "test_bam_stats_samtools_paired_end": { "content": [ + [ + [ + { + "id": "test", + "single_end": true + }, + "test.flagstat:md5,4f7ffd1e6a5e85524d443209ac97d783" + ] + ], [ [ { @@ -117,34 +284,48 @@ }, "test.idxstats:md5,df60a8c8d6621100d05178c93fb053a2" ] - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-01-18T17:17:27.726719" - }, - "test_bam_stats_samtools_single_end_idxstats": { - "content": [ + ], [ [ { "id": "test", "single_end": true }, - "test.idxstats:md5,613e048487662c694aa4a2f73ca96a20" + "test.stats:md5,7afd486ad6abb9a2a3dac90c99e1d87b" ] + ], + [ + "versions.yml:md5,3c485730f712b115bcdc235e7294133b", + "versions.yml:md5,90f593a26a2d53e0f0345df7888f448e", + "versions.yml:md5,9ae003814e63a0907d52eec64d5d3ca3" ] ], "meta": { "nf-test": "0.8.4", - "nextflow": "24.01.0" + "nextflow": "24.04.2" }, - "timestamp": "2023-11-06T09:26:10.349439801" + "timestamp": "2024-07-03T12:19:36.158768" }, - "test_bam_stats_samtools_paired_end_cram_stats": { + "test_bam_stats_samtools_paired_end_cram": { "content": [ + [ + [ + { + "id": "test", + "single_end": false + }, + "test.flagstat:md5,a53f3d26e2e9851f7d528442bbfe9781" + ] + ], + [ + [ + { + "id": "test", + "single_end": false + }, + "test.idxstats:md5,e179601fa7b8ebce81ac3765206f6c15" + ] + ], [ [ { @@ -153,12 +334,17 @@ }, "test.stats:md5,16b59a1f2c99d9fe30f711adc3ebe32d" ] + ], + [ + "versions.yml:md5,3c485730f712b115bcdc235e7294133b", + "versions.yml:md5,90f593a26a2d53e0f0345df7888f448e", + "versions.yml:md5,9ae003814e63a0907d52eec64d5d3ca3" ] ], "meta": { "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nextflow": "24.04.2" }, - "timestamp": "2024-05-29T07:46:11.96999343" + "timestamp": "2024-07-03T12:19:46.625907" } } \ No newline at end of file diff --git a/subworkflows/nf-core/bedgraph_bedclip_bedgraphtobigwig/tests/main.nf.test b/subworkflows/nf-core/bedgraph_bedclip_bedgraphtobigwig/tests/main.nf.test index 94b66019e..17ec676ca 100644 --- a/subworkflows/nf-core/bedgraph_bedclip_bedgraphtobigwig/tests/main.nf.test +++ b/subworkflows/nf-core/bedgraph_bedclip_bedgraphtobigwig/tests/main.nf.test @@ -4,7 +4,7 @@ nextflow_workflow { script "../main.nf" workflow "BEDGRAPH_BEDCLIP_BEDGRAPHTOBIGWIG" config "./nextflow.config" - + test("sarscov2 [bedgraph] [genome_sizes]") { when { @@ -26,4 +26,28 @@ nextflow_workflow { ) } } + + test("sarscov2 [bedgraph] [genome_sizes] - stub") { + + options "-stub" + + when { + workflow { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bedgraph/test.bedgraph', checkIfExists: true) + ]) + input[1] = Channel.of(file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.sizes', checkIfExists: true)) + """ + } + } + + then { + assertAll( + { assert workflow.success }, + { assert snapshot(workflow.out).match() } + ) + } + } } diff --git a/subworkflows/nf-core/bedgraph_bedclip_bedgraphtobigwig/tests/main.nf.test.snap b/subworkflows/nf-core/bedgraph_bedclip_bedgraphtobigwig/tests/main.nf.test.snap index e67bed326..26ed39c00 100644 --- a/subworkflows/nf-core/bedgraph_bedclip_bedgraphtobigwig/tests/main.nf.test.snap +++ b/subworkflows/nf-core/bedgraph_bedclip_bedgraphtobigwig/tests/main.nf.test.snap @@ -48,6 +48,65 @@ ] } ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, "timestamp": "2023-11-26T01:55:31.016058335" + }, + "sarscov2 [bedgraph] [genome_sizes] - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.bigWig:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.clip.bedGraph:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + "versions.yml:md5,21c57fc724b374139b11f88017251733", + "versions.yml:md5,72a7b07bc0e796ff6805c57f7340337f" + ], + "bedgraph": [ + [ + { + "id": "test", + "single_end": false + }, + "test.clip.bedGraph:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "bigwig": [ + [ + { + "id": "test", + "single_end": false + }, + "test.bigWig:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,21c57fc724b374139b11f88017251733", + "versions.yml:md5,72a7b07bc0e796ff6805c57f7340337f" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-07-03T12:22:51.388076" } } \ No newline at end of file diff --git a/subworkflows/nf-core/fastq_align_hisat2/tests/main.nf.test b/subworkflows/nf-core/fastq_align_hisat2/tests/main.nf.test index 884d130a2..0048b3b33 100644 --- a/subworkflows/nf-core/fastq_align_hisat2/tests/main.nf.test +++ b/subworkflows/nf-core/fastq_align_hisat2/tests/main.nf.test @@ -17,6 +17,19 @@ nextflow_workflow { """ } } + + run("HISAT2_EXTRACTSPLICESITES", alias: "HISAT2_EXTRACTSPLICESITES_STUB") { + script "../../../../modules/nf-core/hisat2/extractsplicesites/main.nf" + process { + """ + input[0] = Channel.of([ + [id: 'test'], + file(params.modules_testdata_base_path + "genomics/sarscov2/genome/genome.gtf", checkIfExists: true) + ]) + """ + } + } + run("HISAT2_BUILD") { script "../../../../modules/nf-core/hisat2/build/main.nf" process { @@ -33,6 +46,23 @@ nextflow_workflow { """ } } + + run("HISAT2_BUILD", alias: "HISAT2_BUILD_STUB") { + script "../../../../modules/nf-core/hisat2/build/main.nf" + process { + """ + input[0] = Channel.of([ + [id: 'test'], + file(params.modules_testdata_base_path + "genomics/sarscov2/genome/genome.fasta", checkIfExists: true) + ]) + input[1] = Channel.of([ + [id: 'test'], + file(params.modules_testdata_base_path + "genomics/sarscov2/genome/genome.gtf", checkIfExists: true) + ]) + input[2] = HISAT2_EXTRACTSPLICESITES_STUB.out.txt + """ + } + } } test("sarscov2 - bam - single_end") { @@ -59,16 +89,17 @@ nextflow_workflow { then { assertAll( { assert workflow.success}, - { assert snapshot(file(workflow.out.bai[0][1]).name).match("se - bai")}, - { assert snapshot(file(workflow.out.bam[0][1]).name).match("se - bam")}, - { assert snapshot(file(workflow.out.orig_bam[0][1]).name).match("se - orig_bam")}, - { assert snapshot(workflow.out.csi).match("se - csi")}, - { assert snapshot(workflow.out.fastq).match("se - fastq")}, - { assert snapshot(workflow.out.flagstat).match("se - flagstat")}, - { assert snapshot(workflow.out.idxstats).match("se - idxstats")}, - { assert snapshot(workflow.out.stats).match("se - stats")}, - { assert snapshot(workflow.out.summary).match("se - summary")}, - { assert snapshot(workflow.out.versions).match("se - versions")} + { assert snapshot( + file(workflow.out.bai[0][1]).name, + file(workflow.out.bam[0][1]).name, + file(workflow.out.orig_bam[0][1]).name, + workflow.out.csi, + workflow.out.fastq, + workflow.out.flagstat, + workflow.out.idxstats, + workflow.out.stats, + workflow.out.summary, + workflow.out.versions).match()} ) } } @@ -97,16 +128,79 @@ nextflow_workflow { then { assertAll( { assert workflow.success}, - { assert snapshot(file(workflow.out.bai[0][1]).name).match("pe - bai")}, - { assert snapshot(file(workflow.out.bam[0][1]).name).match("pe - bam")}, - { assert snapshot(file(workflow.out.orig_bam[0][1]).name).match("pe - orig_bam")}, - { assert snapshot(workflow.out.csi).match("pe - csi")}, - { assert snapshot(workflow.out.fastq).match("pe - fastq")}, - { assert snapshot(workflow.out.flagstat).match("pe - flagstat")}, - { assert snapshot(workflow.out.idxstats).match("pe - idxstats")}, - { assert snapshot(workflow.out.stats).match("pe - stats")}, - { assert snapshot(workflow.out.summary).match("pe - summary")}, - { assert snapshot(workflow.out.versions).match("pe - versions")} + { assert snapshot( + file(workflow.out.bai[0][1]).name, + file(workflow.out.bam[0][1]).name, + file(workflow.out.orig_bam[0][1]).name, + workflow.out.csi, + workflow.out.fastq, + workflow.out.flagstat, + workflow.out.idxstats, + workflow.out.stats, + workflow.out.summary, + workflow.out.versions).match()} + ) + } + } + + test("sarscov2 - bam - single_end - stub") { + + options "-stub" + + when { + workflow { + """ + input[0] = Channel.of([ + [ id:'test', single_end:true ], + [ + file(params.modules_testdata_base_path + "genomics/sarscov2/illumina/fastq/test_1.fastq.gz", checkIfExists: true) + ] + ]) + input[1] = HISAT2_BUILD_STUB.out.index + input[2] = HISAT2_EXTRACTSPLICESITES_STUB.out.txt + input[3] = Channel.of([ + [ id:'test' ], + file(params.modules_testdata_base_path + "genomics/sarscov2/genome/genome.fasta", checkIfExists: true) + ]) + """ + } + } + + then { + assertAll( + { assert workflow.success}, + { assert snapshot(workflow.out).match()} + ) + } + } + test("sarscov2 - bam - paired_end - stub") { + + options "-stub" + + when { + workflow { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], + [ + file(params.modules_testdata_base_path + "genomics/sarscov2/illumina/fastq/test_1.fastq.gz", checkIfExists: true), + file(params.modules_testdata_base_path + "genomics/sarscov2/illumina/fastq/test_2.fastq.gz", checkIfExists: true) + ] + ]) + input[1] = HISAT2_BUILD_STUB.out.index + input[2] = HISAT2_EXTRACTSPLICESITES_STUB.out.txt + input[3] = Channel.of([ + [ id:'test' ], + file(params.modules_testdata_base_path + "genomics/sarscov2/genome/genome.fasta", checkIfExists: true) + ]) + """ + } + } + + then { + assertAll( + { assert workflow.success}, + { assert snapshot(workflow.out).match()} ) } } diff --git a/subworkflows/nf-core/fastq_align_hisat2/tests/main.nf.test.snap b/subworkflows/nf-core/fastq_align_hisat2/tests/main.nf.test.snap index 6a24fc922..408dabff0 100644 --- a/subworkflows/nf-core/fastq_align_hisat2/tests/main.nf.test.snap +++ b/subworkflows/nf-core/fastq_align_hisat2/tests/main.nf.test.snap @@ -1,84 +1,42 @@ { - "pe - stats": { + "sarscov2 - bam - single_end": { "content": [ + "test.sorted.bam.bai", + "test.sorted.bam", + "test.bam", + [ + + ], + [ + + ], [ [ { "id": "test", - "single_end": false + "single_end": true }, - "test.stats:md5,603fa8c9e0e9eb3769498fc989a29250" + "test.flagstat:md5,6de3bfde9582ad2532033832091f5c46" ] - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" - }, - "timestamp": "2024-06-20T17:49:22.610136" - }, - "pe - csi": { - "content": [ + ], [ - - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-02-29T13:28:06.081055" - }, - "se - bai": { - "content": [ - "test.sorted.bam.bai" - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-02-29T13:27:50.763127" - }, - "pe - flagstat": { - "content": [ + [ + { + "id": "test", + "single_end": true + }, + "test.idxstats:md5,2a5df85e0d90e55bb2b359f6e05d5fbb" + ] + ], [ [ { "id": "test", - "single_end": false + "single_end": true }, - "test.flagstat:md5,2fa0d90162a1b655863796c2a6bd8f45" + "test.stats:md5,845655ccfd1fd701b9f692f8db9508af" ] - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-02-29T13:28:06.08653" - }, - "pe - orig_bam": { - "content": [ - "test.bam" - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-02-29T13:28:06.077797" - }, - "se - bam": { - "content": [ - "test.sorted.bam" - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-02-29T13:27:50.773767" - }, - "se - summary": { - "content": [ + ], [ [ { @@ -87,26 +45,7 @@ }, "test.hisat2.summary.log:md5,7b8a9e61b7646da1089b041333c41a87" ] - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-02-29T13:27:50.818659" - }, - "pe - bam": { - "content": [ - "test.sorted.bam" - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-02-29T13:28:06.074968" - }, - "se - versions": { - "content": [ + ], [ "versions.yml:md5,2d9432e15956fe71fe0ba811547acea6", "versions.yml:md5,5fcbed7fee2404be4ecee6efab5914b8", @@ -120,102 +59,211 @@ "nf-test": "0.8.4", "nextflow": "24.04.2" }, - "timestamp": "2024-06-20T17:49:02.049644" + "timestamp": "2024-07-03T12:36:06.813423" }, - "pe - idxstats": { + "sarscov2 - bam - single_end - stub": { "content": [ - [ - [ - { - "id": "test", - "single_end": false - }, - "test.idxstats:md5,1adb27b52d4d64b826f48b59d61dcd4d" + { + "0": [ + [ + { + "id": "test", + "single_end": true + }, + "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": true + }, + "test.hisat2.summary.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + + ], + "3": [ + [ + { + "id": "test", + "single_end": true + }, + "test.sorted.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "4": [ + [ + { + "id": "test", + "single_end": true + }, + "test.sorted.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "5": [ + + ], + "6": [ + [ + { + "id": "test", + "single_end": true + }, + "test.stats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "7": [ + [ + { + "id": "test", + "single_end": true + }, + "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "8": [ + [ + { + "id": "test", + "single_end": true + }, + "test.idxstats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "9": [ + "versions.yml:md5,2d9432e15956fe71fe0ba811547acea6", + "versions.yml:md5,5fcbed7fee2404be4ecee6efab5914b8", + "versions.yml:md5,6b9d9eed13bf074965d1623a7e8a1741", + "versions.yml:md5,7767a57d88fff540ce475902df2e9e0a", + "versions.yml:md5,b4ccce0351e5718d36600858452dd4b1", + "versions.yml:md5,bb6710ee58b84a1ed212f9c599d84066" + ], + "bai": [ + [ + { + "id": "test", + "single_end": true + }, + "test.sorted.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "bam": [ + [ + { + "id": "test", + "single_end": true + }, + "test.sorted.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "csi": [ + + ], + "fastq": [ + + ], + "flagstat": [ + [ + { + "id": "test", + "single_end": true + }, + "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "idxstats": [ + [ + { + "id": "test", + "single_end": true + }, + "test.idxstats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "orig_bam": [ + [ + { + "id": "test", + "single_end": true + }, + "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "stats": [ + [ + { + "id": "test", + "single_end": true + }, + "test.stats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "summary": [ + [ + { + "id": "test", + "single_end": true + }, + "test.hisat2.summary.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,2d9432e15956fe71fe0ba811547acea6", + "versions.yml:md5,5fcbed7fee2404be4ecee6efab5914b8", + "versions.yml:md5,6b9d9eed13bf074965d1623a7e8a1741", + "versions.yml:md5,7767a57d88fff540ce475902df2e9e0a", + "versions.yml:md5,b4ccce0351e5718d36600858452dd4b1", + "versions.yml:md5,bb6710ee58b84a1ed212f9c599d84066" ] - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-02-29T13:28:06.089411" - }, - "pe - bai": { - "content": [ - "test.sorted.bam.bai" + } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-02-29T13:28:06.071767" + "timestamp": "2024-07-22T19:36:23.861012" }, - "pe - fastq": { + "sarscov2 - bam - paired_end": { "content": [ + "test.sorted.bam.bai", + "test.sorted.bam", + "test.bam", [ - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-02-29T13:28:06.083598" - }, - "se - fastq": { - "content": [ + ], [ - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-02-29T13:27:50.782981" - }, - "se - csi": { - "content": [ + ], [ - - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-02-29T13:27:50.77962" - }, - "se - idxstats": { - "content": [ + [ + { + "id": "test", + "single_end": false + }, + "test.flagstat:md5,2fa0d90162a1b655863796c2a6bd8f45" + ] + ], [ [ { "id": "test", - "single_end": true + "single_end": false }, - "test.idxstats:md5,2a5df85e0d90e55bb2b359f6e05d5fbb" + "test.idxstats:md5,1adb27b52d4d64b826f48b59d61dcd4d" ] - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-02-29T13:27:50.798637" - }, - "se - orig_bam": { - "content": [ - "test.bam" - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-02-29T13:27:50.776773" - }, - "pe - summary": { - "content": [ + ], + [ + [ + { + "id": "test", + "single_end": false + }, + "test.stats:md5,603fa8c9e0e9eb3769498fc989a29250" + ] + ], [ [ { @@ -224,16 +272,7 @@ }, "test.hisat2.summary.log:md5,9839b31db795958cc4b70711a3414e9c" ] - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-02-29T13:28:06.095265" - }, - "pe - versions": { - "content": [ + ], [ "versions.yml:md5,2d9432e15956fe71fe0ba811547acea6", "versions.yml:md5,5fcbed7fee2404be4ecee6efab5914b8", @@ -247,42 +286,171 @@ "nf-test": "0.8.4", "nextflow": "24.04.2" }, - "timestamp": "2024-06-20T17:49:22.664338" + "timestamp": "2024-07-03T12:36:25.071168" }, - "se - flagstat": { + "sarscov2 - bam - paired_end - stub": { "content": [ - [ - [ - { - "id": "test", - "single_end": true - }, - "test.flagstat:md5,6de3bfde9582ad2532033832091f5c46" + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.hisat2.summary.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + + ], + "3": [ + [ + { + "id": "test", + "single_end": false + }, + "test.sorted.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "4": [ + [ + { + "id": "test", + "single_end": false + }, + "test.sorted.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "5": [ + + ], + "6": [ + [ + { + "id": "test", + "single_end": false + }, + "test.stats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "7": [ + [ + { + "id": "test", + "single_end": false + }, + "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "8": [ + [ + { + "id": "test", + "single_end": false + }, + "test.idxstats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "9": [ + "versions.yml:md5,2d9432e15956fe71fe0ba811547acea6", + "versions.yml:md5,5fcbed7fee2404be4ecee6efab5914b8", + "versions.yml:md5,6b9d9eed13bf074965d1623a7e8a1741", + "versions.yml:md5,7767a57d88fff540ce475902df2e9e0a", + "versions.yml:md5,b4ccce0351e5718d36600858452dd4b1", + "versions.yml:md5,bb6710ee58b84a1ed212f9c599d84066" + ], + "bai": [ + [ + { + "id": "test", + "single_end": false + }, + "test.sorted.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "bam": [ + [ + { + "id": "test", + "single_end": false + }, + "test.sorted.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "csi": [ + + ], + "fastq": [ + + ], + "flagstat": [ + [ + { + "id": "test", + "single_end": false + }, + "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "idxstats": [ + [ + { + "id": "test", + "single_end": false + }, + "test.idxstats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "orig_bam": [ + [ + { + "id": "test", + "single_end": false + }, + "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "stats": [ + [ + { + "id": "test", + "single_end": false + }, + "test.stats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "summary": [ + [ + { + "id": "test", + "single_end": false + }, + "test.hisat2.summary.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,2d9432e15956fe71fe0ba811547acea6", + "versions.yml:md5,5fcbed7fee2404be4ecee6efab5914b8", + "versions.yml:md5,6b9d9eed13bf074965d1623a7e8a1741", + "versions.yml:md5,7767a57d88fff540ce475902df2e9e0a", + "versions.yml:md5,b4ccce0351e5718d36600858452dd4b1", + "versions.yml:md5,bb6710ee58b84a1ed212f9c599d84066" ] - ] + } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-02-29T13:27:50.786813" - }, - "se - stats": { - "content": [ - [ - [ - { - "id": "test", - "single_end": true - }, - "test.stats:md5,845655ccfd1fd701b9f692f8db9508af" - ] - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-06-20T17:49:01.982358" + "timestamp": "2024-07-22T19:36:44.894976" } } \ No newline at end of file diff --git a/subworkflows/nf-core/fastq_fastqc_umitools_fastp/tests/main.nf.test b/subworkflows/nf-core/fastq_fastqc_umitools_fastp/tests/main.nf.test index 7bcb4b052..48ba5f48b 100644 --- a/subworkflows/nf-core/fastq_fastqc_umitools_fastp/tests/main.nf.test +++ b/subworkflows/nf-core/fastq_fastqc_umitools_fastp/tests/main.nf.test @@ -5,6 +5,15 @@ nextflow_workflow { workflow "FASTQ_FASTQC_UMITOOLS_FASTP" config './nextflow.config' + tag "subworkflows" + tag "subworkflows_nfcore" + tag "subworkflows/fastq_fastqc_umitools_fastp" + tag "fastq_fastqc_umitools_fastp" + tag "fastqc" + tag "umitools/extract" + tag "fastp" + + test("sarscov2 paired-end [fastq]") { when { @@ -43,24 +52,23 @@ nextflow_workflow { then { assertAll( { assert workflow.success }, + { assert workflow.out.fastqc_raw_html }, + { assert workflow.out.fastqc_raw_zip }, + { assert workflow.out.fastqc_trim_html }, + { assert workflow.out.fastqc_trim_zip }, + { assert workflow.out.trim_html }, + { assert workflow.out.trim_log }, { assert snapshot( + workflow.out.adapter_seq, workflow.out.reads, - workflow.out.umi_log, workflow.out.trim_json, + workflow.out.trim_read_count, workflow.out.trim_reads_fail, workflow.out.trim_reads_merged, - workflow.out.adapter_seq, - workflow.out.trim_read_count, + workflow.out.umi_log, workflow.out.versions ).match() - }, - - { assert workflow.out.fastqc_raw_html }, - { assert workflow.out.fastqc_raw_zip }, - { assert workflow.out.trim_html }, - { assert workflow.out.trim_log }, - { assert workflow.out.fastqc_trim_html }, - { assert workflow.out.fastqc_trim_zip } + } ) } } @@ -103,24 +111,23 @@ nextflow_workflow { then { assertAll( { assert workflow.success }, + { assert workflow.out.trim_html }, + { assert workflow.out.trim_log }, + { assert !workflow.out.fastqc_raw_html }, + { assert !workflow.out.fastqc_raw_zip }, + { assert !workflow.out.fastqc_trim_html }, + { assert !workflow.out.fastqc_trim_zip }, { assert snapshot( + workflow.out.adapter_seq, workflow.out.reads, - workflow.out.umi_log, workflow.out.trim_json, + workflow.out.trim_read_count, workflow.out.trim_reads_fail, workflow.out.trim_reads_merged, - workflow.out.adapter_seq, - workflow.out.trim_read_count, + workflow.out.umi_log, workflow.out.versions ).match() - }, - - { assert !workflow.out.fastqc_raw_html }, - { assert !workflow.out.fastqc_raw_zip }, - { assert workflow.out.trim_html }, - { assert workflow.out.trim_log }, - { assert !workflow.out.fastqc_trim_html }, - { assert !workflow.out.fastqc_trim_zip } + } ) } } @@ -163,23 +170,22 @@ nextflow_workflow { then { assertAll( { assert workflow.success }, + { assert workflow.out.fastqc_raw_html }, + { assert workflow.out.fastqc_raw_zip }, + { assert workflow.out.fastqc_trim_html }, + { assert workflow.out.fastqc_trim_zip }, + { assert workflow.out.trim_html }, + { assert workflow.out.trim_log }, { assert snapshot( + workflow.out.adapter_seq, workflow.out.reads, workflow.out.trim_json, + workflow.out.trim_read_count, workflow.out.trim_reads_fail, workflow.out.trim_reads_merged, - workflow.out.adapter_seq, - workflow.out.trim_read_count, workflow.out.versions ).match() - }, - - { assert workflow.out.fastqc_raw_html }, - { assert workflow.out.fastqc_raw_zip }, - { assert workflow.out.trim_html }, - { assert workflow.out.trim_log }, - { assert workflow.out.fastqc_trim_html }, - { assert workflow.out.fastqc_trim_zip } + } ) } } @@ -223,24 +229,23 @@ nextflow_workflow { then { assertAll( { assert workflow.success }, + { assert workflow.out.fastqc_raw_html }, + { assert workflow.out.fastqc_raw_zip }, + { assert workflow.out.fastqc_trim_html }, + { assert workflow.out.fastqc_trim_zip }, + { assert workflow.out.trim_html }, + { assert workflow.out.trim_log }, { assert snapshot( + workflow.out.adapter_seq, workflow.out.reads, - workflow.out.umi_log, workflow.out.trim_json, + workflow.out.trim_read_count, workflow.out.trim_reads_fail, workflow.out.trim_reads_merged, - workflow.out.adapter_seq, - workflow.out.trim_read_count, + workflow.out.umi_log, workflow.out.versions ).match() - }, - - { assert workflow.out.fastqc_raw_html }, - { assert workflow.out.fastqc_raw_zip }, - { assert workflow.out.trim_html }, - { assert workflow.out.trim_log }, - { assert workflow.out.fastqc_trim_html }, - { assert workflow.out.fastqc_trim_zip } + } ) } } @@ -283,24 +288,23 @@ nextflow_workflow { then { assertAll( { assert workflow.success }, + { assert workflow.out.fastqc_raw_html }, + { assert workflow.out.fastqc_raw_zip }, + { assert workflow.out.fastqc_trim_html }, + { assert workflow.out.fastqc_trim_zip }, + { assert workflow.out.trim_html }, + { assert workflow.out.trim_log }, { assert snapshot( + workflow.out.adapter_seq, workflow.out.reads, - workflow.out.umi_log, workflow.out.trim_json, + workflow.out.trim_read_count, workflow.out.trim_reads_fail, workflow.out.trim_reads_merged, - workflow.out.adapter_seq, - workflow.out.trim_read_count, + workflow.out.umi_log, workflow.out.versions ).match() - }, - - { assert workflow.out.fastqc_raw_html }, - { assert workflow.out.fastqc_raw_zip }, - { assert workflow.out.trim_html }, - { assert workflow.out.trim_log }, - { assert workflow.out.fastqc_trim_html }, - { assert workflow.out.fastqc_trim_zip } + } ) } } @@ -343,27 +347,24 @@ nextflow_workflow { then { assertAll( { assert workflow.success }, + { assert workflow.out.fastqc_raw_html }, + { assert workflow.out.fastqc_raw_zip }, + { assert !workflow.out.fastqc_trim_html }, + { assert !workflow.out.fastqc_trim_zip }, + { assert !workflow.out.trim_html }, + { assert !workflow.out.trim_log }, { assert snapshot( + // If we skip trimming then input is output, so not snapshotting + workflow.out.adapter_seq, workflow.out.reads.get(0).get(0), // Reads meta map - // Because the input file is passed to the output file, we have to do check the filename only - file(workflow.out.reads.get(0).get(1).get(0)).name, - file(workflow.out.reads.get(0).get(1).get(1)).name, - workflow.out.umi_log, workflow.out.trim_json, + workflow.out.trim_read_count, workflow.out.trim_reads_fail, workflow.out.trim_reads_merged, - workflow.out.adapter_seq, - workflow.out.trim_read_count, + workflow.out.umi_log, workflow.out.versions ).match() - }, - - { assert workflow.out.fastqc_raw_html }, - { assert workflow.out.fastqc_raw_zip }, - { assert !workflow.out.trim_html }, - { assert !workflow.out.trim_log }, - { assert !workflow.out.fastqc_trim_html }, - { assert !workflow.out.fastqc_trim_zip } + } ) } } @@ -408,24 +409,23 @@ nextflow_workflow { then { assertAll( { assert workflow.success }, + { assert workflow.out.fastqc_raw_html }, + { assert workflow.out.fastqc_raw_zip }, + { assert workflow.out.fastqc_trim_html }, + { assert workflow.out.fastqc_trim_zip }, + { assert workflow.out.trim_html }, + { assert workflow.out.trim_log }, { assert snapshot( + workflow.out.adapter_seq, workflow.out.reads, - workflow.out.umi_log, workflow.out.trim_json, + workflow.out.trim_read_count, workflow.out.trim_reads_fail, workflow.out.trim_reads_merged, - workflow.out.adapter_seq, - workflow.out.trim_read_count, + workflow.out.umi_log, workflow.out.versions ).match() - }, - - { assert workflow.out.fastqc_raw_html }, - { assert workflow.out.fastqc_raw_zip }, - { assert workflow.out.trim_html }, - { assert workflow.out.trim_log }, - { assert workflow.out.fastqc_trim_html }, - { assert workflow.out.fastqc_trim_zip } + } ) } } @@ -468,24 +468,23 @@ nextflow_workflow { then { assertAll( { assert workflow.success }, + { assert workflow.out.fastqc_raw_html }, + { assert workflow.out.fastqc_raw_zip }, + { assert workflow.out.fastqc_trim_html }, + { assert workflow.out.fastqc_trim_zip }, + { assert workflow.out.trim_html }, + { assert workflow.out.trim_log }, { assert snapshot( + workflow.out.adapter_seq, workflow.out.reads, - workflow.out.umi_log, workflow.out.trim_json, + workflow.out.trim_read_count, workflow.out.trim_reads_fail, workflow.out.trim_reads_merged, - workflow.out.adapter_seq, - workflow.out.trim_read_count, + workflow.out.umi_log, workflow.out.versions ).match() - }, - - { assert workflow.out.fastqc_raw_html }, - { assert workflow.out.fastqc_raw_zip }, - { assert workflow.out.trim_html }, - { assert workflow.out.trim_log }, - { assert workflow.out.fastqc_trim_html }, - { assert workflow.out.fastqc_trim_zip } + } ) } } @@ -529,24 +528,23 @@ nextflow_workflow { then { assertAll( { assert workflow.success }, + { assert workflow.out.fastqc_raw_html }, + { assert workflow.out.fastqc_raw_zip }, + { assert workflow.out.fastqc_trim_html }, + { assert workflow.out.fastqc_trim_zip }, + { assert workflow.out.trim_html }, + { assert workflow.out.trim_log }, { assert snapshot( + workflow.out.adapter_seq, workflow.out.reads, - workflow.out.umi_log, workflow.out.trim_json, + workflow.out.trim_read_count, workflow.out.trim_reads_fail, workflow.out.trim_reads_merged, - workflow.out.adapter_seq, - workflow.out.trim_read_count, + workflow.out.umi_log, workflow.out.versions ).match() - }, - - { assert workflow.out.fastqc_raw_html }, - { assert workflow.out.fastqc_raw_zip }, - { assert workflow.out.trim_html }, - { assert workflow.out.trim_log }, - { assert workflow.out.fastqc_trim_html }, - { assert workflow.out.fastqc_trim_zip } + } ) } } @@ -595,4 +593,381 @@ nextflow_workflow { ) } } + + test("skip_fastqc - stub") { + + options "-stub" + + when { + workflow { + """ + skip_fastqc = true + with_umi = false + skip_umi_extract = false + umi_discard_read = 1 + skip_trimming = false + adapter_fasta = [] + save_trimmed_fail = false + save_merged = false + min_trimmed_reads = 1 + + input[0] = Channel.of([ + [ id:'test', single_end: false ], // meta map + [ + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) + ] + ]) + input[1] = skip_fastqc + input[2] = with_umi + input[3] = skip_umi_extract + input[4] = umi_discard_read + input[5] = skip_trimming + input[6] = adapter_fasta + input[7] = save_trimmed_fail + input[8] = save_merged + input[9] = min_trimmed_reads + """ + } + } + + then { + assertAll( + { assert workflow.success }, + { assert snapshot(workflow.out).match() } + ) + } + } + + test("with_umi - stub") { + + options "-stub" + + when { + workflow { + """ + skip_fastqc = false + with_umi = true + skip_umi_extract = false + umi_discard_read = 1 + skip_trimming = false + adapter_fasta = [] + save_trimmed_fail = false + save_merged = false + min_trimmed_reads = 1 + + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) + ] + ]) + input[1] = skip_fastqc + input[2] = with_umi + input[3] = skip_umi_extract + input[4] = umi_discard_read + input[5] = skip_trimming + input[6] = adapter_fasta + input[7] = save_trimmed_fail + input[8] = save_merged + input[9] = min_trimmed_reads + """ + } + } + + then { + assertAll( + { assert workflow.success }, + { assert snapshot(workflow.out).match() } + ) + } + } + + + test("skip_umi_extract - stub") { + + options "-stub" + + when { + workflow { + """ + skip_fastqc = false + with_umi = true + skip_umi_extract = true + umi_discard_read = 1 + skip_trimming = false + adapter_fasta = [] + save_trimmed_fail = false + save_merged = false + min_trimmed_reads = 1 + + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) + ] + ]) + input[1] = skip_fastqc + input[2] = with_umi + input[3] = skip_umi_extract + input[4] = umi_discard_read + input[5] = skip_trimming + input[6] = adapter_fasta + input[7] = save_trimmed_fail + input[8] = save_merged + input[9] = min_trimmed_reads + """ + } + } + + then { + assertAll( + { assert workflow.success }, + { assert snapshot(workflow.out).match() } + ) + } + } + + test("umi_discard_read = 2 - stub") { + + options "-stub" + + when { + workflow { + """ + skip_fastqc = false + with_umi = true + skip_umi_extract = true + umi_discard_read = 2 + skip_trimming = false + adapter_fasta = [] + save_trimmed_fail = false + save_merged = false + min_trimmed_reads = 1 + + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) + ] + ]) + input[1] = skip_fastqc + input[2] = with_umi + input[3] = skip_umi_extract + input[4] = umi_discard_read + input[5] = skip_trimming + input[6] = adapter_fasta + input[7] = save_trimmed_fail + input[8] = save_merged + input[9] = min_trimmed_reads + """ + } + } + + then { + assertAll( + { assert workflow.success }, + { assert snapshot(workflow.out).match() } + ) + } + } + + test("skip_trimming - stub") { + + options "-stub" + + when { + workflow { + """ + skip_fastqc = false + with_umi = false + skip_umi_extract = false + umi_discard_read = 1 + skip_trimming = true + adapter_fasta = [] + save_trimmed_fail = false + save_merged = false + min_trimmed_reads = 1 + + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) + ] + ]) + input[1] = skip_fastqc + input[2] = with_umi + input[3] = skip_umi_extract + input[4] = umi_discard_read + input[5] = skip_trimming + input[6] = adapter_fasta + input[7] = save_trimmed_fail + input[8] = save_merged + input[9] = min_trimmed_reads + """ + } + } + + then { + assertAll( + { assert workflow.success }, + { assert snapshot( + workflow.out.adapter_seq, + workflow.out.fastqc_raw_html, + workflow.out.fastqc_raw_zip, + workflow.out.fastqc_trim_html, + workflow.out.fastqc_trim_zip, + workflow.out.trim_html, + workflow.out.trim_json, + workflow.out.trim_log, + workflow.out.trim_read_count, + workflow.out.trim_reads_fail, + workflow.out.trim_reads_merged, + workflow.out.umi_log, + workflow.out.versions).match() } + ) + } + } + + test("save_trimmed_fail - stub") { + + options "-stub" + + config './nextflow.save_trimmed.config' + + when { + workflow { + """ + skip_fastqc = false + with_umi = false + skip_umi_extract = false + umi_discard_read = 1 + skip_trimming = false + adapter_fasta = [] + save_trimmed_fail = true + save_merged = false + min_trimmed_reads = 1 + + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) + ] + ]) + input[1] = skip_fastqc + input[2] = with_umi + input[3] = skip_umi_extract + input[4] = umi_discard_read + input[5] = skip_trimming + input[6] = adapter_fasta + input[7] = save_trimmed_fail + input[8] = save_merged + input[9] = min_trimmed_reads + """ + } + } + + then { + assertAll( + { assert workflow.success }, + { assert snapshot(workflow.out).match() } + ) + } + } + + test("save_merged - stub") { + + options "-stub" + + when { + workflow { + """ + skip_fastqc = false + with_umi = false + skip_umi_extract = false + umi_discard_read = 1 + skip_trimming = false + adapter_fasta = [] + save_trimmed_fail = false + save_merged = true + min_trimmed_reads = 1 + + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) + ] + ]) + input[1] = skip_fastqc + input[2] = with_umi + input[3] = skip_umi_extract + input[4] = umi_discard_read + input[5] = skip_trimming + input[6] = adapter_fasta + input[7] = save_trimmed_fail + input[8] = save_merged + input[9] = min_trimmed_reads + """ + } + } + + then { + assertAll( + { assert workflow.success }, + { assert snapshot(workflow.out).match() } + ) + } + } + + test("min_trimmed_reads = 26 - stub") { + // Subworkflow should stop after FASTP which trims down to 25 reads + + options "-stub" + + when { + workflow { + """ + skip_fastqc = false + with_umi = false + skip_umi_extract = false + umi_discard_read = 1 + skip_trimming = false + adapter_fasta = [] + save_trimmed_fail = false + save_merged = true + min_trimmed_reads = 26 + + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) + ] + ]) + input[1] = skip_fastqc + input[2] = with_umi + input[3] = skip_umi_extract + input[4] = umi_discard_read + input[5] = skip_trimming + input[6] = adapter_fasta + input[7] = save_trimmed_fail + input[8] = save_merged + input[9] = min_trimmed_reads + """ + } + } + + then { + assertAll( + { assert workflow.success }, + { assert snapshot(workflow.out).match() } + ) + } + } } diff --git a/subworkflows/nf-core/fastq_fastqc_umitools_fastp/tests/main.nf.test.snap b/subworkflows/nf-core/fastq_fastqc_umitools_fastp/tests/main.nf.test.snap index b591fab90..e7d1f51ed 100644 --- a/subworkflows/nf-core/fastq_fastqc_umitools_fastp/tests/main.nf.test.snap +++ b/subworkflows/nf-core/fastq_fastqc_umitools_fastp/tests/main.nf.test.snap @@ -1,36 +1,6 @@ { "skip_fastqc": { "content": [ - [ - [ - { - "id": "test", - "single_end": false - }, - [ - "test_1.fastp.fastq.gz:md5,67b2bbae47f073e05a97a9c2edce23c7", - "test_2.fastp.fastq.gz:md5,25cbdca08e2083dbd4f0502de6b62f39" - ] - ] - ], - [ - - ], - [ - [ - { - "id": "test", - "single_end": false - }, - "test.fastp.json:md5,1e0f8e27e71728e2b63fc64086be95cd" - ] - ], - [ - - ], - [ - - ], [ [ { @@ -40,27 +10,6 @@ "unspecified" ] ], - [ - [ - { - "id": "test", - "single_end": false - }, - 198 - ] - ], - [ - "versions.yml:md5,85bd0117e5778fff18e3920972a296ad" - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" - }, - "timestamp": "2024-06-10T15:08:06.209854813" - }, - "save_trimmed_fail": { - "content": [ [ [ { @@ -68,13 +17,10 @@ "single_end": false }, [ - "test_1.fastp.fastq.gz:md5,6ff32a64c5188b9a9192be1398c262c7", - "test_2.fastp.fastq.gz:md5,db0cb7c9977e94ac2b4b446ebd017a8a" + "test_1.fastp.fastq.gz:md5,67b2bbae47f073e05a97a9c2edce23c7", + "test_2.fastp.fastq.gz:md5,25cbdca08e2083dbd4f0502de6b62f39" ] ] - ], - [ - ], [ [ @@ -82,7 +28,7 @@ "id": "test", "single_end": false }, - "test.fastp.json:md5,4c3268ddb50ea5b33125984776aa3519" + "test.fastp.json:md5,1e0f8e27e71728e2b63fc64086be95cd" ] ], [ @@ -91,47 +37,29 @@ "id": "test", "single_end": false }, - [ - "test.paired.fail.fastq.gz:md5,409b687c734cedd7a1fec14d316e1366", - "test_1.fail.fastq.gz:md5,4f273cf3159c13f79e8ffae12f5661f6", - "test_2.fail.fastq.gz:md5,f97b9edefb5649aab661fbc9e71fc995" - ] + 198 ] ], [ ], [ - [ - { - "id": "test", - "single_end": false - }, - "unspecified" - ] + ], [ - [ - { - "id": "test", - "single_end": false - }, - 162 - ] + ], [ - "versions.yml:md5,85bd0117e5778fff18e3920972a296ad", - "versions.yml:md5,c50aa59475ab901bc6f9a2cf7b1a14e0", - "versions.yml:md5,f3dcaae948e8eed92b4a5557b4c6668e" + "versions.yml:md5,85bd0117e5778fff18e3920972a296ad" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-06-10T15:09:56.338504908" + "timestamp": "2024-07-22T16:56:01.933832" }, - "skip_umi_extract": { + "save_trimmed_fail": { "content": [ [ [ @@ -139,14 +67,8 @@ "id": "test", "single_end": false }, - [ - "test_1.fastp.fastq.gz:md5,67b2bbae47f073e05a97a9c2edce23c7", - "test_2.fastp.fastq.gz:md5,25cbdca08e2083dbd4f0502de6b62f39" - ] + "unspecified" ] - ], - [ - ], [ [ @@ -154,14 +76,11 @@ "id": "test", "single_end": false }, - "test.fastp.json:md5,1e0f8e27e71728e2b63fc64086be95cd" + [ + "test_1.fastp.fastq.gz:md5,6ff32a64c5188b9a9192be1398c262c7", + "test_2.fastp.fastq.gz:md5,db0cb7c9977e94ac2b4b446ebd017a8a" + ] ] - ], - [ - - ], - [ - ], [ [ @@ -169,7 +88,7 @@ "id": "test", "single_end": false }, - "unspecified" + "test.fastp.json:md5,4c3268ddb50ea5b33125984776aa3519" ] ], [ @@ -178,23 +97,9 @@ "id": "test", "single_end": false }, - 198 + 162 ] ], - [ - "versions.yml:md5,85bd0117e5778fff18e3920972a296ad", - "versions.yml:md5,c50aa59475ab901bc6f9a2cf7b1a14e0", - "versions.yml:md5,f3dcaae948e8eed92b4a5557b4c6668e" - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" - }, - "timestamp": "2024-06-10T15:08:51.174735433" - }, - "umi_discard_read = 2": { - "content": [ [ [ { @@ -202,46 +107,17 @@ "single_end": false }, [ - "test_1.fastp.fastq.gz:md5,67b2bbae47f073e05a97a9c2edce23c7", - "test_2.fastp.fastq.gz:md5,25cbdca08e2083dbd4f0502de6b62f39" + "test.paired.fail.fastq.gz:md5,409b687c734cedd7a1fec14d316e1366", + "test_1.fail.fastq.gz:md5,4f273cf3159c13f79e8ffae12f5661f6", + "test_2.fail.fastq.gz:md5,f97b9edefb5649aab661fbc9e71fc995" ] ] ], [ - ], - [ - [ - { - "id": "test", - "single_end": false - }, - "test.fastp.json:md5,1e0f8e27e71728e2b63fc64086be95cd" - ] - ], - [ - ], [ - ], - [ - [ - { - "id": "test", - "single_end": false - }, - "unspecified" - ] - ], - [ - [ - { - "id": "test", - "single_end": false - }, - 198 - ] ], [ "versions.yml:md5,85bd0117e5778fff18e3920972a296ad", @@ -250,12 +126,12 @@ ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-06-10T15:09:14.145250471" + "timestamp": "2024-07-22T16:57:38.736" }, - "save_merged": { + "skip_umi_extract": { "content": [ [ [ @@ -263,26 +139,8 @@ "id": "test", "single_end": false }, - [ - "test_1.fastp.fastq.gz:md5,54b726a55e992a869fd3fa778afe1672", - "test_2.fastp.fastq.gz:md5,29d3b33b869f7b63417b8ff07bb128ba" - ] - ] - ], - [ - - ], - [ - [ - { - "id": "test", - "single_end": false - }, - "test.fastp.json:md5,b712fd68ed0322f4bec49ff2a5237fcc" + "unspecified" ] - ], - [ - ], [ [ @@ -290,7 +148,10 @@ "id": "test", "single_end": false }, - "test.merged.fastq.gz:md5,c873bb1ab3fa859dcc47306465e749d5" + [ + "test_1.fastp.fastq.gz:md5,67b2bbae47f073e05a97a9c2edce23c7", + "test_2.fastp.fastq.gz:md5,25cbdca08e2083dbd4f0502de6b62f39" + ] ] ], [ @@ -299,7 +160,7 @@ "id": "test", "single_end": false }, - "unspecified" + "test.fastp.json:md5,1e0f8e27e71728e2b63fc64086be95cd" ] ], [ @@ -308,37 +169,8 @@ "id": "test", "single_end": false }, - 75 + 198 ] - ], - [ - "versions.yml:md5,85bd0117e5778fff18e3920972a296ad", - "versions.yml:md5,c50aa59475ab901bc6f9a2cf7b1a14e0", - "versions.yml:md5,f3dcaae948e8eed92b4a5557b4c6668e" - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" - }, - "timestamp": "2024-06-10T15:10:16.25526763" - }, - "skip_trimming": { - "content": [ - { - "id": "test", - "single_end": false - }, - "test_1.fastq.gz", - "test_2.fastq.gz", - [ - - ], - [ - - ], - [ - ], [ @@ -350,16 +182,18 @@ ], [ + "versions.yml:md5,85bd0117e5778fff18e3920972a296ad", + "versions.yml:md5,c50aa59475ab901bc6f9a2cf7b1a14e0", "versions.yml:md5,f3dcaae948e8eed92b4a5557b4c6668e" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-03-19T15:49:26.574759" + "timestamp": "2024-07-22T16:56:47.905105" }, - "sarscov2 paired-end [fastq]": { + "umi_discard_read = 2": { "content": [ [ [ @@ -367,14 +201,8 @@ "id": "test", "single_end": false }, - [ - "test_1.fastp.fastq.gz:md5,67b2bbae47f073e05a97a9c2edce23c7", - "test_2.fastp.fastq.gz:md5,25cbdca08e2083dbd4f0502de6b62f39" - ] + "unspecified" ] - ], - [ - ], [ [ @@ -382,14 +210,11 @@ "id": "test", "single_end": false }, - "test.fastp.json:md5,1e0f8e27e71728e2b63fc64086be95cd" + [ + "test_1.fastp.fastq.gz:md5,67b2bbae47f073e05a97a9c2edce23c7", + "test_2.fastp.fastq.gz:md5,25cbdca08e2083dbd4f0502de6b62f39" + ] ] - ], - [ - - ], - [ - ], [ [ @@ -397,7 +222,7 @@ "id": "test", "single_end": false }, - "unspecified" + "test.fastp.json:md5,1e0f8e27e71728e2b63fc64086be95cd" ] ], [ @@ -408,6 +233,15 @@ }, 198 ] + ], + [ + + ], + [ + + ], + [ + ], [ "versions.yml:md5,85bd0117e5778fff18e3920972a296ad", @@ -416,25 +250,238 @@ ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-06-10T15:07:52.031579846" + "timestamp": "2024-07-22T16:57:05.436744" }, - "min_trimmed_reads = 26": { + "umi_discard_read = 2 - stub": { "content": [ - [ - [ - { - "id": "test", - "single_end": false - }, + { + "0": [ [ - "test_1.fastp.fastq.gz:md5,54b726a55e992a869fd3fa778afe1672", - "test_2.fastp.fastq.gz:md5,29d3b33b869f7b63417b8ff07bb128ba" - ] - ] - ], + { + "id": "test", + "single_end": false + }, + [ + "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "10": [ + [ + { + "id": "test", + "single_end": false + }, + 1 + ] + ], + "11": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "12": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "13": [ + "versions.yml:md5,85bd0117e5778fff18e3920972a296ad", + "versions.yml:md5,c50aa59475ab901bc6f9a2cf7b1a14e0", + "versions.yml:md5,f3dcaae948e8eed92b4a5557b4c6668e" + ], + "2": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + + ], + "4": [ + [ + { + "id": "test", + "single_end": false + }, + "" + ] + ], + "5": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "6": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "7": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "8": [ + + ], + "9": [ + + ], + "adapter_seq": [ + [ + { + "id": "test", + "single_end": false + }, + "" + ] + ], + "fastqc_raw_html": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "fastqc_raw_zip": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "fastqc_trim_html": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "fastqc_trim_zip": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "reads": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "trim_html": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "trim_json": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "trim_log": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "trim_read_count": [ + [ + { + "id": "test", + "single_end": false + }, + 1 + ] + ], + "trim_reads_fail": [ + + ], + "trim_reads_merged": [ + + ], + "umi_log": [ + + ], + "versions": [ + "versions.yml:md5,85bd0117e5778fff18e3920972a296ad", + "versions.yml:md5,c50aa59475ab901bc6f9a2cf7b1a14e0", + "versions.yml:md5,f3dcaae948e8eed92b4a5557b4c6668e" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T16:59:27.273892" + }, + "skip_trimming - stub": { + "content": [ [ ], @@ -444,11 +491,8 @@ "id": "test", "single_end": false }, - "test.fastp.json:md5,b712fd68ed0322f4bec49ff2a5237fcc" + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" ] - ], - [ - ], [ [ @@ -456,65 +500,150 @@ "id": "test", "single_end": false }, - "test.merged.fastq.gz:md5,c873bb1ab3fa859dcc47306465e749d5" + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" ] ], [ - [ - { - "id": "test", - "single_end": false - }, - "unspecified" - ] + ], [ - [ - { - "id": "test", - "single_end": false - }, - 75 - ] + ], [ - "versions.yml:md5,85bd0117e5778fff18e3920972a296ad", - "versions.yml:md5,c50aa59475ab901bc6f9a2cf7b1a14e0", - "versions.yml:md5,f3dcaae948e8eed92b4a5557b4c6668e" - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" - }, - "timestamp": "2024-06-10T15:10:34.68796644" - }, - "with_umi": { - "content": [ + + ], [ - [ - { - "id": "test", - "single_end": true + + ], + [ + + ], + [ + + ], + [ + + ], + [ + + ], + [ + + ], + [ + "versions.yml:md5,f3dcaae948e8eed92b4a5557b4c6668e" + ] + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T16:59:39.247758" + }, + "save_merged": { + "content": [ + [ + [ + { + "id": "test", + "single_end": false }, - "test.fastp.fastq.gz:md5,ba8c6c3a7ce718d9a2c5857e2edf53bc" + "unspecified" ] ], [ [ { "id": "test", - "single_end": true + "single_end": false }, - "test.fastp.json:md5,d39c5c6d9a2e35fb60d26ced46569af6" + [ + "test_1.fastp.fastq.gz:md5,54b726a55e992a869fd3fa778afe1672", + "test_2.fastp.fastq.gz:md5,29d3b33b869f7b63417b8ff07bb128ba" + ] + ] + ], + [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.json:md5,b712fd68ed0322f4bec49ff2a5237fcc" + ] + ], + [ + [ + { + "id": "test", + "single_end": false + }, + 75 + ] + ], + [ + + ], + [ + [ + { + "id": "test", + "single_end": false + }, + "test.merged.fastq.gz:md5,c873bb1ab3fa859dcc47306465e749d5" ] ], [ + ], + [ + "versions.yml:md5,85bd0117e5778fff18e3920972a296ad", + "versions.yml:md5,c50aa59475ab901bc6f9a2cf7b1a14e0", + "versions.yml:md5,f3dcaae948e8eed92b4a5557b4c6668e" + ] + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T16:57:57.472342" + }, + "skip_trimming": { + "content": [ + [ + + ], + { + "id": "test", + "single_end": false + }, + [ + + ], + [ + + ], + [ + + ], + [ + ], [ ], + [ + "versions.yml:md5,f3dcaae948e8eed92b4a5557b4c6668e" + ] + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T16:57:19.875543" + }, + "with_umi": { + "content": [ [ [ { @@ -524,6 +653,24 @@ "" ] ], + [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.fastq.gz:md5,ba8c6c3a7ce718d9a2c5857e2edf53bc" + ] + ], + [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.json:md5,d39c5c6d9a2e35fb60d26ced46569af6" + ] + ], [ [ { @@ -532,6 +679,12 @@ }, 99 ] + ], + [ + + ], + [ + ], [ "versions.yml:md5,01f264f78de3c6d893c449cc6d3cd721", @@ -541,12 +694,1492 @@ ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-06-10T15:08:32.267769943" + "timestamp": "2024-07-22T16:56:26.778625" }, - "sarscov2 paired-end [fastq] - stub": { + "min_trimmed_reads = 26": { + "content": [ + [ + [ + { + "id": "test", + "single_end": false + }, + "unspecified" + ] + ], + [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.fastp.fastq.gz:md5,54b726a55e992a869fd3fa778afe1672", + "test_2.fastp.fastq.gz:md5,29d3b33b869f7b63417b8ff07bb128ba" + ] + ] + ], + [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.json:md5,b712fd68ed0322f4bec49ff2a5237fcc" + ] + ], + [ + [ + { + "id": "test", + "single_end": false + }, + 75 + ] + ], + [ + + ], + [ + [ + { + "id": "test", + "single_end": false + }, + "test.merged.fastq.gz:md5,c873bb1ab3fa859dcc47306465e749d5" + ] + ], + [ + + ], + [ + "versions.yml:md5,85bd0117e5778fff18e3920972a296ad", + "versions.yml:md5,c50aa59475ab901bc6f9a2cf7b1a14e0", + "versions.yml:md5,f3dcaae948e8eed92b4a5557b4c6668e" + ] + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T16:58:16.36697" + }, + "min_trimmed_reads = 26 - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "10": [ + [ + { + "id": "test", + "single_end": false + }, + 26 + ] + ], + "11": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "12": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "13": [ + "versions.yml:md5,85bd0117e5778fff18e3920972a296ad", + "versions.yml:md5,c50aa59475ab901bc6f9a2cf7b1a14e0", + "versions.yml:md5,f3dcaae948e8eed92b4a5557b4c6668e" + ], + "2": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + + ], + "4": [ + [ + { + "id": "test", + "single_end": false + }, + "" + ] + ], + "5": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "6": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "7": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "8": [ + + ], + "9": [ + [ + { + "id": "test", + "single_end": false + }, + "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ], + "adapter_seq": [ + [ + { + "id": "test", + "single_end": false + }, + "" + ] + ], + "fastqc_raw_html": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "fastqc_raw_zip": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "fastqc_trim_html": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "fastqc_trim_zip": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "reads": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "trim_html": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "trim_json": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "trim_log": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "trim_read_count": [ + [ + { + "id": "test", + "single_end": false + }, + 26 + ] + ], + "trim_reads_fail": [ + + ], + "trim_reads_merged": [ + [ + { + "id": "test", + "single_end": false + }, + "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ], + "umi_log": [ + + ], + "versions": [ + "versions.yml:md5,85bd0117e5778fff18e3920972a296ad", + "versions.yml:md5,c50aa59475ab901bc6f9a2cf7b1a14e0", + "versions.yml:md5,f3dcaae948e8eed92b4a5557b4c6668e" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T17:00:16.524361" + }, + "with_umi - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "10": [ + [ + { + "id": "test", + "single_end": true + }, + 1 + ] + ], + "11": [ + [ + { + "id": "test", + "single_end": true + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "12": [ + [ + { + "id": "test", + "single_end": true + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "13": [ + "versions.yml:md5,01f264f78de3c6d893c449cc6d3cd721", + "versions.yml:md5,85bd0117e5778fff18e3920972a296ad", + "versions.yml:md5,c50aa59475ab901bc6f9a2cf7b1a14e0", + "versions.yml:md5,f3dcaae948e8eed92b4a5557b4c6668e" + ], + "2": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + [ + { + "id": "test", + "single_end": false + }, + "test.umi_extract.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "4": [ + [ + { + "id": "test", + "single_end": true + }, + "" + ] + ], + "5": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "6": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "7": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "8": [ + + ], + "9": [ + + ], + "adapter_seq": [ + [ + { + "id": "test", + "single_end": true + }, + "" + ] + ], + "fastqc_raw_html": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "fastqc_raw_zip": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "fastqc_trim_html": [ + [ + { + "id": "test", + "single_end": true + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "fastqc_trim_zip": [ + [ + { + "id": "test", + "single_end": true + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "reads": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ], + "trim_html": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "trim_json": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "trim_log": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "trim_read_count": [ + [ + { + "id": "test", + "single_end": true + }, + 1 + ] + ], + "trim_reads_fail": [ + + ], + "trim_reads_merged": [ + + ], + "umi_log": [ + [ + { + "id": "test", + "single_end": false + }, + "test.umi_extract.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,01f264f78de3c6d893c449cc6d3cd721", + "versions.yml:md5,85bd0117e5778fff18e3920972a296ad", + "versions.yml:md5,c50aa59475ab901bc6f9a2cf7b1a14e0", + "versions.yml:md5,f3dcaae948e8eed92b4a5557b4c6668e" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T16:58:56.42517" + }, + "skip_fastqc - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "1": [ + + ], + "10": [ + [ + { + "id": "test", + "single_end": false + }, + 1 + ] + ], + "11": [ + + ], + "12": [ + + ], + "13": [ + "versions.yml:md5,85bd0117e5778fff18e3920972a296ad" + ], + "2": [ + + ], + "3": [ + + ], + "4": [ + [ + { + "id": "test", + "single_end": false + }, + "" + ] + ], + "5": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "6": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "7": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "8": [ + + ], + "9": [ + + ], + "adapter_seq": [ + [ + { + "id": "test", + "single_end": false + }, + "" + ] + ], + "fastqc_raw_html": [ + + ], + "fastqc_raw_zip": [ + + ], + "fastqc_trim_html": [ + + ], + "fastqc_trim_zip": [ + + ], + "reads": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "trim_html": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "trim_json": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "trim_log": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "trim_read_count": [ + [ + { + "id": "test", + "single_end": false + }, + 1 + ] + ], + "trim_reads_fail": [ + + ], + "trim_reads_merged": [ + + ], + "umi_log": [ + + ], + "versions": [ + "versions.yml:md5,85bd0117e5778fff18e3920972a296ad" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T16:58:41.207281" + }, + "save_merged - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "10": [ + [ + { + "id": "test", + "single_end": false + }, + 1 + ] + ], + "11": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "12": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "13": [ + "versions.yml:md5,85bd0117e5778fff18e3920972a296ad", + "versions.yml:md5,c50aa59475ab901bc6f9a2cf7b1a14e0", + "versions.yml:md5,f3dcaae948e8eed92b4a5557b4c6668e" + ], + "2": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + + ], + "4": [ + [ + { + "id": "test", + "single_end": false + }, + "" + ] + ], + "5": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "6": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "7": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "8": [ + + ], + "9": [ + [ + { + "id": "test", + "single_end": false + }, + "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ], + "adapter_seq": [ + [ + { + "id": "test", + "single_end": false + }, + "" + ] + ], + "fastqc_raw_html": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "fastqc_raw_zip": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "fastqc_trim_html": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "fastqc_trim_zip": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "reads": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "trim_html": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "trim_json": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "trim_log": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "trim_read_count": [ + [ + { + "id": "test", + "single_end": false + }, + 1 + ] + ], + "trim_reads_fail": [ + + ], + "trim_reads_merged": [ + [ + { + "id": "test", + "single_end": false + }, + "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ], + "umi_log": [ + + ], + "versions": [ + "versions.yml:md5,85bd0117e5778fff18e3920972a296ad", + "versions.yml:md5,c50aa59475ab901bc6f9a2cf7b1a14e0", + "versions.yml:md5,f3dcaae948e8eed92b4a5557b4c6668e" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T17:00:03.695409" + }, + "sarscov2 paired-end [fastq]": { + "content": [ + [ + [ + { + "id": "test", + "single_end": false + }, + "unspecified" + ] + ], + [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.fastp.fastq.gz:md5,67b2bbae47f073e05a97a9c2edce23c7", + "test_2.fastp.fastq.gz:md5,25cbdca08e2083dbd4f0502de6b62f39" + ] + ] + ], + [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.json:md5,1e0f8e27e71728e2b63fc64086be95cd" + ] + ], + [ + [ + { + "id": "test", + "single_end": false + }, + 198 + ] + ], + [ + + ], + [ + + ], + [ + + ], + [ + "versions.yml:md5,85bd0117e5778fff18e3920972a296ad", + "versions.yml:md5,c50aa59475ab901bc6f9a2cf7b1a14e0", + "versions.yml:md5,f3dcaae948e8eed92b4a5557b4c6668e" + ] + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T16:55:50.614571" + }, + "sarscov2 paired-end [fastq] - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "10": [ + [ + { + "id": "test", + "single_end": false + }, + 1 + ] + ], + "11": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "12": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "13": [ + "versions.yml:md5,85bd0117e5778fff18e3920972a296ad", + "versions.yml:md5,c50aa59475ab901bc6f9a2cf7b1a14e0", + "versions.yml:md5,f3dcaae948e8eed92b4a5557b4c6668e" + ], + "2": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + + ], + "4": [ + [ + { + "id": "test", + "single_end": false + }, + "" + ] + ], + "5": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "6": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "7": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "8": [ + + ], + "9": [ + + ], + "adapter_seq": [ + [ + { + "id": "test", + "single_end": false + }, + "" + ] + ], + "fastqc_raw_html": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "fastqc_raw_zip": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "fastqc_trim_html": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "fastqc_trim_zip": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "reads": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "trim_html": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "trim_json": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "trim_log": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "trim_read_count": [ + [ + { + "id": "test", + "single_end": false + }, + 1 + ] + ], + "trim_reads_fail": [ + + ], + "trim_reads_merged": [ + + ], + "umi_log": [ + + ], + "versions": [ + "versions.yml:md5,85bd0117e5778fff18e3920972a296ad", + "versions.yml:md5,c50aa59475ab901bc6f9a2cf7b1a14e0", + "versions.yml:md5,f3dcaae948e8eed92b4a5557b4c6668e" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T16:58:29.296468" + }, + "save_trimmed_fail - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "10": [ + [ + { + "id": "test", + "single_end": false + }, + 1 + ] + ], + "11": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "12": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "13": [ + "versions.yml:md5,85bd0117e5778fff18e3920972a296ad", + "versions.yml:md5,c50aa59475ab901bc6f9a2cf7b1a14e0", + "versions.yml:md5,f3dcaae948e8eed92b4a5557b4c6668e" + ], + "2": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + + ], + "4": [ + [ + { + "id": "test", + "single_end": false + }, + "" + ] + ], + "5": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "6": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "7": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "8": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.paired.fail.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test_1.fail.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test_2.fail.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "9": [ + + ], + "adapter_seq": [ + [ + { + "id": "test", + "single_end": false + }, + "" + ] + ], + "fastqc_raw_html": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "fastqc_raw_zip": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "fastqc_trim_html": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "fastqc_trim_zip": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "reads": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "trim_html": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "trim_json": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "trim_log": [ + [ + { + "id": "test", + "single_end": false + }, + "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "trim_read_count": [ + [ + { + "id": "test", + "single_end": false + }, + 1 + ] + ], + "trim_reads_fail": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.paired.fail.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test_1.fail.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test_2.fail.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "trim_reads_merged": [ + + ], + "umi_log": [ + + ], + "versions": [ + "versions.yml:md5,85bd0117e5778fff18e3920972a296ad", + "versions.yml:md5,c50aa59475ab901bc6f9a2cf7b1a14e0", + "versions.yml:md5,f3dcaae948e8eed92b4a5557b4c6668e" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T16:59:51.615894" + }, + "skip_umi_extract - stub": { "content": [ { "0": [ @@ -766,9 +2399,9 @@ } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.2" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-06-21T14:46:58.329605" + "timestamp": "2024-07-22T16:59:12.592278" } } \ No newline at end of file diff --git a/subworkflows/nf-core/fastq_fastqc_umitools_trimgalore/tests/main.nf.test b/subworkflows/nf-core/fastq_fastqc_umitools_trimgalore/tests/main.nf.test index 6d01cbbd1..3fffd234b 100644 --- a/subworkflows/nf-core/fastq_fastqc_umitools_trimgalore/tests/main.nf.test +++ b/subworkflows/nf-core/fastq_fastqc_umitools_trimgalore/tests/main.nf.test @@ -28,10 +28,11 @@ nextflow_workflow { assertAll( { assert workflow.success}, { assert path(workflow.out.fastqc_html[0][1]).text.contains("File typeConventional base calls") }, - { assert snapshot(workflow.out.reads).match("se - reads") }, - { assert snapshot(workflow.out.trim_read_count).match("se - trim_read_count") }, - { assert snapshot(workflow.out.trim_unpaired).match("se - trim_unpaired") }, - { assert snapshot(workflow.out.versions).match("se - versions") } + { assert snapshot( + workflow.out.reads, + workflow.out.trim_read_count, + workflow.out.trim_unpaired, + workflow.out.versions).match() } ) } } @@ -61,10 +62,11 @@ nextflow_workflow { then { assertAll( { assert workflow.success}, - { assert snapshot(workflow.out.reads).match("pe - reads") }, - { assert snapshot(workflow.out.trim_read_count).match("pe - trim_read_count") }, - { assert snapshot(workflow.out.trim_unpaired).match("pe - trim_unpaired") }, - { assert snapshot(workflow.out.versions).match("pe - versions") } + { assert snapshot( + workflow.out.reads, + workflow.out.trim_read_count, + workflow.out.trim_unpaired, + workflow.out.versions).match() } ) } } @@ -93,10 +95,11 @@ nextflow_workflow { then { assertAll( { assert workflow.success}, - { assert snapshot(workflow.out.reads).match("pe no umi - reads") }, - { assert snapshot(workflow.out.trim_read_count).match("pe no umi - trim_read_count") }, - { assert snapshot(workflow.out.trim_unpaired).match("pe no umi - trim_unpaired") }, - { assert snapshot(workflow.out.versions).match("pe no umi - versions") } + { assert snapshot( + workflow.out.reads, + workflow.out.trim_read_count, + workflow.out.trim_unpaired, + workflow.out.versions).match() } ) } } @@ -126,9 +129,134 @@ nextflow_workflow { then { assertAll( { assert workflow.success}, - { assert snapshot(workflow.out.trim_read_count).match("pe skip all - trim_read_count") }, - { assert snapshot(workflow.out.trim_unpaired).match("pe skip all - trim_unpaired") }, - { assert snapshot(workflow.out.versions).match("pe skip all - versions") } + { assert snapshot( + workflow.out.trim_read_count, + workflow.out.trim_unpaired, + workflow.out.versions).match() } + ) + } + } + + test("test single end read with UMI - stub") { + + options "-stub" + + when { + workflow { + """ + input[0] = Channel.of([ + [ id:'test', single_end:true ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ] + ]) + input[1] = false // skip_fastqc + input[2] = true // with_umi + input[3] = false // skip_umi_extract + input[4] = false // skip_trimming + input[5] = 1 // umi_discard_read + input[6] = 1 // min_trimmed_reads + """ + } + } + + then { + assertAll( + { assert workflow.success}, + { assert snapshot(workflow.out).match() } + ) + } + } + + test("test paired end read with UMI - stub") { + + options "-stub" + + when { + workflow { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) + ] + ]) + input[1] = false // skip_fastqc + input[2] = true // with_umi + input[3] = false // skip_umi_extract + input[4] = false // skip_trimming + input[5] = 1 // umi_discard_read + input[6] = 1 // min_trimmed_reads + """ + } + } + + then { + assertAll( + { assert workflow.success}, + { assert snapshot(workflow.out).match() } + ) + } + } + test("test paired end read without UMI - stub") { + + options "-stub" + + when { + workflow { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) + ] + ]) + input[1] = false // skip_fastqc + input[2] = false // with_umi + input[3] = false // skip_umi_extract + input[4] = false // skip_trimming + input[5] = 1 // umi_discard_read + input[6] = 1 // min_trimmed_reads + """ + } + } + + then { + assertAll( + { assert workflow.success}, + { assert snapshot(workflow.out).match() } + ) + } + } + + test("test skip all steps - stub") { + + options "-stub" + + when { + workflow { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) + ] + ]) + input[1] = true // skip_fastqc + input[2] = true // with_umi + input[3] = true // skip_umi_extract + input[4] = true // skip_trimming + input[5] = 0 // umi_discard_read + input[6] = 1 // min_trimmed_reads + """ + } + } + + then { + assertAll( + { assert workflow.success} + // No snapshot when skipping all as output is input ) } } diff --git a/subworkflows/nf-core/fastq_fastqc_umitools_trimgalore/tests/main.nf.test.snap b/subworkflows/nf-core/fastq_fastqc_umitools_trimgalore/tests/main.nf.test.snap index 23b5fc9ea..034591495 100644 --- a/subworkflows/nf-core/fastq_fastqc_umitools_trimgalore/tests/main.nf.test.snap +++ b/subworkflows/nf-core/fastq_fastqc_umitools_trimgalore/tests/main.nf.test.snap @@ -1,110 +1,304 @@ { - "pe no umi - reads": { + "test paired end read with UMI - stub": { "content": [ - [ - [ - { - "id": "test", - "single_end": false - }, + { + "0": [ + + ], + "1": [ [ - "test_1_val_1.fq.gz:md5,566d44cca0d22c522d6cf0e50c7165dc", - "test_2_val_2.fq.gz:md5,3c023e8e890b897821df3dc98f48c2b3" + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + [ + { + "id": "test", + "single_end": false + }, + "test.umi_extract.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "4": [ + + ], + "5": [ + + ], + "6": [ + + ], + "7": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastq.gz_trimming_report.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "8": [ + [ + { + "id": "test", + "single_end": true + }, + 0 + ] + ], + "9": [ + "versions.yml:md5,0a5b8fa83ba29cf645bf9e9471cca150", + "versions.yml:md5,3e4b7f058c0aa96ba41c3e4d6df6e839", + "versions.yml:md5,7e740129a23c5ac21c27476e30f8a6d2" + ], + "fastqc_html": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "fastqc_zip": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" ] + ], + "reads": [ + + ], + "trim_html": [ + + ], + "trim_log": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastq.gz_trimming_report.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "trim_read_count": [ + [ + { + "id": "test", + "single_end": true + }, + 0 + ] + ], + "trim_unpaired": [ + + ], + "trim_zip": [ + + ], + "umi_log": [ + [ + { + "id": "test", + "single_end": false + }, + "test.umi_extract.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,0a5b8fa83ba29cf645bf9e9471cca150", + "versions.yml:md5,3e4b7f058c0aa96ba41c3e4d6df6e839", + "versions.yml:md5,7e740129a23c5ac21c27476e30f8a6d2" ] - ] + } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-03-01T14:42:34.197155" + "timestamp": "2024-07-22T17:06:34.919444" }, - "pe skip all - trim_unpaired": { + "test paired end read without UMI - stub": { "content": [ - [ - - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-01T14:42:44.569875" - }, - "pe skip all - versions": { - "content": [ - [ - - ] + { + "0": [ + + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + + ], + "4": [ + + ], + "5": [ + + ], + "6": [ + + ], + "7": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.fastq.gz_trimming_report.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "test_2.fastq.gz_trimming_report.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "8": [ + [ + { + "id": "test", + "single_end": false + }, + 0 + ] + ], + "9": [ + "versions.yml:md5,0a5b8fa83ba29cf645bf9e9471cca150", + "versions.yml:md5,7e740129a23c5ac21c27476e30f8a6d2" + ], + "fastqc_html": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "fastqc_zip": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "reads": [ + + ], + "trim_html": [ + + ], + "trim_log": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.fastq.gz_trimming_report.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "test_2.fastq.gz_trimming_report.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "trim_read_count": [ + [ + { + "id": "test", + "single_end": false + }, + 0 + ] + ], + "trim_unpaired": [ + + ], + "trim_zip": [ + + ], + "umi_log": [ + + ], + "versions": [ + "versions.yml:md5,0a5b8fa83ba29cf645bf9e9471cca150", + "versions.yml:md5,7e740129a23c5ac21c27476e30f8a6d2" + ] + } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-03-01T14:42:44.578583" + "timestamp": "2024-07-22T17:06:51.765414" }, - "pe - trim_read_count": { + "test paired end read without UMI": { "content": [ [ [ { "id": "test", - "single_end": true + "single_end": false }, - 100.0 + [ + "test_1_val_1.fq.gz:md5,566d44cca0d22c522d6cf0e50c7165dc", + "test_2_val_2.fq.gz:md5,3c023e8e890b897821df3dc98f48c2b3" + ] ] - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-01T14:42:16.730434" - }, - "se - trim_read_count": { - "content": [ + ], [ [ { "id": "test", - "single_end": true + "single_end": false }, 100.0 ] - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-01T14:41:56.047953" - }, - "se - trim_unpaired": { - "content": [ + ], [ - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-01T14:41:56.052782" - }, - "pe no umi - trim_unpaired": { - "content": [ + ], [ - + "versions.yml:md5,0a5b8fa83ba29cf645bf9e9471cca150", + "versions.yml:md5,7e740129a23c5ac21c27476e30f8a6d2" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-03-01T14:42:34.210238" + "timestamp": "2024-07-22T17:05:37.366404" }, - "pe - reads": { + "test single end read with UMI": { "content": [ [ [ @@ -112,36 +306,21 @@ "id": "test", "single_end": true }, - "test_trimmed.fq.gz:md5,9c58b78ac2c7b5ce9ca6b090eee1d39c" + "test_trimmed.fq.gz:md5,faae784affdd7d84e2fa9da9e9425229" ] - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-01T14:42:16.720251" - }, - "se - reads": { - "content": [ + ], [ [ { "id": "test", "single_end": true }, - "test_trimmed.fq.gz:md5,faae784affdd7d84e2fa9da9e9425229" + 100.0 ] - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-01T14:41:56.033273" - }, - "se - versions": { - "content": [ + ], + [ + + ], [ "versions.yml:md5,0a5b8fa83ba29cf645bf9e9471cca150", "versions.yml:md5,3e4b7f058c0aa96ba41c3e4d6df6e839", @@ -149,44 +328,34 @@ ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-03-01T14:41:56.056939" + "timestamp": "2024-07-22T17:04:53.072227" }, - "pe no umi - versions": { + "test paired end read with UMI": { "content": [ [ - "versions.yml:md5,0a5b8fa83ba29cf645bf9e9471cca150", - "versions.yml:md5,7e740129a23c5ac21c27476e30f8a6d2" - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-01T14:42:34.216606" - }, - "pe no umi - trim_read_count": { - "content": [ + [ + { + "id": "test", + "single_end": true + }, + "test_trimmed.fq.gz:md5,9c58b78ac2c7b5ce9ca6b090eee1d39c" + ] + ], [ [ { "id": "test", - "single_end": false + "single_end": true }, 100.0 ] - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-03-01T14:42:34.203868" - }, - "pe - versions": { - "content": [ + ], + [ + + ], [ "versions.yml:md5,0a5b8fa83ba29cf645bf9e9471cca150", "versions.yml:md5,3e4b7f058c0aa96ba41c3e4d6df6e839", @@ -194,33 +363,162 @@ ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-03-01T14:42:16.758431" + "timestamp": "2024-07-22T17:05:16.709704" }, - "pe skip all - trim_read_count": { + "test skip all steps": { "content": [ [ + ], + [ + + ], + [ + ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-03-01T14:42:44.557631" + "timestamp": "2024-07-22T17:05:49.455992" }, - "pe - trim_unpaired": { + "test single end read with UMI - stub": { "content": [ - [ - - ] + { + "0": [ + + ], + "1": [ + [ + { + "id": "test", + "single_end": true + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + [ + { + "id": "test", + "single_end": true + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + [ + { + "id": "test", + "single_end": true + }, + "test.umi_extract.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "4": [ + + ], + "5": [ + + ], + "6": [ + + ], + "7": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastq.gz_trimming_report.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "8": [ + [ + { + "id": "test", + "single_end": true + }, + 0 + ] + ], + "9": [ + "versions.yml:md5,0a5b8fa83ba29cf645bf9e9471cca150", + "versions.yml:md5,3e4b7f058c0aa96ba41c3e4d6df6e839", + "versions.yml:md5,7e740129a23c5ac21c27476e30f8a6d2" + ], + "fastqc_html": [ + [ + { + "id": "test", + "single_end": true + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "fastqc_zip": [ + [ + { + "id": "test", + "single_end": true + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "reads": [ + + ], + "trim_html": [ + + ], + "trim_log": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastq.gz_trimming_report.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "trim_read_count": [ + [ + { + "id": "test", + "single_end": true + }, + 0 + ] + ], + "trim_unpaired": [ + + ], + "trim_zip": [ + + ], + "umi_log": [ + [ + { + "id": "test", + "single_end": true + }, + "test.umi_extract.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,0a5b8fa83ba29cf645bf9e9471cca150", + "versions.yml:md5,3e4b7f058c0aa96ba41c3e4d6df6e839", + "versions.yml:md5,7e740129a23c5ac21c27476e30f8a6d2" + ] + } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-03-01T14:42:16.743003" + "timestamp": "2024-07-22T17:06:09.844235" } -} \ No newline at end of file +} diff --git a/subworkflows/nf-core/fastq_qc_trim_filter_setstrandedness/tests/main.nf.test b/subworkflows/nf-core/fastq_qc_trim_filter_setstrandedness/tests/main.nf.test index 5242f2bee..c752e176c 100644 --- a/subworkflows/nf-core/fastq_qc_trim_filter_setstrandedness/tests/main.nf.test +++ b/subworkflows/nf-core/fastq_qc_trim_filter_setstrandedness/tests/main.nf.test @@ -5,21 +5,6 @@ nextflow_workflow { workflow "FASTQ_QC_TRIM_FILTER_SETSTRANDEDNESS" config "./nextflow.config" - tag "subworkflows" - tag "subworkflows_nfcore" - tag "subworkflows/fastq_qc_trim_filter_setstrandedness" - - tag "bbmap/bbsplit" - tag "cat" - tag "cat/fastq" - tag "fastqc" - tag "sortmerna" - tag "subworkflows/fastq_fastqc_umitools_trimgalore" - tag "subworkflows/fastq_fastqc_umitools_fastp" - tag "subworkflows/fastq_subsample_fq_salmon" - - - test("homo_sapiens paired-end [fastq] fastp") { when { diff --git a/subworkflows/nf-core/fastq_qc_trim_filter_setstrandedness/tests/tags.yml b/subworkflows/nf-core/fastq_qc_trim_filter_setstrandedness/tests/tags.yml deleted file mode 100644 index cafd4a33d..000000000 --- a/subworkflows/nf-core/fastq_qc_trim_filter_setstrandedness/tests/tags.yml +++ /dev/null @@ -1,2 +0,0 @@ -subworkflows/preprocess_rnaseq: - - subworkflows/nf-core/preprocess_rnaseq/** diff --git a/subworkflows/nf-core/fastq_subsample_fq_salmon/tests/main.nf.test b/subworkflows/nf-core/fastq_subsample_fq_salmon/tests/main.nf.test index 0a4b29706..077d9c758 100644 --- a/subworkflows/nf-core/fastq_subsample_fq_salmon/tests/main.nf.test +++ b/subworkflows/nf-core/fastq_subsample_fq_salmon/tests/main.nf.test @@ -43,16 +43,61 @@ nextflow_workflow { def readlines2 = path(workflow.out.reads[0][1][1]).linesGzip assertAll( { assert workflow.success }, - { assert snapshot(readlines1[0..5]).match("test_reads_1_lines") }, - { assert snapshot(readlines1.size()).match("test_reads_1_size") }, - { assert snapshot(readlines2[0..5]).match("test_reads_2_lines") }, - { assert snapshot(readlines2.size()).match("test_reads_2_size") }, - { assert snapshot(workflow.out.versions).match("versions") }, - { assert snapshot(workflow.out.lib_format_counts).match("lib_format_counts") }, - { assert workflow.out.index }, + { assert workflow.out.json_info }, { assert workflow.out.results }, - { assert workflow.out.json_info } + { assert snapshot( + readlines1[0..5], + readlines1.size(), + readlines2[0..5], + readlines2.size(), + workflow.out.lib_format_counts, + workflow.out.versions).match() } + ) + } + } + + test("homo_sapiens paired-end [fastq] - stub") { + + options "-stub" + + setup { + run("SALMON_INDEX") { + script "../../../../modules/nf-core/salmon/index/main.nf" + process { + """ + input[0] = Channel.of(file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)) // genome_fasta + input[1] = Channel.of(file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/transcriptome.fasta', checkIfExists: true)) // transcriptome_fasta + """ + } + } + } + + when { + workflow { + """ + make_index = false + + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ] + ]) + input[1] = Channel.of(file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)) // genome_fasta + input[2] = Channel.of(file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/transcriptome.fasta', checkIfExists: true)) // transcriptome_fasta + input[3] = Channel.of(file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true)) // genome_gtf + input[4] = SALMON_INDEX.out.index + input[5] = make_index + """ + } + } + + then { + def readlines1 = path(workflow.out.reads[0][1][0]).linesGzip + def readlines2 = path(workflow.out.reads[0][1][1]).linesGzip + assertAll( + { assert workflow.success }, + { assert snapshot(workflow.out).match() } ) } } diff --git a/subworkflows/nf-core/fastq_subsample_fq_salmon/tests/main.nf.test.snap b/subworkflows/nf-core/fastq_subsample_fq_salmon/tests/main.nf.test.snap index 8bef73cc4..e0c944f31 100644 --- a/subworkflows/nf-core/fastq_subsample_fq_salmon/tests/main.nf.test.snap +++ b/subworkflows/nf-core/fastq_subsample_fq_salmon/tests/main.nf.test.snap @@ -1,28 +1,5 @@ { - "test_reads_1_size": { - "content": [ - 1066944 - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" - }, - "timestamp": "2024-06-14T10:32:16.109988" - }, - "versions": { - "content": [ - [ - "versions.yml:md5,12c0d1f67c2afb97470ae0974e5e01bb", - "versions.yml:md5,885fde9e7beac002b3a17b66b92db4bd" - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" - }, - "timestamp": "2024-06-14T10:32:16.112471" - }, - "test_reads_1_lines": { + "homo_sapiens paired-end [fastq]": { "content": [ [ "@normal#21#998579#1/1", @@ -31,16 +8,8 @@ "102302000331;3333;23133320233330*33/233333333333333/313232333/3;3;3/333000;11/00;;01//103*1032323233", "@normal#21#998572#2/1", "CTCCTCTCCTTCTACCTGCTGGGGTTGCTTGTCAGTAGCGGGCAAGGTCGGAGTGTTGCGCTTTATTGCATTTACTTTCCCTCCCCCTTCCACCCGGCCA" - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" - }, - "timestamp": "2024-06-14T10:32:16.108208" - }, - "test_reads_2_lines": { - "content": [ + ], + 1066944, [ "@normal#21#998579#1/2", "AAAAAAAAAGAAGAAGCAGAAGCTGTTTCCCTGGATATCCTGCTCACCGATTCCCCTCTCCAATTCTGTATTTTCCCTTCTCTTATTTAAGGGTCTCCAC", @@ -48,26 +17,8 @@ "023333233332333310333302333211/3333;0300;*/;000/32;201003031/22;21333032;;11/23030322;2332333313/030", "@normal#21#998572#2/2", "TTCCCCTCTCCAATTGAGTATTTTCCCTTCTCTTATTTAAGGGTCTCCACACAAACAGATACAATTTTAGGGACAGCTAGGAGAAAGAACGAAAATAATAA" - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" - }, - "timestamp": "2024-06-14T10:32:16.111188" - }, - "test_reads_2_size": { - "content": [ - 1066944 - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" - }, - "timestamp": "2024-06-14T10:32:16.111792" - }, - "lib_format_counts": { - "content": [ + ], + 1066944, [ [ { @@ -76,12 +27,155 @@ }, "test_lib_format_counts.json:md5,0b0e2dc090e5ad88f9a9d6dbe9c3e4a0" ] + ], + [ + "versions.yml:md5,12c0d1f67c2afb97470ae0974e5e01bb", + "versions.yml:md5,885fde9e7beac002b3a17b66b92db4bd" ] ], "meta": { "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nextflow": "24.04.2" + }, + "timestamp": "2024-07-03T15:08:35.832206" + }, + "homo_sapiens paired-end [fastq] - stub": { + "content": [ + { + "0": [ + [ + "complete_ref_lens.bin:md5,d41d8cd98f00b204e9800998ecf8427e", + "ctable.bin:md5,d41d8cd98f00b204e9800998ecf8427e", + "ctg_offsets.bin:md5,d41d8cd98f00b204e9800998ecf8427e", + "duplicate_clusters.tsv:md5,d41d8cd98f00b204e9800998ecf8427e", + "info.json:md5,d41d8cd98f00b204e9800998ecf8427e", + "mphf.bin:md5,d41d8cd98f00b204e9800998ecf8427e", + "pos.bin:md5,d41d8cd98f00b204e9800998ecf8427e", + "pre_indexing.log:md5,d41d8cd98f00b204e9800998ecf8427e", + "rank.bin:md5,d41d8cd98f00b204e9800998ecf8427e", + "refAccumLengths.bin:md5,d41d8cd98f00b204e9800998ecf8427e", + "ref_indexing.log:md5,d41d8cd98f00b204e9800998ecf8427e", + "reflengths.bin:md5,d41d8cd98f00b204e9800998ecf8427e", + "refseq.bin:md5,d41d8cd98f00b204e9800998ecf8427e", + "seq.bin:md5,d41d8cd98f00b204e9800998ecf8427e", + "versionInfo.json:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_R1.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test_R2.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "2": [ + [ + { + "id": "test", + "single_end": false + }, + [ + + ] + ] + ], + "3": [ + [ + { + "id": "test", + "single_end": false + }, + "test_meta_info.json:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "4": [ + [ + { + "id": "test", + "single_end": false + }, + "test_lib_format_counts.json:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "5": [ + "versions.yml:md5,12c0d1f67c2afb97470ae0974e5e01bb", + "versions.yml:md5,885fde9e7beac002b3a17b66b92db4bd" + ], + "index": [ + [ + "complete_ref_lens.bin:md5,d41d8cd98f00b204e9800998ecf8427e", + "ctable.bin:md5,d41d8cd98f00b204e9800998ecf8427e", + "ctg_offsets.bin:md5,d41d8cd98f00b204e9800998ecf8427e", + "duplicate_clusters.tsv:md5,d41d8cd98f00b204e9800998ecf8427e", + "info.json:md5,d41d8cd98f00b204e9800998ecf8427e", + "mphf.bin:md5,d41d8cd98f00b204e9800998ecf8427e", + "pos.bin:md5,d41d8cd98f00b204e9800998ecf8427e", + "pre_indexing.log:md5,d41d8cd98f00b204e9800998ecf8427e", + "rank.bin:md5,d41d8cd98f00b204e9800998ecf8427e", + "refAccumLengths.bin:md5,d41d8cd98f00b204e9800998ecf8427e", + "ref_indexing.log:md5,d41d8cd98f00b204e9800998ecf8427e", + "reflengths.bin:md5,d41d8cd98f00b204e9800998ecf8427e", + "refseq.bin:md5,d41d8cd98f00b204e9800998ecf8427e", + "seq.bin:md5,d41d8cd98f00b204e9800998ecf8427e", + "versionInfo.json:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "json_info": [ + [ + { + "id": "test", + "single_end": false + }, + "test_meta_info.json:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "lib_format_counts": [ + [ + { + "id": "test", + "single_end": false + }, + "test_lib_format_counts.json:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "reads": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_R1.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test_R2.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "results": [ + [ + { + "id": "test", + "single_end": false + }, + [ + + ] + ] + ], + "versions": [ + "versions.yml:md5,12c0d1f67c2afb97470ae0974e5e01bb", + "versions.yml:md5,885fde9e7beac002b3a17b66b92db4bd" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" }, - "timestamp": "2024-06-14T10:32:16.114075" + "timestamp": "2024-07-03T15:08:56.819" } } \ No newline at end of file diff --git a/subworkflows/nf-core/quantify_pseudo_alignment/tests/main.nf.test b/subworkflows/nf-core/quantify_pseudo_alignment/tests/main.nf.test index 21004870a..d0a59629e 100644 --- a/subworkflows/nf-core/quantify_pseudo_alignment/tests/main.nf.test +++ b/subworkflows/nf-core/quantify_pseudo_alignment/tests/main.nf.test @@ -50,24 +50,23 @@ nextflow_workflow { assertAll( { assert workflow.success }, { assert snapshot( - workflow.out.tpm_gene, + file(workflow.out.merged_gene_rds[0][1]).name, + file(workflow.out.merged_gene_rds_length_scaled[0][1]).name, + file(workflow.out.merged_gene_rds_scaled[0][1]).name, + file(workflow.out.merged_transcript_rds[0][1]).name, workflow.out.counts_gene, - workflow.out.lengths_gene, workflow.out.counts_gene_length_scaled, - workflow.out.tpm_transcript, + workflow.out.lengths_gene, workflow.out.lengths_transcript, workflow.out.merged_counts_transcript, workflow.out.merged_tpm_transcript, - workflow.out.versions, - file(workflow.out.merged_gene_rds[0][1]).name, - file(workflow.out.merged_gene_rds_length_scaled[0][1]).name, - file(workflow.out.merged_gene_rds_scaled[0][1]).name, - file(workflow.out.merged_transcript_rds[0][1]).name + workflow.out.tpm_gene, + workflow.out.tpm_transcript, + workflow.out.versions ).match() } ) } - } test("kallisto") { @@ -86,7 +85,6 @@ nextflow_workflow { } } - when { workflow { """ @@ -119,22 +117,126 @@ nextflow_workflow { assertAll( { assert workflow.success }, { assert snapshot( - workflow.out.tpm_gene, - workflow.out.counts_gene, - workflow.out.lengths_gene, - workflow.out.counts_gene_length_scaled, - workflow.out.tpm_transcript, - workflow.out.lengths_transcript, - workflow.out.versions, file(workflow.out.merged_gene_rds[0][1]).name, file(workflow.out.merged_gene_rds_length_scaled[0][1]).name, file(workflow.out.merged_gene_rds_scaled[0][1]).name, - file(workflow.out.merged_transcript_rds[0][1]).name + file(workflow.out.merged_transcript_rds[0][1]).name, + workflow.out.counts_gene, + workflow.out.counts_gene_length_scaled, + workflow.out.lengths_gene, + workflow.out.lengths_transcript, + workflow.out.tpm_gene, + workflow.out.tpm_transcript, + workflow.out.versions ).match() } ) } + } + + test("salmon - stub") { + + options "-stub" + + setup { + run("SALMON_INDEX") { + script "../../../../modules/nf-core/salmon/index/main.nf" + process { + """ + input[0] = Channel.of([file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/genome.fasta", checkIfExists: true)]) + input[1] = Channel.of([file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/transcriptome.fasta", checkIfExists: true)]) + """ + } + } + } + + when { + workflow { + """ + input[0] = [ + [ id: 'samplesheet' ], + file(params.modules_testdata_base_path + '/genomics/sarscov2/illumina/csv/samplesheet_micro.csv', checkIfExists: true) + ] + input[1] = [ + [ id: 'test' ], + [ + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_2.fastq.gz', checkIfExists: true) + ] + ] + input[2] = SALMON_INDEX.out.index + input[3] = Channel.of(file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/transcriptome.fasta", checkIfExists: true)) + input[4] = Channel.of(file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/genome.gtf", checkIfExists: true)) + input[5] = 'gene_id' + input[6] = 'gene_name' + input[7] = 'salmon' + input[8] = false + input[9] = 'A' + input[10] = null + input[11] = null + """ + } + } + then { + assertAll( + { assert workflow.success }, + { assert snapshot(workflow.out).match()} + ) + } } + test("kallisto - stub") { + + options "-stub" + + setup { + run("KALLISTO_INDEX") { + script "../../../../modules/nf-core/kallisto/index/main.nf" + process { + """ + input[0] = Channel.of([ + [ id:'transcriptome' ], // meta map + file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/transcriptome.fasta", checkIfExists: true) + ]) + """ + } + } + } + + when { + workflow { + """ + input[0] = [ + [ id: 'samplesheet' ], + file(params.modules_testdata_base_path + '/genomics/sarscov2/illumina/csv/samplesheet_micro.csv', checkIfExists: true) + ] + input[1] = [ + [ id: 'test' ], + [ + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_2.fastq.gz', checkIfExists: true) + ] + ] + input[2] = KALLISTO_INDEX.out.index + input[3] = Channel.of(file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/transcriptome.fasta", checkIfExists: true)) + input[4] = Channel.of(file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/genome.gtf", checkIfExists: true)) + input[5] = 'gene_id' + input[6] = 'gene_name' + input[7] = 'kallisto' + input[8] = null + input[9] = null + input[10] = [] + input[11] = [] + """ + } + } + + then { + assertAll( + { assert workflow.success }, + { assert snapshot(workflow.out).match()} + ) + } + } } diff --git a/subworkflows/nf-core/quantify_pseudo_alignment/tests/main.nf.test.snap b/subworkflows/nf-core/quantify_pseudo_alignment/tests/main.nf.test.snap index c5f435665..4db35cced 100644 --- a/subworkflows/nf-core/quantify_pseudo_alignment/tests/main.nf.test.snap +++ b/subworkflows/nf-core/quantify_pseudo_alignment/tests/main.nf.test.snap @@ -1,12 +1,16 @@ { "kallisto": { "content": [ + "all_samples.SummarizedExperiment.rds", + "all_samples.SummarizedExperiment.rds", + "all_samples.SummarizedExperiment.rds", + "all_samples.SummarizedExperiment.rds", [ [ { "id": "all_samples" }, - "all_samples.gene_tpm.tsv:md5,23fa0c64cfbd198806b53897de791b8b" + "all_samples.gene_counts.tsv:md5,4ba44e5ebc9ed0ca2ca008d10a1dddc3" ] ], [ @@ -14,7 +18,7 @@ { "id": "all_samples" }, - "all_samples.gene_counts.tsv:md5,4ba44e5ebc9ed0ca2ca008d10a1dddc3" + "all_samples.gene_counts_length_scaled.tsv:md5,078746568e3fd0c995559352b661b2d9" ] ], [ @@ -30,7 +34,7 @@ { "id": "all_samples" }, - "all_samples.gene_counts_length_scaled.tsv:md5,078746568e3fd0c995559352b661b2d9" + "all_samples.transcript_lengths.tsv:md5,131952a97905469ab012f0f46e52405c" ] ], [ @@ -38,7 +42,7 @@ { "id": "all_samples" }, - "all_samples.transcript_tpm.tsv:md5,de458e1c2a579e53bd7671c5176f5d0c" + "all_samples.gene_tpm.tsv:md5,23fa0c64cfbd198806b53897de791b8b" ] ], [ @@ -46,7 +50,7 @@ { "id": "all_samples" }, - "all_samples.transcript_lengths.tsv:md5,131952a97905469ab012f0f46e52405c" + "all_samples.transcript_tpm.tsv:md5,de458e1c2a579e53bd7671c5176f5d0c" ] ], [ @@ -54,26 +58,532 @@ "versions.yml:md5,d5243289a32cde9e90e20f1a202bb566", "versions.yml:md5,e9e7d18c3de83f1113fb1ff0c55d35ed", "versions.yml:md5,ea39658f8685118d81d42acd451e66ea" - ], - "all_samples.SummarizedExperiment.rds", - "all_samples.SummarizedExperiment.rds", - "all_samples.SummarizedExperiment.rds", - "all_samples.SummarizedExperiment.rds" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-07-03T15:36:19.861809" + }, + "salmon - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + [ + + ] + ] + ], + "1": [ + [ + { + "id": "test" + }, + [ + + ] + ] + ], + "10": [ + [ + { + "id": "all_samples" + }, + "all_samples.SummarizedExperiment.rds:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "11": [ + [ + { + "id": "all_samples" + }, + "all_samples.SummarizedExperiment.rds:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "12": [ + [ + { + "id": "all_samples" + }, + "all_samples.SummarizedExperiment.rds:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "13": [ + [ + { + "id": "all_samples" + }, + "all_samples.SummarizedExperiment.rds:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "14": [ + "versions.yml:md5,4c3564e1ba17d8ce2b0ee784251ddd87", + "versions.yml:md5,7afb76ee798ceb1e5dff5879d28ef85a", + "versions.yml:md5,d5243289a32cde9e90e20f1a202bb566", + "versions.yml:md5,e9e7d18c3de83f1113fb1ff0c55d35ed" + ], + "2": [ + [ + { + "id": "all_samples" + }, + "all_samples.gene_tpm.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + [ + { + "id": "all_samples" + }, + "all_samples.gene_counts.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "4": [ + [ + { + "id": "all_samples" + }, + "all_samples.gene_lengths.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "5": [ + [ + { + "id": "all_samples" + }, + "all_samples.gene_counts_length_scaled.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "6": [ + [ + { + "id": "all_samples" + }, + "all_samples.gene_counts_scaled.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "7": [ + [ + { + "id": "all_samples" + }, + "all_samples.transcript_tpm.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "8": [ + [ + { + "id": "all_samples" + }, + "all_samples.transcript_counts.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "9": [ + [ + { + "id": "all_samples" + }, + "all_samples.transcript_lengths.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "counts_gene": [ + [ + { + "id": "all_samples" + }, + "all_samples.gene_counts.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "counts_gene_length_scaled": [ + [ + { + "id": "all_samples" + }, + "all_samples.gene_counts_length_scaled.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "counts_gene_scaled": [ + [ + { + "id": "all_samples" + }, + "all_samples.gene_counts_scaled.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "counts_transcript": [ + [ + { + "id": "all_samples" + }, + "all_samples.transcript_counts.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "lengths_gene": [ + [ + { + "id": "all_samples" + }, + "all_samples.gene_lengths.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "lengths_transcript": [ + [ + { + "id": "all_samples" + }, + "all_samples.transcript_lengths.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "merged_gene_rds": [ + [ + { + "id": "all_samples" + }, + "all_samples.SummarizedExperiment.rds:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "merged_gene_rds_length_scaled": [ + [ + { + "id": "all_samples" + }, + "all_samples.SummarizedExperiment.rds:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "merged_gene_rds_scaled": [ + [ + { + "id": "all_samples" + }, + "all_samples.SummarizedExperiment.rds:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "merged_transcript_rds": [ + [ + { + "id": "all_samples" + }, + "all_samples.SummarizedExperiment.rds:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "multiqc": [ + [ + { + "id": "test" + }, + [ + + ] + ] + ], + "results": [ + [ + { + "id": "test" + }, + [ + + ] + ] + ], + "tpm_gene": [ + [ + { + "id": "all_samples" + }, + "all_samples.gene_tpm.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "tpm_transcript": [ + [ + { + "id": "all_samples" + }, + "all_samples.transcript_tpm.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,4c3564e1ba17d8ce2b0ee784251ddd87", + "versions.yml:md5,7afb76ee798ceb1e5dff5879d28ef85a", + "versions.yml:md5,d5243289a32cde9e90e20f1a202bb566", + "versions.yml:md5,e9e7d18c3de83f1113fb1ff0c55d35ed" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-07-03T15:36:55.281379" + }, + "kallisto - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + [ + + ] + ] + ], + "1": [ + [ + { + "id": "test" + }, + "test.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "10": [ + [ + { + "id": "all_samples" + }, + "all_samples.SummarizedExperiment.rds:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "11": [ + [ + { + "id": "all_samples" + }, + "all_samples.SummarizedExperiment.rds:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "12": [ + [ + { + "id": "all_samples" + }, + "all_samples.SummarizedExperiment.rds:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "13": [ + [ + { + "id": "all_samples" + }, + "all_samples.SummarizedExperiment.rds:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "14": [ + "versions.yml:md5,7afb76ee798ceb1e5dff5879d28ef85a", + "versions.yml:md5,d5243289a32cde9e90e20f1a202bb566", + "versions.yml:md5,e9e7d18c3de83f1113fb1ff0c55d35ed", + "versions.yml:md5,ea39658f8685118d81d42acd451e66ea" + ], + "2": [ + [ + { + "id": "all_samples" + }, + "all_samples.gene_tpm.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + [ + { + "id": "all_samples" + }, + "all_samples.gene_counts.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "4": [ + [ + { + "id": "all_samples" + }, + "all_samples.gene_lengths.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "5": [ + [ + { + "id": "all_samples" + }, + "all_samples.gene_counts_length_scaled.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "6": [ + [ + { + "id": "all_samples" + }, + "all_samples.gene_counts_scaled.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "7": [ + [ + { + "id": "all_samples" + }, + "all_samples.transcript_tpm.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "8": [ + [ + { + "id": "all_samples" + }, + "all_samples.transcript_counts.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "9": [ + [ + { + "id": "all_samples" + }, + "all_samples.transcript_lengths.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "counts_gene": [ + [ + { + "id": "all_samples" + }, + "all_samples.gene_counts.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "counts_gene_length_scaled": [ + [ + { + "id": "all_samples" + }, + "all_samples.gene_counts_length_scaled.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "counts_gene_scaled": [ + [ + { + "id": "all_samples" + }, + "all_samples.gene_counts_scaled.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "counts_transcript": [ + [ + { + "id": "all_samples" + }, + "all_samples.transcript_counts.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "lengths_gene": [ + [ + { + "id": "all_samples" + }, + "all_samples.gene_lengths.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "lengths_transcript": [ + [ + { + "id": "all_samples" + }, + "all_samples.transcript_lengths.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "merged_gene_rds": [ + [ + { + "id": "all_samples" + }, + "all_samples.SummarizedExperiment.rds:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "merged_gene_rds_length_scaled": [ + [ + { + "id": "all_samples" + }, + "all_samples.SummarizedExperiment.rds:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "merged_gene_rds_scaled": [ + [ + { + "id": "all_samples" + }, + "all_samples.SummarizedExperiment.rds:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "merged_transcript_rds": [ + [ + { + "id": "all_samples" + }, + "all_samples.SummarizedExperiment.rds:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "multiqc": [ + [ + { + "id": "test" + }, + "test.log:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "results": [ + [ + { + "id": "test" + }, + [ + + ] + ] + ], + "tpm_gene": [ + [ + { + "id": "all_samples" + }, + "all_samples.gene_tpm.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "tpm_transcript": [ + [ + { + "id": "all_samples" + }, + "all_samples.transcript_tpm.tsv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,7afb76ee798ceb1e5dff5879d28ef85a", + "versions.yml:md5,d5243289a32cde9e90e20f1a202bb566", + "versions.yml:md5,e9e7d18c3de83f1113fb1ff0c55d35ed", + "versions.yml:md5,ea39658f8685118d81d42acd451e66ea" + ] + } ], "meta": { "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nextflow": "24.04.2" }, - "timestamp": "2024-05-28T12:54:12.855884" + "timestamp": "2024-07-03T15:37:29.239014" }, "salmon": { "content": [ + "all_samples.SummarizedExperiment.rds", + "all_samples.SummarizedExperiment.rds", + "all_samples.SummarizedExperiment.rds", + "all_samples.SummarizedExperiment.rds", [ [ { "id": "all_samples" }, - "all_samples.gene_tpm.tsv:md5,9711ed8364c3a1ea4fc87bd5e0780835" + "all_samples.gene_counts.tsv:md5,865a4706b8bf47f476d8298fdd344902" ] ], [ @@ -81,7 +591,7 @@ { "id": "all_samples" }, - "all_samples.gene_counts.tsv:md5,865a4706b8bf47f476d8298fdd344902" + "all_samples.gene_counts_length_scaled.tsv:md5,46194b28815747fe3c3d5a619fa994a7" ] ], [ @@ -97,15 +607,17 @@ { "id": "all_samples" }, - "all_samples.gene_counts_length_scaled.tsv:md5,46194b28815747fe3c3d5a619fa994a7" + "all_samples.transcript_lengths.tsv:md5,f39a15fea56a5a8e5776dcdda0c8f102" ] ], + null, + null, [ [ { "id": "all_samples" }, - "all_samples.transcript_tpm.tsv:md5,e0c16bf083ebb88bcfaf27cfba12d3e9" + "all_samples.gene_tpm.tsv:md5,9711ed8364c3a1ea4fc87bd5e0780835" ] ], [ @@ -113,26 +625,20 @@ { "id": "all_samples" }, - "all_samples.transcript_lengths.tsv:md5,f39a15fea56a5a8e5776dcdda0c8f102" + "all_samples.transcript_tpm.tsv:md5,e0c16bf083ebb88bcfaf27cfba12d3e9" ] ], - null, - null, [ "versions.yml:md5,4c3564e1ba17d8ce2b0ee784251ddd87", "versions.yml:md5,b44caeec65491d47e098c7ddaf024b96", "versions.yml:md5,d5243289a32cde9e90e20f1a202bb566", "versions.yml:md5,e9e7d18c3de83f1113fb1ff0c55d35ed" - ], - "all_samples.SummarizedExperiment.rds", - "all_samples.SummarizedExperiment.rds", - "all_samples.SummarizedExperiment.rds", - "all_samples.SummarizedExperiment.rds" + ] ], "meta": { "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nextflow": "24.04.2" }, - "timestamp": "2024-05-28T12:53:39.46319" + "timestamp": "2024-07-03T15:35:48.954002" } } \ No newline at end of file diff --git a/tests/default.nf.test b/tests/default.nf.test index b086c6db3..fb4fc2f29 100644 --- a/tests/default.nf.test +++ b/tests/default.nf.test @@ -14,24 +14,41 @@ nextflow_pipeline { then { assertAll( { assert workflow.success }, - { assert snapshot(UTILS.removeNextflowVersion("$outputDir/pipeline_info/nf_core_rnaseq_software_mqc_versions.yml")).match("software_versions") }, { assert snapshot( - path("${params.outdir}/salmon/salmon.merged.transcript_counts.tsv"), - path("${params.outdir}/custom/out/genome_gfp.fasta"), - path("${params.outdir}/custom/out/genome_gfp.gtf"), - path("${params.outdir}/star_salmon/bigwig/RAP1_IAA_30M_REP1.forward.bigWig"), - path("${params.outdir}/star_salmon/bigwig/RAP1_IAA_30M_REP1.reverse.bigWig"), - path("${params.outdir}/star_salmon/bigwig/RAP1_UNINDUCED_REP1.forward.bigWig"), - path("${params.outdir}/star_salmon/bigwig/RAP1_UNINDUCED_REP1.reverse.bigWig"), - path("${params.outdir}/star_salmon/bigwig/RAP1_UNINDUCED_REP2.forward.bigWig"), - path("${params.outdir}/star_salmon/bigwig/RAP1_UNINDUCED_REP2.reverse.bigWig"), - path("${params.outdir}/star_salmon/bigwig/WT_REP1.forward.bigWig"), - path("${params.outdir}/star_salmon/bigwig/WT_REP1.reverse.bigWig"), - path("${params.outdir}/star_salmon/bigwig/WT_REP2.forward.bigWig"), - path("${params.outdir}/star_salmon/bigwig/WT_REP2.reverse.bigWig") - ).match("output_files") + UTILS.removeNextflowVersion("$outputDir/pipeline_info/nf_core_rnaseq_software_mqc_versions.yml"), + path("${params.outdir}/custom/out/genome_gfp.fasta"), + path("${params.outdir}/custom/out/genome_gfp.gtf"), + path("${params.outdir}/salmon/salmon.merged.transcript_counts.tsv"), + path("${params.outdir}/star_salmon/bigwig/RAP1_IAA_30M_REP1.forward.bigWig"), + path("${params.outdir}/star_salmon/bigwig/RAP1_IAA_30M_REP1.reverse.bigWig"), + path("${params.outdir}/star_salmon/bigwig/RAP1_UNINDUCED_REP1.forward.bigWig"), + path("${params.outdir}/star_salmon/bigwig/RAP1_UNINDUCED_REP1.reverse.bigWig"), + path("${params.outdir}/star_salmon/bigwig/RAP1_UNINDUCED_REP2.forward.bigWig"), + path("${params.outdir}/star_salmon/bigwig/RAP1_UNINDUCED_REP2.reverse.bigWig"), + path("${params.outdir}/star_salmon/bigwig/WT_REP1.forward.bigWig"), + path("${params.outdir}/star_salmon/bigwig/WT_REP1.reverse.bigWig"), + path("${params.outdir}/star_salmon/bigwig/WT_REP2.forward.bigWig"), + path("${params.outdir}/star_salmon/bigwig/WT_REP2.reverse.bigWig")).match() } ) } } + + test("Params: default - stub") { + + options "-stub" + + when { + params { + outdir = "$outputDir" + } + } + + then { + assertAll( + { assert workflow.success }, + { assert snapshot(UTILS.removeNextflowVersion("$outputDir/pipeline_info/nf_core_rnaseq_software_mqc_versions.yml")).match() } + ) + } + } } diff --git a/tests/default.nf.test.snap b/tests/default.nf.test.snap index 83b22815a..7371218e8 100644 --- a/tests/default.nf.test.snap +++ b/tests/default.nf.test.snap @@ -1,9 +1,20 @@ { - "output_files": { + "Params: default - stub": { "content": [ - "salmon.merged.transcript_counts.tsv:md5,ff0f5be09ca7a322672c0074ba35da17", + "{BBMAP_BBSPLIT={bbmap=39.01}, CAT_FASTQ={cat=8.3}, CUSTOM_CATADDITIONALFASTA={python=null}, CUSTOM_GETCHROMSIZES={getchromsizes=1.2}, FASTQC={fastqc=0.12.1}, GTF2BED={perl=5.26.2}, GTF_FILTER={python=3.9.5}, GUNZIP_ADDITIONAL_FASTA={gunzip=1.1}, GUNZIP_GTF={gunzip=1.1}, STAR_GENOMEGENERATE={star=2.7.10a, samtools=1.18, gawk=5.1.0}, TRIMGALORE={trimgalore=0.6.7, cutadapt=3.4}, UNTAR_SALMON_INDEX={untar=1.34}, Workflow={nf-core/rnaseq=v3.15.0dev}}" + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-12T16:33:33.623985" + }, + "Params: default": { + "content": [ + "{BBMAP_BBSPLIT={bbmap=39.01}, BEDTOOLS_GENOMECOV_FW={bedtools=2.31.1}, CAT_FASTQ={cat=8.3}, CUSTOM_CATADDITIONALFASTA={python=3.9.5}, CUSTOM_GETCHROMSIZES={getchromsizes=1.2}, CUSTOM_TX2GENE={python=3.9.5}, DESEQ2_QC_PSEUDO={r-base=4.0.3, bioconductor-deseq2=1.28.0}, DESEQ2_QC_STAR_SALMON={r-base=4.0.3, bioconductor-deseq2=1.28.0}, DUPRADAR={bioconductor-dupradar=1.32.0}, FASTQC={fastqc=0.12.1}, FQ_SUBSAMPLE={fq=0.9.1 (2022-02-22)}, GTF2BED={perl=5.26.2}, GTF_FILTER={python=3.9.5}, GUNZIP_ADDITIONAL_FASTA={gunzip=1.1}, GUNZIP_GTF={gunzip=1.1}, MULTIQC_CUSTOM_BIOTYPE={python=3.9.5}, PICARD_MARKDUPLICATES={picard=3.1.1}, QUALIMAP_RNASEQ={qualimap=2.3}, RSEQC_BAMSTAT={rseqc=5.0.2}, RSEQC_INFEREXPERIMENT={rseqc=5.0.2}, RSEQC_INNERDISTANCE={rseqc=5.0.2}, RSEQC_JUNCTIONANNOTATION={rseqc=5.0.2}, RSEQC_JUNCTIONSATURATION={rseqc=5.0.2}, RSEQC_READDISTRIBUTION={rseqc=5.0.2}, RSEQC_READDUPLICATION={rseqc=5.0.2}, SALMON_QUANT={salmon=1.10.1}, SAMTOOLS_FLAGSTAT={samtools=1.2}, SAMTOOLS_IDXSTATS={samtools=1.2}, SAMTOOLS_INDEX={samtools=1.2}, SAMTOOLS_SORT={samtools=1.2}, SAMTOOLS_STATS={samtools=1.2}, SE_GENE={bioconductor-summarizedexperiment=1.32.0}, STAR_ALIGN={star=2.7.10a, samtools=1.18, gawk=5.1.0}, STAR_GENOMEGENERATE={star=2.7.10a, samtools=1.18, gawk=5.1.0}, STRINGTIE_STRINGTIE={stringtie=2.2.1}, SUBREAD_FEATURECOUNTS={subread=2.0.1}, TRIMGALORE={trimgalore=0.6.7, cutadapt=3.4}, TXIMETA_TXIMPORT={bioconductor-tximeta=1.20.1}, UCSC_BEDCLIP={ucsc=377}, UCSC_BEDGRAPHTOBIGWIG={ucsc=445}, UNTAR_SALMON_INDEX={untar=1.34}, Workflow={nf-core/rnaseq=v3.15.0dev}}", "genome_gfp.fasta:md5,e23e302af63736a199985a169fdac055", "genome_gfp.gtf:md5,c98b12c302f15731bfc36bcf297cfe28", + "salmon.merged.transcript_counts.tsv:md5,ff0f5be09ca7a322672c0074ba35da17", "RAP1_IAA_30M_REP1.forward.bigWig:md5,0abafd7a9f9035469c003fd3dabd73e8", "RAP1_IAA_30M_REP1.reverse.bigWig:md5,0f1e9ac71fc0b99785f06ecb860ef00e", "RAP1_UNINDUCED_REP1.forward.bigWig:md5,09e8d65e21ac92e9a3b78afe3acdf28b", @@ -17,18 +28,8 @@ ], "meta": { "nf-test": "0.8.4", - "nextflow": "24.04.1" - }, - "timestamp": "2024-06-27T15:38:12.586958" - }, - "software_versions": { - "content": [ - "{BBMAP_BBSPLIT={bbmap=39.01}, BEDTOOLS_GENOMECOV_FW={bedtools=2.31.1}, CAT_FASTQ={cat=8.3}, CUSTOM_CATADDITIONALFASTA={python=3.9.5}, CUSTOM_GETCHROMSIZES={getchromsizes=1.2}, CUSTOM_TX2GENE={python=3.9.5}, DESEQ2_QC_PSEUDO={r-base=4.0.3, bioconductor-deseq2=1.28.0}, DESEQ2_QC_STAR_SALMON={r-base=4.0.3, bioconductor-deseq2=1.28.0}, DUPRADAR={bioconductor-dupradar=1.32.0}, FASTQC={fastqc=0.12.1}, FQ_SUBSAMPLE={fq=0.9.1 (2022-02-22)}, GTF2BED={perl=5.26.2}, GTF_FILTER={python=3.9.5}, GUNZIP_ADDITIONAL_FASTA={gunzip=1.1}, GUNZIP_GTF={gunzip=1.1}, MULTIQC_CUSTOM_BIOTYPE={python=3.9.5}, PICARD_MARKDUPLICATES={picard=3.1.1}, QUALIMAP_RNASEQ={qualimap=2.3}, RSEQC_BAMSTAT={rseqc=5.0.2}, RSEQC_INFEREXPERIMENT={rseqc=5.0.2}, RSEQC_INNERDISTANCE={rseqc=5.0.2}, RSEQC_JUNCTIONANNOTATION={rseqc=5.0.2}, RSEQC_JUNCTIONSATURATION={rseqc=5.0.2}, RSEQC_READDISTRIBUTION={rseqc=5.0.2}, RSEQC_READDUPLICATION={rseqc=5.0.2}, SALMON_QUANT={salmon=1.10.1}, SAMTOOLS_FLAGSTAT={samtools=1.2}, SAMTOOLS_IDXSTATS={samtools=1.2}, SAMTOOLS_INDEX={samtools=1.2}, SAMTOOLS_SORT={samtools=1.2}, SAMTOOLS_STATS={samtools=1.2}, SE_GENE={bioconductor-summarizedexperiment=1.32.0}, STAR_ALIGN={star=2.7.10a, samtools=1.18, gawk=5.1.0}, STAR_GENOMEGENERATE={star=2.7.10a, samtools=1.18, gawk=5.1.0}, STRINGTIE_STRINGTIE={stringtie=2.2.1}, SUBREAD_FEATURECOUNTS={subread=2.0.1}, TRIMGALORE={trimgalore=0.6.7, cutadapt=3.4}, TXIMETA_TXIMPORT={bioconductor-tximeta=1.20.1}, UCSC_BEDCLIP={ucsc=377}, UCSC_BEDGRAPHTOBIGWIG={ucsc=445}, UNTAR_SALMON_INDEX={untar=1.3}, Workflow={nf-core/rnaseq=v3.15.0dev}}" - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.04.1" + "nextflow": "24.04.3" }, - "timestamp": "2024-06-27T15:38:12.576022" + "timestamp": "2024-07-12T16:32:22.039132" } -} \ No newline at end of file +}