diff --git a/.github/workflows/ci.yml b/.github/workflows/ci.yml
index b6747cce5..8346f837c 100644
--- a/.github/workflows/ci.yml
+++ b/.github/workflows/ci.yml
@@ -5,7 +5,7 @@ on:
env:
NXF_ANSI_LOG: false
- NFT_VER: "0.8.4"
+ NFT_VER: "0.9.0"
NFT_WORKDIR: "~"
NFT_DIFF: "pdiff"
NFT_DIFF_ARGS: "--line-numbers --expand-tabs=2"
diff --git a/CHANGELOG.md b/CHANGELOG.md
index dad3ea168..7e06350e8 100644
--- a/CHANGELOG.md
+++ b/CHANGELOG.md
@@ -102,6 +102,7 @@ Thank you to everyone else that has contributed by reporting bugs, enhancements
- [PR #1330](https://github.com/nf-core/rnaseq/pull/1330) - Update all nf-core/modules and subworkflows
- [PR #1331](https://github.com/nf-core/rnaseq/pull/1331) - Adding stubs for local modules
- [PR #1334](https://github.com/nf-core/rnaseq/pull/1334) - Update all nf-core/modules and subworkflows with stubs
+- [PR #1335](https://github.com/nf-core/rnaseq/pull/1335) - Adding stubs at all levels
- [PR #1336](https://github.com/nf-core/rnaseq/pull/1334) - Use nf-core/setup-nf-test to install nf-test from cache during CI/CD
- [PR #1340](https://github.com/nf-core/rnaseq/pull/1340) - Remove out-of-date Azure specific guidance
- [PR #1341](https://github.com/nf-core/rnaseq/pull/1341) - Add rename in the MultiQC report for samples without techreps
@@ -137,6 +138,7 @@ Thank you to everyone else that has contributed by reporting bugs, enhancements
| `samtools` | 1.17 | 1.20 |
| `sortmerna` | 4.3.4 | 4.3.6 |
| `umi_tools` | 1.14 | 1.15 |
+| `untar` | 1.3 | 1.34 |
> **NB:** Dependency has been **updated** if both old and new version information is present.
>
diff --git a/modules.json b/modules.json
index 93774f80e..a01086438 100644
--- a/modules.json
+++ b/modules.json
@@ -7,7 +7,7 @@
"nf-core": {
"bbmap/bbsplit": {
"branch": "master",
- "git_sha": "2c6b1144ed58b6184ad58fc4e6b6a90219b4bf4f",
+ "git_sha": "1ceaa8ba4d0fd886dbca0e545815d905b7407de7",
"installed_by": ["fastq_qc_trim_filter_setstrandedness", "modules"]
},
"bedtools/genomecov": {
@@ -17,22 +17,22 @@
},
"cat/fastq": {
"branch": "master",
- "git_sha": "4fc983ad0b30e6e32696fa7d980c76c7bfe1c03e",
+ "git_sha": "1ceaa8ba4d0fd886dbca0e545815d905b7407de7",
"installed_by": ["fastq_qc_trim_filter_setstrandedness", "modules"]
},
"custom/catadditionalfasta": {
"branch": "master",
- "git_sha": "2c6b1144ed58b6184ad58fc4e6b6a90219b4bf4f",
+ "git_sha": "1ceaa8ba4d0fd886dbca0e545815d905b7407de7",
"installed_by": ["modules"]
},
"custom/getchromsizes": {
"branch": "master",
- "git_sha": "41a4135c502b42ede663af87efa70a96ecbd7cb9",
+ "git_sha": "1ceaa8ba4d0fd886dbca0e545815d905b7407de7",
"installed_by": ["modules"]
},
"custom/tx2gene": {
"branch": "master",
- "git_sha": "82024cf6325d2ee194e7f056d841ecad2f6856e9",
+ "git_sha": "4e5f4687318f24ba944a13609d3ea6ebd890737d",
"installed_by": ["modules", "quantify_pseudo_alignment"]
},
"dupradar": {
@@ -42,12 +42,12 @@
},
"fastp": {
"branch": "master",
- "git_sha": "b90b5cd93149a1b3be263d916c7234fe0708a71c",
+ "git_sha": "1ceaa8ba4d0fd886dbca0e545815d905b7407de7",
"installed_by": ["fastq_fastqc_umitools_fastp", "modules"]
},
"fastqc": {
"branch": "master",
- "git_sha": "285a50500f9e02578d90b3ce6382ea3c30216acd",
+ "git_sha": "46eca555142d6e597729fcb682adcc791796f514",
"installed_by": ["fastq_fastqc_umitools_fastp", "fastq_fastqc_umitools_trimgalore"]
},
"fq/subsample": {
@@ -62,7 +62,7 @@
},
"gunzip": {
"branch": "master",
- "git_sha": "a7231cbccb86535529e33859e05d19ac93f3ea04",
+ "git_sha": "4e5f4687318f24ba944a13609d3ea6ebd890737d",
"installed_by": ["modules"]
},
"hisat2/align": {
@@ -82,12 +82,12 @@
},
"kallisto/index": {
"branch": "master",
- "git_sha": "de5811dd9ca15af1e131806001bcaae909e42021",
+ "git_sha": "fbe341e9af0bb98533757f536b26d38507d31724",
"installed_by": ["modules"]
},
"kallisto/quant": {
"branch": "master",
- "git_sha": "de5811dd9ca15af1e131806001bcaae909e42021",
+ "git_sha": "fbe341e9af0bb98533757f536b26d38507d31724",
"installed_by": ["modules", "quantify_pseudo_alignment"]
},
"multiqc": {
@@ -97,8 +97,9 @@
},
"picard/markduplicates": {
"branch": "master",
- "git_sha": "1943aa60f7490c3d6740e8872e6e69122ccc8087",
- "installed_by": ["bam_markduplicates_picard"]
+ "git_sha": "46eca555142d6e597729fcb682adcc791796f514",
+ "installed_by": ["bam_markduplicates_picard"],
+ "patch": "modules/nf-core/picard/markduplicates/picard-markduplicates.diff"
},
"preseq/lcextrap": {
"branch": "master",
@@ -107,7 +108,7 @@
},
"qualimap/rnaseq": {
"branch": "master",
- "git_sha": "6b0e4fe14ca1b12e131f64608f0bbaf36fd11451",
+ "git_sha": "46eca555142d6e597729fcb682adcc791796f514",
"installed_by": ["modules"]
},
"rsem/calculateexpression": {
@@ -172,17 +173,17 @@
},
"samtools/flagstat": {
"branch": "master",
- "git_sha": "04fbbc7c43cebc0b95d5b126f6d9fe4effa33519",
+ "git_sha": "46eca555142d6e597729fcb682adcc791796f514",
"installed_by": ["bam_stats_samtools"]
},
"samtools/idxstats": {
"branch": "master",
- "git_sha": "04fbbc7c43cebc0b95d5b126f6d9fe4effa33519",
+ "git_sha": "46eca555142d6e597729fcb682adcc791796f514",
"installed_by": ["bam_stats_samtools"]
},
"samtools/index": {
"branch": "master",
- "git_sha": "04fbbc7c43cebc0b95d5b126f6d9fe4effa33519",
+ "git_sha": "46eca555142d6e597729fcb682adcc791796f514",
"installed_by": [
"bam_dedup_stats_samtools_umitools",
"bam_markduplicates_picard",
@@ -191,12 +192,12 @@
},
"samtools/sort": {
"branch": "master",
- "git_sha": "04fbbc7c43cebc0b95d5b126f6d9fe4effa33519",
+ "git_sha": "46eca555142d6e597729fcb682adcc791796f514",
"installed_by": ["bam_sort_stats_samtools"]
},
"samtools/stats": {
"branch": "master",
- "git_sha": "04fbbc7c43cebc0b95d5b126f6d9fe4effa33519",
+ "git_sha": "1fe379cf6e6c1e6fa5e32bcbeefea0f1e874dac6",
"installed_by": ["bam_stats_samtools"]
},
"sortmerna": {
@@ -206,17 +207,17 @@
},
"star/align": {
"branch": "master",
- "git_sha": "a21faa6a3481af92a343a10926f59c189a2c16c9",
+ "git_sha": "46eca555142d6e597729fcb682adcc791796f514",
"installed_by": ["modules"]
},
"star/genomegenerate": {
"branch": "master",
- "git_sha": "a21faa6a3481af92a343a10926f59c189a2c16c9",
+ "git_sha": "46eca555142d6e597729fcb682adcc791796f514",
"installed_by": ["modules"]
},
"stringtie/stringtie": {
"branch": "master",
- "git_sha": "b1b959609bda44341120aed1766329909f54b8d0",
+ "git_sha": "c789476080a150f87066ca3ed42a622339a26c0b",
"installed_by": ["modules"]
},
"subread/featurecounts": {
@@ -226,7 +227,7 @@
},
"summarizedexperiment/summarizedexperiment": {
"branch": "master",
- "git_sha": "31751460f9ce9552846e13fdeec6953dcb47132d",
+ "git_sha": "4e5f4687318f24ba944a13609d3ea6ebd890737d",
"installed_by": ["modules", "quantify_pseudo_alignment"]
},
"trimgalore": {
@@ -246,12 +247,12 @@
},
"ucsc/bedgraphtobigwig": {
"branch": "master",
- "git_sha": "7c75d01997236f61b9b77399d9933cb36041f2c3",
+ "git_sha": "46eca555142d6e597729fcb682adcc791796f514",
"installed_by": ["bedgraph_bedclip_bedgraphtobigwig"]
},
"umitools/dedup": {
"branch": "master",
- "git_sha": "3bd4f34e3093c2a16e6a8eefc22242b9b94641db",
+ "git_sha": "0eacd714effe5aac1c1de26593873960b3346cab",
"installed_by": ["bam_dedup_stats_samtools_umitools"]
},
"umitools/extract": {
@@ -266,7 +267,7 @@
},
"untar": {
"branch": "master",
- "git_sha": "5caf7640a9ef1d18d765d55339be751bb0969dfa",
+ "git_sha": "4e5f4687318f24ba944a13609d3ea6ebd890737d",
"installed_by": ["modules"]
}
}
@@ -275,27 +276,27 @@
"nf-core": {
"bam_dedup_stats_samtools_umitools": {
"branch": "master",
- "git_sha": "8f2062e7b4185590fb9f43c275381a31a6544fc0",
+ "git_sha": "46eca555142d6e597729fcb682adcc791796f514",
"installed_by": ["subworkflows"]
},
"bam_markduplicates_picard": {
"branch": "master",
- "git_sha": "04fbbc7c43cebc0b95d5b126f6d9fe4effa33519",
+ "git_sha": "46eca555142d6e597729fcb682adcc791796f514",
"installed_by": ["subworkflows"]
},
"bam_rseqc": {
"branch": "master",
- "git_sha": "9eb22e4d3f28c274b7c498a1564581377349a242",
+ "git_sha": "0eacd714effe5aac1c1de26593873960b3346cab",
"installed_by": ["subworkflows"]
},
"bam_sort_stats_samtools": {
"branch": "master",
- "git_sha": "04fbbc7c43cebc0b95d5b126f6d9fe4effa33519",
+ "git_sha": "46eca555142d6e597729fcb682adcc791796f514",
"installed_by": ["fastq_align_hisat2"]
},
"bam_stats_samtools": {
"branch": "master",
- "git_sha": "04fbbc7c43cebc0b95d5b126f6d9fe4effa33519",
+ "git_sha": "0eacd714effe5aac1c1de26593873960b3346cab",
"installed_by": [
"bam_dedup_stats_samtools_umitools",
"bam_markduplicates_picard",
@@ -304,22 +305,22 @@
},
"bedgraph_bedclip_bedgraphtobigwig": {
"branch": "master",
- "git_sha": "a4bceac1aecee5aa0a5dbc601baf0e2e61013fb2",
+ "git_sha": "0eacd714effe5aac1c1de26593873960b3346cab",
"installed_by": ["subworkflows"]
},
"fastq_align_hisat2": {
"branch": "master",
- "git_sha": "c60c14b285b89bdd0607e371417dadb80385ad6e",
+ "git_sha": "c789476080a150f87066ca3ed42a622339a26c0b",
"installed_by": ["subworkflows"]
},
"fastq_fastqc_umitools_fastp": {
"branch": "master",
- "git_sha": "db35d26edeafacf9906a517827df621a29adc13d",
+ "git_sha": "46eca555142d6e597729fcb682adcc791796f514",
"installed_by": ["fastq_qc_trim_filter_setstrandedness", "subworkflows"]
},
"fastq_fastqc_umitools_trimgalore": {
"branch": "master",
- "git_sha": "cb6defa0834eda9d6d3f967e981c819fc3e257bf",
+ "git_sha": "46eca555142d6e597729fcb682adcc791796f514",
"installed_by": ["fastq_qc_trim_filter_setstrandedness", "subworkflows"]
},
"fastq_qc_trim_filter_setstrandedness": {
@@ -329,12 +330,12 @@
},
"fastq_subsample_fq_salmon": {
"branch": "master",
- "git_sha": "727232afb8294b53dd9d05bfe469b70cce1675bb",
+ "git_sha": "fbe341e9af0bb98533757f536b26d38507d31724",
"installed_by": ["fastq_qc_trim_filter_setstrandedness", "subworkflows"]
},
"quantify_pseudo_alignment": {
"branch": "master",
- "git_sha": "5d095e8413da1f4c72b7d07ce87f75c09482486f",
+ "git_sha": "fbe341e9af0bb98533757f536b26d38507d31724",
"installed_by": ["subworkflows"]
},
"utils_nextflow_pipeline": {
diff --git a/modules/local/deseq2_qc/main.nf b/modules/local/deseq2_qc/main.nf
index 7ff5877bb..7aa81e9b5 100644
--- a/modules/local/deseq2_qc/main.nf
+++ b/modules/local/deseq2_qc/main.nf
@@ -63,16 +63,16 @@ process DESEQ2_QC {
def label_lower = args2.toLowerCase()
prefix = task.ext.prefix ?: "deseq2"
"""
- mkdir size_factors
touch ${label_lower}.pca.vals_mqc.tsv
touch ${label_lower}.sample.dists_mqc.tsv
- touch ${prefix}.plots.pdf
touch ${prefix}.dds.RData
touch ${prefix}.pca.vals.txt
+ touch ${prefix}.plots.pdf
touch ${prefix}.sample.dists.txt
touch R_sessionInfo.log
- touch size_factors/${prefix}.size_factors.RData
+ mkdir size_factors
+ touch size_factors/${prefix}.size_factors.RData
for i in `head $counts -n 1 | cut -f3-`;
do
touch size_factors/\${i}.size_factors.RData
diff --git a/modules/local/star_align_igenomes/main.nf b/modules/local/star_align_igenomes/main.nf
index 04068f142..7bda3df84 100644
--- a/modules/local/star_align_igenomes/main.nf
+++ b/modules/local/star_align_igenomes/main.nf
@@ -76,6 +76,8 @@ process STAR_ALIGN_IGENOMES {
stub:
def prefix = task.ext.prefix ?: "${meta.id}"
"""
+ echo "" | gzip > ${prefix}.unmapped_1.fastq.gz
+ echo "" | gzip > ${prefix}.unmapped_2.fastq.gz
touch ${prefix}Xd.out.bam
touch ${prefix}.Log.final.out
touch ${prefix}.Log.out
@@ -84,8 +86,6 @@ process STAR_ALIGN_IGENOMES {
touch ${prefix}.toTranscriptome.out.bam
touch ${prefix}.Aligned.unsort.out.bam
touch ${prefix}.Aligned.sortedByCoord.out.bam
- touch ${prefix}.unmapped_1.fastq.gz
- touch ${prefix}.unmapped_2.fastq.gz
touch ${prefix}.tab
touch ${prefix}.SJ.out.tab
touch ${prefix}.ReadsPerGene.out.tab
diff --git a/modules/local/star_align_igenomes/tests/main.nf.test b/modules/local/star_align_igenomes/tests/main.nf.test
index 8255c1732..37f65930a 100644
--- a/modules/local/star_align_igenomes/tests/main.nf.test
+++ b/modules/local/star_align_igenomes/tests/main.nf.test
@@ -4,20 +4,324 @@ nextflow_process {
script "../main.nf"
process "STAR_ALIGN_IGENOMES"
- setup {
- run("STAR_GENOMEGENERATE_IGENOMES") {
- script "../../star_genomegenerate_igenomes/main.nf"
+ test("homo_sapiens - single_end") {
+ config "./nextflow.config"
+ setup {
+ run("STAR_GENOMEGENERATE_IGENOMES") {
+ script "../../star_genomegenerate_igenomes/main.nf"
+ process {
+ """
+ input[0] = Channel.of([file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)])
+ input[1] = Channel.of([file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true)])
+ """
+ }
+ }
+ }
+
+ when {
process {
"""
- input[0] = Channel.of([file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)])
- input[1] = Channel.of([file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true)])
+ input[0] = Channel.of([
+ [ id:'test', single_end:true ], // meta map
+ [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_rnaseq_1.fastq.gz', checkIfExists: true) ]
+ ])
+ input[1] = STAR_GENOMEGENERATE_IGENOMES.out.index.map{ [ [id:'star'], it ] }
+ input[2] = Channel.of([
+ [ id:'test_gtf' ],
+ [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true) ]
+ ])
+ input[3] = false
+ input[4] = 'illumina'
+ input[5] = false
"""
}
}
+
+ then {
+ assertAll(
+ { assert process.success },
+ { assert snapshot(
+ file(process.out.log_final[0][1]).name,
+ file(process.out.log_out[0][1]).name,
+ file(process.out.log_progress[0][1]).name,
+ process.out.bam,
+ process.out.bam_sorted,
+ process.out.bam_transcript,
+ process.out.bam_unsorted,
+ process.out.bedgraph,
+ process.out.fastq,
+ process.out.junction,
+ process.out.read_per_gene_tab,
+ process.out.sam,
+ process.out.spl_junc_tab,
+ process.out.tab,
+ process.out.wig,
+ process.out.versions
+ ).match() }
+ )
+ }
}
- test("homo_sapiens - single_end") {
+ test("homo_sapiens - paired_end") {
config "./nextflow.config"
+ setup {
+ run("STAR_GENOMEGENERATE_IGENOMES") {
+ script "../../star_genomegenerate_igenomes/main.nf"
+ process {
+ """
+ input[0] = Channel.of([file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)])
+ input[1] = Channel.of([file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true)])
+ """
+ }
+ }
+ }
+
+ when {
+ process {
+ """
+ input[0] = Channel.of([
+ [ id:'test', single_end:false ], // meta map
+ [
+ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_rnaseq_1.fastq.gz', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_rnaseq_2.fastq.gz', checkIfExists: true)
+ ]
+ ])
+ input[1] = STAR_GENOMEGENERATE_IGENOMES.out.index.map{ [ [id:'star'], it ] }
+ input[2] = Channel.of([
+ [ id:'test_gtf' ],
+ [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true) ]
+ ])
+ input[3] = false
+ input[4] = 'illumina'
+ input[5] = false
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert process.success },
+ { assert snapshot(
+ file(process.out.log_final[0][1]).name,
+ file(process.out.log_out[0][1]).name,
+ file(process.out.log_progress[0][1]).name,
+ process.out.bam,
+ process.out.bam_sorted,
+ process.out.bam_transcript,
+ process.out.bam_unsorted,
+ process.out.bedgraph,
+ process.out.fastq,
+ process.out.junction,
+ process.out.read_per_gene_tab,
+ process.out.sam,
+ process.out.spl_junc_tab,
+ process.out.tab,
+ process.out.wig,
+ process.out.versions
+ ).match() }
+ )
+ }
+ }
+
+ test("homo_sapiens - paired_end - arriba") {
+ config "./nextflow.arriba.config"
+ setup {
+ run("STAR_GENOMEGENERATE_IGENOMES") {
+ script "../../star_genomegenerate_igenomes/main.nf"
+ process {
+ """
+ input[0] = Channel.of([file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)])
+ input[1] = Channel.of([file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true)])
+ """
+ }
+ }
+ }
+
+ when {
+ process {
+ """
+ input[0] = Channel.of([
+ [ id:'test', single_end:false ], // meta map
+ [
+ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_rnaseq_1.fastq.gz', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_rnaseq_2.fastq.gz', checkIfExists: true)
+ ]
+ ])
+ input[1] = STAR_GENOMEGENERATE_IGENOMES.out.index.map{ [ [id:'star'], it ] }
+ input[2] = Channel.of([
+ [ id:'test_gtf' ],
+ [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true) ]
+ ])
+ input[3] = false
+ input[4] = 'illumina'
+ input[5] = false
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert process.success },
+ { assert snapshot(
+ file(process.out.log_final[0][1]).name,
+ file(process.out.log_out[0][1]).name,
+ file(process.out.log_progress[0][1]).name,
+ process.out.bam,
+ process.out.bam_sorted,
+ process.out.bam_transcript,
+ process.out.bam_unsorted,
+ process.out.bedgraph,
+ process.out.fastq,
+ process.out.junction,
+ process.out.read_per_gene_tab,
+ process.out.sam,
+ process.out.spl_junc_tab,
+ process.out.tab,
+ process.out.wig,
+ process.out.versions
+ ).match() }
+ )
+ }
+ }
+
+ test("homo_sapiens - paired_end - starfusion") {
+ config "./nextflow.starfusion.config"
+ setup {
+ run("STAR_GENOMEGENERATE_IGENOMES") {
+ script "../../star_genomegenerate_igenomes/main.nf"
+ process {
+ """
+ input[0] = Channel.of([file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)])
+ input[1] = Channel.of([file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true)])
+ """
+ }
+ }
+ }
+
+ when {
+ process {
+ """
+ input[0] = Channel.of([
+ [ id:'test', single_end:false ], // meta map
+ [
+ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_rnaseq_1.fastq.gz', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_rnaseq_2.fastq.gz', checkIfExists: true)
+ ]
+ ])
+ input[1] = STAR_GENOMEGENERATE_IGENOMES.out.index.map{ [ [id:'star'], it ] }
+ input[2] = Channel.of([
+ [ id:'test_gtf' ],
+ [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true) ]
+ ])
+ input[3] = false
+ input[4] = 'illumina'
+ input[5] = false
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert process.success },
+ { assert snapshot(
+ file(process.out.log_final[0][1]).name,
+ file(process.out.log_out[0][1]).name,
+ file(process.out.log_progress[0][1]).name,
+ process.out.bam,
+ process.out.bam_sorted,
+ process.out.bam_transcript,
+ process.out.bam_unsorted,
+ process.out.bedgraph,
+ process.out.fastq,
+ process.out.junction,
+ process.out.read_per_gene_tab,
+ process.out.sam,
+ process.out.spl_junc_tab,
+ process.out.tab,
+ process.out.wig,
+ process.out.versions
+ ).match() }
+ )
+ }
+ }
+
+ test("homo_sapiens - paired_end - multiple") {
+ config "./nextflow.config"
+ setup {
+ run("STAR_GENOMEGENERATE_IGENOMES") {
+ script "../../star_genomegenerate_igenomes/main.nf"
+ process {
+ """
+ input[0] = Channel.of([file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)])
+ input[1] = Channel.of([file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true)])
+ """
+ }
+ }
+ }
+
+ when {
+ process {
+ """
+ input[0] = Channel.of([
+ [ id:'test', single_end:false ], // meta map
+ [
+ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_rnaseq_1.fastq.gz', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_rnaseq_2.fastq.gz', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_rnaseq_1.fastq.gz', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_rnaseq_2.fastq.gz', checkIfExists: true)
+ ]
+ ])
+ input[1] = STAR_GENOMEGENERATE_IGENOMES.out.index.map{ [ [id:'star'], it ] }
+ input[2] = Channel.of([
+ [ id:'test_gtf' ],
+ [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true) ]
+ ])
+ input[3] = false
+ input[4] = 'illumina'
+ input[5] = false
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert process.success },
+ { assert snapshot(
+ file(process.out.log_final[0][1]).name,
+ file(process.out.log_out[0][1]).name,
+ file(process.out.log_progress[0][1]).name,
+ process.out.bam,
+ process.out.bam_sorted,
+ process.out.bam_transcript,
+ process.out.bam_unsorted,
+ process.out.bedgraph,
+ process.out.fastq,
+ process.out.junction,
+ process.out.read_per_gene_tab,
+ process.out.sam,
+ process.out.spl_junc_tab,
+ process.out.tab,
+ process.out.wig,
+ process.out.versions
+ ).match() }
+ )
+ }
+ }
+
+ test("homo_sapiens - single_end - stub") {
+ options "-stub"
+ config "./nextflow.config"
+ setup {
+ run("STAR_GENOMEGENERATE_IGENOMES") {
+ script "../../star_genomegenerate_igenomes/main.nf"
+ process {
+ """
+ input[0] = Channel.of([file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)])
+ input[1] = Channel.of([file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true)])
+ """
+ }
+ }
+ }
when {
process {
@@ -41,28 +345,25 @@ nextflow_process {
then {
assertAll(
{ assert process.success },
- { assert snapshot(file(process.out.log_final[0][1]).name).match("homo_sapiens - single_end - log_final") },
- { assert snapshot(file(process.out.log_out[0][1]).name).match("homo_sapiens - single_end - log_out") },
- { assert snapshot(process.out.bam).match("homo_sapiens - single_end - bam") },
- { assert snapshot(process.out.bam_sorted).match("homo_sapiens - single_end - bam_sorted") },
- { assert snapshot(process.out.bam_transcript).match("homo_sapiens - single_end - bam_transcript") },
- { assert snapshot(process.out.bam_unsorted).match("homo_sapiens - single_end - bam_unsorted") },
- { assert snapshot(process.out.bedgraph).match("homo_sapiens - single_end - bedgraph") },
- { assert snapshot(process.out.fastq).match("homo_sapiens - single_end - fastq") },
- { assert snapshot(process.out.junction).match("homo_sapiens - single_end - junction") },
- { assert snapshot(process.out.log_progress).match("homo_sapiens - single_end - log_progress") },
- { assert snapshot(process.out.read_per_gene_tab).match("homo_sapiens - single_end - read_per_gene_tab") },
- { assert snapshot(process.out.sam).match("homo_sapiens - single_end - sam") },
- { assert snapshot(process.out.spl_junc_tab).match("homo_sapiens - single_end - spl_junc_tab") },
- { assert snapshot(process.out.tab).match("homo_sapiens - single_end - tab") },
- { assert snapshot(process.out.wig).match("homo_sapiens - single_end - wig") },
- { assert snapshot(process.out.versions).match("homo_sapiens - single_end - versions") }
+ { assert snapshot(process.out).match() }
)
}
}
- test("homo_sapiens - paired_end") {
+ test("homo_sapiens - paired_end - stub") {
+ options "-stub"
config "./nextflow.config"
+ setup {
+ run("STAR_GENOMEGENERATE_IGENOMES") {
+ script "../../star_genomegenerate_igenomes/main.nf"
+ process {
+ """
+ input[0] = Channel.of([file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)])
+ input[1] = Channel.of([file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true)])
+ """
+ }
+ }
+ }
when {
process {
@@ -89,28 +390,25 @@ nextflow_process {
then {
assertAll(
{ assert process.success },
- { assert snapshot(file(process.out.log_final[0][1]).name).match("homo_sapiens - paired_end - log_final") },
- { assert snapshot(file(process.out.log_out[0][1]).name).match("homo_sapiens - paired_end - log_out") },
- { assert snapshot(process.out.bam).match("homo_sapiens - paired_end - bam") },
- { assert snapshot(process.out.bam_sorted).match("homo_sapiens - paired_end - bam_sorted") },
- { assert snapshot(process.out.bam_transcript).match("homo_sapiens - paired_end - bam_transcript") },
- { assert snapshot(process.out.bam_unsorted).match("homo_sapiens - paired_end - bam_unsorted") },
- { assert snapshot(process.out.bedgraph).match("homo_sapiens - paired_end - bedgraph") },
- { assert snapshot(process.out.fastq).match("homo_sapiens - paired_end - fastq") },
- { assert snapshot(process.out.junction).match("homo_sapiens - paired_end - junction") },
- { assert snapshot(process.out.log_progress).match("homo_sapiens - paired_end - log_progress") },
- { assert snapshot(process.out.read_per_gene_tab).match("homo_sapiens - paired_end - read_per_gene_tab") },
- { assert snapshot(process.out.sam).match("homo_sapiens - paired_end - sam") },
- { assert snapshot(process.out.spl_junc_tab).match("homo_sapiens - paired_end - spl_junc_tab") },
- { assert snapshot(process.out.tab).match("homo_sapiens - paired_end - tab") },
- { assert snapshot(process.out.wig).match("homo_sapiens - paired_end - wig") },
- { assert snapshot(process.out.versions).match("homo_sapiens - paired_end - versions") }
+ { assert snapshot(process.out).match() }
)
}
}
- test("homo_sapiens - paired_end - arriba") {
+ test("homo_sapiens - paired_end - arriba - stub") {
+ options "-stub"
config "./nextflow.arriba.config"
+ setup {
+ run("STAR_GENOMEGENERATE_IGENOMES") {
+ script "../../star_genomegenerate_igenomes/main.nf"
+ process {
+ """
+ input[0] = Channel.of([file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)])
+ input[1] = Channel.of([file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true)])
+ """
+ }
+ }
+ }
when {
process {
@@ -137,28 +435,25 @@ nextflow_process {
then {
assertAll(
{ assert process.success },
- { assert snapshot(file(process.out.log_final[0][1]).name).match("homo_sapiens - paired_end - arriba - log_final") },
- { assert snapshot(file(process.out.log_out[0][1]).name).match("homo_sapiens - paired_end - arriba - log_out") },
- { assert snapshot(file(process.out.log_progress[0][1]).name).match("homo_sapiens - paired_end - arriba - log_progress") },
- { assert snapshot(process.out.bam).match("homo_sapiens - paired_end - arriba - bam") },
- { assert snapshot(process.out.bam_sorted).match("homo_sapiens - paired_end - arriba - bam_sorted") },
- { assert snapshot(process.out.bam_transcript).match("homo_sapiens - paired_end - arriba - bam_transcript") },
- { assert snapshot(process.out.bam_unsorted).match("homo_sapiens - paired_end - arriba - bam_unsorted") },
- { assert snapshot(process.out.bedgraph).match("homo_sapiens - paired_end - arriba - bedgraph") },
- { assert snapshot(process.out.fastq).match("homo_sapiens - paired_end - arriba - fastq") },
- { assert snapshot(process.out.junction).match("homo_sapiens - paired_end - arriba - junction") },
- { assert snapshot(process.out.read_per_gene_tab).match("homo_sapiens - paired_end - arriba - read_per_gene_tab") },
- { assert snapshot(process.out.sam).match("homo_sapiens - paired_end - arriba - sam") },
- { assert snapshot(process.out.spl_junc_tab).match("homo_sapiens - paired_end - arriba - spl_junc_tab") },
- { assert snapshot(process.out.tab).match("homo_sapiens - paired_end - arriba - tab") },
- { assert snapshot(process.out.wig).match("homo_sapiens - paired_end - arriba - wig") },
- { assert snapshot(process.out.versions).match("homo_sapiens - paired_end - arriba - versions") }
+ { assert snapshot(process.out).match() }
)
}
}
- test("homo_sapiens - paired_end - starfusion") {
+ test("homo_sapiens - paired_end - starfusion - stub") {
+ options "-stub"
config "./nextflow.starfusion.config"
+ setup {
+ run("STAR_GENOMEGENERATE_IGENOMES") {
+ script "../../star_genomegenerate_igenomes/main.nf"
+ process {
+ """
+ input[0] = Channel.of([file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)])
+ input[1] = Channel.of([file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true)])
+ """
+ }
+ }
+ }
when {
process {
@@ -185,28 +480,25 @@ nextflow_process {
then {
assertAll(
{ assert process.success },
- { assert snapshot(file(process.out.log_final[0][1]).name).match("homo_sapiens - paired_end - starfusion - log_final") },
- { assert snapshot(file(process.out.log_out[0][1]).name).match("homo_sapiens - paired_end - starfusion - log_out") },
- { assert snapshot(file(process.out.log_progress[0][1]).name).match("homo_sapiens - paired_end - starfusion - log_progress") },
- { assert snapshot(process.out.bam).match("homo_sapiens - paired_end - starfusion - bam") },
- { assert snapshot(process.out.bam_sorted).match("homo_sapiens - paired_end - starfusion - bam_sorted") },
- { assert snapshot(process.out.bam_transcript).match("homo_sapiens - paired_end - starfusion - bam_transcript") },
- { assert snapshot(process.out.bam_unsorted).match("homo_sapiens - paired_end - starfusion - bam_unsorted") },
- { assert snapshot(process.out.bedgraph).match("homo_sapiens - paired_end - starfusion - bedgraph") },
- { assert snapshot(process.out.fastq).match("homo_sapiens - paired_end - starfusion - fastq") },
- { assert snapshot(process.out.junction).match("homo_sapiens - paired_end - starfusion - junction") },
- { assert snapshot(process.out.read_per_gene_tab).match("homo_sapiens - paired_end - starfusion - read_per_gene_tab") },
- { assert snapshot(process.out.sam).match("homo_sapiens - paired_end - starfusion - sam") },
- { assert snapshot(process.out.spl_junc_tab).match("homo_sapiens - paired_end - starfusion - spl_junc_tab") },
- { assert snapshot(process.out.tab).match("homo_sapiens - paired_end - starfusion - tab") },
- { assert snapshot(process.out.wig).match("homo_sapiens - paired_end - starfusion - wig") },
- { assert snapshot(process.out.versions).match("homo_sapiens - paired_end - starfusion - versions") }
+ { assert snapshot(process.out).match() }
)
}
}
- test("homo_sapiens - paired_end - multiple") {
+ test("homo_sapiens - paired_end - multiple - stub") {
+ options "-stub"
config "./nextflow.config"
+ setup {
+ run("STAR_GENOMEGENERATE_IGENOMES") {
+ script "../../star_genomegenerate_igenomes/main.nf"
+ process {
+ """
+ input[0] = Channel.of([file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)])
+ input[1] = Channel.of([file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true)])
+ """
+ }
+ }
+ }
when {
process {
@@ -235,22 +527,7 @@ nextflow_process {
then {
assertAll(
{ assert process.success },
- { assert snapshot(file(process.out.log_final[0][1]).name).match("homo_sapiens - paired_end - multiple - log_final") },
- { assert snapshot(file(process.out.log_out[0][1]).name).match("homo_sapiens - paired_end - multiple - log_out") },
- { assert snapshot(file(process.out.log_progress[0][1]).name).match("homo_sapiens - paired_end - multiple - log_progress") },
- { assert snapshot(process.out.bam).match("homo_sapiens - paired_end - multiple - bam") },
- { assert snapshot(process.out.bam_sorted).match("homo_sapiens - paired_end - multiple - bam_sorted") },
- { assert snapshot(process.out.bam_transcript).match("homo_sapiens - paired_end - multiple - bam_transcript") },
- { assert snapshot(process.out.bam_unsorted).match("homo_sapiens - paired_end - multiple - bam_unsorted") },
- { assert snapshot(process.out.bedgraph).match("homo_sapiens - paired_end - multiple - bedgraph") },
- { assert snapshot(process.out.fastq).match("homo_sapiens - paired_end - multiple - fastq") },
- { assert snapshot(process.out.junction).match("homo_sapiens - paired_end - multiple - junction") },
- { assert snapshot(process.out.read_per_gene_tab).match("homo_sapiens - paired_end - multiple - read_per_gene_tab") },
- { assert snapshot(process.out.sam).match("homo_sapiens - paired_end - multiple - sam") },
- { assert snapshot(process.out.spl_junc_tab).match("homo_sapiens - paired_end - multiple - spl_junc_tab") },
- { assert snapshot(process.out.tab).match("homo_sapiens - paired_end - multiple - tab") },
- { assert snapshot(process.out.wig).match("homo_sapiens - paired_end - multiple - wig") },
- { assert snapshot(process.out.versions).match("homo_sapiens - paired_end - multiple - versions") }
+ { assert snapshot(process.out).match() }
)
}
}
diff --git a/modules/local/star_align_igenomes/tests/main.nf.test.snap b/modules/local/star_align_igenomes/tests/main.nf.test.snap
index 7dad647c0..5a0b193b1 100644
--- a/modules/local/star_align_igenomes/tests/main.nf.test.snap
+++ b/modules/local/star_align_igenomes/tests/main.nf.test.snap
@@ -1,324 +1,565 @@
{
- "homo_sapiens - paired_end - multiple - bam_sorted": {
+ "homo_sapiens - single_end - stub": {
"content": [
- [
- [
- {
- "id": "test",
- "single_end": false
- },
- "test.Aligned.sortedByCoord.out.bam:md5,7b20152380dbc52ec23d2e95a7953710"
+ {
+ "0": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.Log.final.out:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "1": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.Log.out:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "10": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.Chimeric.out.junction:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "11": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.out.sam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "2": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.Log.progress.out:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "3": [
+ "versions.yml:md5,957a57604ceb366b7af0123738e13559"
+ ],
+ "4": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ [
+ "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "testXd.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ ],
+ "5": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ [
+ "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ ],
+ "6": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.toTranscriptome.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "7": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.Aligned.unsort.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "8": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ [
+ "test.unmapped_1.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+ "test.unmapped_2.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ]
+ ],
+ "9": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ [
+ "test.ReadsPerGene.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.SJ.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.tab:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ ],
+ "bam": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ [
+ "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "testXd.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ ],
+ "bam_sorted": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ [
+ "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ ],
+ "bam_transcript": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.toTranscriptome.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "bam_unsorted": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.Aligned.unsort.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "fastq": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ [
+ "test.unmapped_1.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+ "test.unmapped_2.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ]
+ ],
+ "junction": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.Chimeric.out.junction:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "log_final": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.Log.final.out:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "log_out": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.Log.out:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "log_progress": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.Log.progress.out:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "sam": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.out.sam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "tab": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ [
+ "test.ReadsPerGene.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.SJ.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.tab:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ ],
+ "versions": [
+ "versions.yml:md5,957a57604ceb366b7af0123738e13559"
]
- ]
+ }
],
"meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
},
- "timestamp": "2024-03-05T12:52:13.056684"
+ "timestamp": "2024-07-22T20:12:37.024869"
},
- "homo_sapiens - paired_end - multiple - wig": {
- "content": null,
+ "homo_sapiens - paired_end - arriba - stub": {
+ "content": [
+ {
+ "0": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Log.final.out:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "1": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Log.out:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "10": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Chimeric.out.junction:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "11": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.out.sam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "2": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Log.progress.out:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "3": [
+ "versions.yml:md5,957a57604ceb366b7af0123738e13559"
+ ],
+ "4": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "testXd.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ ],
+ "5": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ ],
+ "6": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.toTranscriptome.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "7": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Aligned.unsort.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "8": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test.unmapped_1.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+ "test.unmapped_2.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ]
+ ],
+ "9": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test.ReadsPerGene.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.SJ.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.tab:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ ],
+ "bam": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "testXd.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ ],
+ "bam_sorted": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ ],
+ "bam_transcript": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.toTranscriptome.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "bam_unsorted": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Aligned.unsort.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "fastq": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test.unmapped_1.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+ "test.unmapped_2.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ]
+ ],
+ "junction": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Chimeric.out.junction:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "log_final": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Log.final.out:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "log_out": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Log.out:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "log_progress": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Log.progress.out:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "sam": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.out.sam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "tab": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test.ReadsPerGene.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.SJ.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.tab:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ ],
+ "versions": [
+ "versions.yml:md5,957a57604ceb366b7af0123738e13559"
+ ]
+ }
+ ],
"meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
},
- "timestamp": "2024-03-05T11:43:54.502911"
+ "timestamp": "2024-07-22T20:13:17.56838"
},
- "homo_sapiens - paired_end - arriba - tab": {
+ "homo_sapiens - single_end": {
"content": [
+ "test.Log.final.out",
+ "test.Log.out",
+ "test.Log.progress.out",
[
[
{
"id": "test",
- "single_end": false
+ "single_end": true
},
- "test.SJ.out.tab:md5,5155c9fd1f787ad6d7d80987fb06219c"
+ "test.Aligned.sortedByCoord.out.bam:md5,e5060a8dd60584378786c588c3f25b4d"
]
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-05T12:48:07.200426"
- },
- "homo_sapiens - single_end - wig": {
- "content": null,
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-05T11:39:12.419461"
- },
- "homo_sapiens - paired_end - sam": {
- "content": [
+ ],
[
-
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-05T11:39:28.821547"
- },
- "homo_sapiens - paired_end - arriba - versions": {
- "content": [
- [
- "versions.yml:md5,957a57604ceb366b7af0123738e13559"
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-05T12:48:07.267343"
- },
- "homo_sapiens - paired_end - multiple - bedgraph": {
- "content": null,
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-05T11:43:54.432752"
- },
- "homo_sapiens - paired_end - read_per_gene_tab": {
- "content": null,
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-05T11:39:28.81774"
- },
- "homo_sapiens - paired_end - arriba - bedgraph": {
- "content": null,
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-05T11:39:45.643743"
- },
- "homo_sapiens - single_end - junction": {
- "content": [
- [
-
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-05T11:39:12.406191"
- },
- "homo_sapiens - paired_end - arriba - spl_junc_tab": {
- "content": null,
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-05T11:39:45.65723"
- },
- "homo_sapiens - single_end - sam": {
- "content": [
- [
-
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-05T11:39:12.411481"
- },
- "homo_sapiens - paired_end - fastq": {
- "content": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.Aligned.sortedByCoord.out.bam:md5,e5060a8dd60584378786c588c3f25b4d"
+ ]
+ ],
[
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-05T11:39:28.810584"
- },
- "homo_sapiens - single_end - versions": {
- "content": [
- [
- "versions.yml:md5,957a57604ceb366b7af0123738e13559"
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-05T12:40:00.104687"
- },
- "homo_sapiens - paired_end - multiple - log_out": {
- "content": [
- "test.Log.out"
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-05T12:52:12.894285"
- },
- "homo_sapiens - paired_end - arriba - fastq": {
- "content": [
+ ],
[
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-05T11:39:45.646457"
- },
- "homo_sapiens - paired_end - multiple - junction": {
- "content": [
+ ],
+ null,
[
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-05T11:43:54.45332"
- },
- "homo_sapiens - paired_end - multiple - spl_junc_tab": {
- "content": null,
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-05T11:43:54.482358"
- },
- "homo_sapiens - paired_end - starfusion - log_final": {
- "content": [
- "test.Log.final.out"
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-05T12:44:02.475493"
- },
- "homo_sapiens - paired_end - starfusion - fastq": {
- "content": [
+ ],
[
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-05T11:41:39.262375"
- },
- "homo_sapiens - paired_end - multiple - sam": {
- "content": [
+ ],
+ null,
[
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-05T11:43:54.472236"
- },
- "homo_sapiens - paired_end - multiple - log_final": {
- "content": [
- "test.Log.final.out"
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-05T12:52:12.865334"
- },
- "homo_sapiens - paired_end - starfusion - bam": {
- "content": [
+ ],
+ null,
[
[
{
"id": "test",
- "single_end": false
+ "single_end": true
},
- "test.Aligned.out.bam:md5,7806e69c537f72e494f9ce8e95f16355"
+ "test.SJ.out.tab:md5,75a516ab950fb958f40b29996474949c"
]
+ ],
+ null,
+ [
+ "versions.yml:md5,957a57604ceb366b7af0123738e13559"
]
],
"meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
},
- "timestamp": "2024-03-05T12:44:02.545949"
+ "timestamp": "2024-07-22T20:04:35.055193"
},
- "homo_sapiens - paired_end - arriba - junction": {
+ "homo_sapiens - paired_end": {
"content": [
+ "test.Log.final.out",
+ "test.Log.out",
+ "test.Log.progress.out",
[
[
{
"id": "test",
"single_end": false
},
- "test.Chimeric.out.junction:md5,62760fd60371d5bacae324c370358944"
+ "test.Aligned.sortedByCoord.out.bam:md5,b6cec9bba6b04b9b92eddbef128bdfbb"
]
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-05T12:48:07.133125"
- },
- "homo_sapiens - single_end - bedgraph": {
- "content": null,
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-05T11:39:12.402541"
- },
- "homo_sapiens - paired_end - arriba - read_per_gene_tab": {
- "content": null,
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-05T11:39:45.651485"
- },
- "homo_sapiens - paired_end - starfusion - bam_sorted": {
- "content": [
- [
-
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-05T11:41:39.217628"
- },
- "homo_sapiens - single_end - bam_unsorted": {
- "content": [
- [
-
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-05T11:39:12.400925"
- },
- "homo_sapiens - paired_end - bam": {
- "content": [
+ ],
[
[
{
@@ -327,102 +568,25 @@
},
"test.Aligned.sortedByCoord.out.bam:md5,b6cec9bba6b04b9b92eddbef128bdfbb"
]
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-05T12:40:45.530038"
- },
- "homo_sapiens - paired_end - arriba - bam_transcript": {
- "content": [
+ ],
[
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-05T11:39:45.63966"
- },
- "homo_sapiens - paired_end - log_out": {
- "content": [
- "test.Log.out"
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-05T12:40:45.492406"
- },
- "homo_sapiens - paired_end - arriba - log_out": {
- "content": [
- "test.Log.out"
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-05T12:48:06.975033"
- },
- "homo_sapiens - paired_end - multiple - versions": {
- "content": [
+ ],
[
- "versions.yml:md5,957a57604ceb366b7af0123738e13559"
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-05T12:52:13.193701"
- },
- "homo_sapiens - paired_end - starfusion - bam_transcript": {
- "content": [
+
+ ],
+ null,
[
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-05T11:41:39.224799"
- },
- "homo_sapiens - paired_end - starfusion - tab": {
- "content": [
+ ],
[
- [
- {
- "id": "test",
- "single_end": false
- },
- "test.SJ.out.tab:md5,19c3faa1bfa9a0cc5e4c45f17065b53a"
- ]
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-05T12:44:02.631643"
- },
- "homo_sapiens - single_end - fastq": {
- "content": [
+
+ ],
+ null,
[
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-05T11:39:12.404069"
- },
- "homo_sapiens - paired_end - tab": {
- "content": [
+ ],
+ null,
[
[
{
@@ -431,204 +595,592 @@
},
"test.SJ.out.tab:md5,844af19ab0fc8cd9a3f75228445aca0d"
]
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-05T12:40:45.687553"
- },
- "homo_sapiens - paired_end - starfusion - bedgraph": {
- "content": null,
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-05T11:41:39.254528"
- },
- "homo_sapiens - single_end - bam_transcript": {
- "content": [
- [
-
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-05T11:39:12.39955"
- },
- "homo_sapiens - paired_end - versions": {
- "content": [
+ ],
+ null,
[
"versions.yml:md5,957a57604ceb366b7af0123738e13559"
]
],
"meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
},
- "timestamp": "2024-03-05T12:40:45.748799"
+ "timestamp": "2024-07-22T20:05:25.626464"
},
- "homo_sapiens - paired_end - multiple - tab": {
+ "homo_sapiens - paired_end - multiple - stub": {
"content": [
- [
- [
- {
- "id": "test",
- "single_end": false
- },
- "test.SJ.out.tab:md5,069877e053714e23010fe4e1c003b4a2"
+ {
+ "0": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Log.final.out:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "1": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Log.out:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "10": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Chimeric.out.junction:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "11": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.out.sam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "2": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Log.progress.out:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "3": [
+ "versions.yml:md5,957a57604ceb366b7af0123738e13559"
+ ],
+ "4": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "testXd.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ ],
+ "5": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ ],
+ "6": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.toTranscriptome.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "7": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Aligned.unsort.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "8": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test.unmapped_1.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+ "test.unmapped_2.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ]
+ ],
+ "9": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test.ReadsPerGene.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.SJ.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.tab:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ ],
+ "bam": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "testXd.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ ],
+ "bam_sorted": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ ],
+ "bam_transcript": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.toTranscriptome.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "bam_unsorted": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Aligned.unsort.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "fastq": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test.unmapped_1.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+ "test.unmapped_2.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ]
+ ],
+ "junction": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Chimeric.out.junction:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "log_final": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Log.final.out:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "log_out": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Log.out:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "log_progress": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Log.progress.out:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "sam": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.out.sam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "tab": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test.ReadsPerGene.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.SJ.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.tab:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ ],
+ "versions": [
+ "versions.yml:md5,957a57604ceb366b7af0123738e13559"
]
- ]
+ }
],
"meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
},
- "timestamp": "2024-03-05T12:52:13.125877"
+ "timestamp": "2024-07-22T20:14:00.135162"
},
- "homo_sapiens - single_end - bam": {
+ "homo_sapiens - paired_end - multiple": {
"content": [
+ "test.Log.final.out",
+ "test.Log.out",
+ "test.Log.progress.out",
[
[
{
"id": "test",
- "single_end": true
+ "single_end": false
},
- "test.Aligned.sortedByCoord.out.bam:md5,e5060a8dd60584378786c588c3f25b4d"
+ "test.Aligned.sortedByCoord.out.bam:md5,7b20152380dbc52ec23d2e95a7953710"
]
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-05T12:39:59.959658"
- },
- "homo_sapiens - paired_end - arriba - wig": {
- "content": null,
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-05T11:39:45.663497"
- },
- "homo_sapiens - paired_end - log_progress": {
- "content": [
+ ],
[
[
{
"id": "test",
"single_end": false
},
- "test.Log.progress.out:md5,b2bd061d6cbaaf3d6d3b1fed547f69b8"
+ "test.Aligned.sortedByCoord.out.bam:md5,7b20152380dbc52ec23d2e95a7953710"
]
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-05T12:40:45.630526"
- },
- "homo_sapiens - paired_end - arriba - log_final": {
- "content": [
- "test.Log.final.out"
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-05T12:48:06.951543"
- },
- "homo_sapiens - paired_end - bam_unsorted": {
- "content": [
+ ],
[
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-05T11:39:28.805957"
- },
- "homo_sapiens - paired_end - arriba - sam": {
- "content": [
+ ],
[
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-05T11:39:45.654389"
- },
- "homo_sapiens - paired_end - multiple - bam": {
- "content": [
+ ],
+ null,
+ [
+
+ ],
+ [
+
+ ],
+ null,
+ [
+
+ ],
+ null,
[
[
{
"id": "test",
"single_end": false
},
- "test.Aligned.sortedByCoord.out.bam:md5,7b20152380dbc52ec23d2e95a7953710"
+ "test.SJ.out.tab:md5,069877e053714e23010fe4e1c003b4a2"
]
+ ],
+ null,
+ [
+ "versions.yml:md5,957a57604ceb366b7af0123738e13559"
]
],
"meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
},
- "timestamp": "2024-03-05T12:52:12.98725"
+ "timestamp": "2024-07-22T20:12:16.618713"
},
- "homo_sapiens - paired_end - multiple - fastq": {
+ "homo_sapiens - paired_end - stub": {
"content": [
- [
-
- ]
+ {
+ "0": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Log.final.out:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "1": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Log.out:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "10": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Chimeric.out.junction:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "11": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.out.sam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "2": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Log.progress.out:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "3": [
+ "versions.yml:md5,957a57604ceb366b7af0123738e13559"
+ ],
+ "4": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "testXd.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ ],
+ "5": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ ],
+ "6": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.toTranscriptome.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "7": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Aligned.unsort.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "8": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test.unmapped_1.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+ "test.unmapped_2.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ]
+ ],
+ "9": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test.ReadsPerGene.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.SJ.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.tab:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ ],
+ "bam": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "testXd.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ ],
+ "bam_sorted": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ ],
+ "bam_transcript": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.toTranscriptome.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "bam_unsorted": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Aligned.unsort.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "fastq": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test.unmapped_1.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+ "test.unmapped_2.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ]
+ ],
+ "junction": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Chimeric.out.junction:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "log_final": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Log.final.out:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "log_out": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Log.out:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "log_progress": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Log.progress.out:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "sam": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.out.sam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "tab": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test.ReadsPerGene.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.SJ.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.tab:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ ],
+ "versions": [
+ "versions.yml:md5,957a57604ceb366b7af0123738e13559"
+ ]
+ }
],
"meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
},
- "timestamp": "2024-03-05T11:43:54.445019"
+ "timestamp": "2024-07-22T20:12:56.326797"
},
- "homo_sapiens - single_end - bam_sorted": {
+ "homo_sapiens - paired_end - starfusion": {
"content": [
+ "test.Log.final.out",
+ "test.Log.out",
+ "test.Log.progress.out",
[
[
{
"id": "test",
- "single_end": true
+ "single_end": false
},
- "test.Aligned.sortedByCoord.out.bam:md5,e5060a8dd60584378786c588c3f25b4d"
+ "test.Aligned.out.bam:md5,7806e69c537f72e494f9ce8e95f16355"
]
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-05T12:39:59.996165"
- },
- "homo_sapiens - paired_end - arriba - bam_sorted": {
- "content": [
+ ],
[
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-05T11:39:45.637599"
- },
- "homo_sapiens - paired_end - starfusion - junction": {
- "content": [
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ null,
+ [
+
+ ],
[
[
{
@@ -637,322 +1189,334 @@
},
"test.Chimeric.out.junction:md5,c6d4d8c641ebb1c152a10da44f0dbf20"
]
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-05T12:44:02.589611"
- },
- "homo_sapiens - single_end - tab": {
- "content": [
+ ],
+ null,
+ [
+
+ ],
+ null,
[
[
{
"id": "test",
- "single_end": true
+ "single_end": false
},
- "test.SJ.out.tab:md5,75a516ab950fb958f40b29996474949c"
+ "test.SJ.out.tab:md5,19c3faa1bfa9a0cc5e4c45f17065b53a"
]
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-05T12:40:00.069146"
- },
- "homo_sapiens - paired_end - starfusion - versions": {
- "content": [
+ ],
+ null,
[
"versions.yml:md5,957a57604ceb366b7af0123738e13559"
]
],
"meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
},
- "timestamp": "2024-03-05T12:44:02.672571"
+ "timestamp": "2024-07-22T20:10:49.022723"
},
- "homo_sapiens - paired_end - multiple - bam_unsorted": {
- "content": [
- [
-
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-05T11:43:54.423849"
- },
- "homo_sapiens - paired_end - arriba - log_progress": {
- "content": [
- "test.Log.progress.out"
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-05T12:48:06.986955"
- },
- "homo_sapiens - paired_end - bedgraph": {
- "content": null,
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-05T11:39:28.808248"
- },
- "homo_sapiens - paired_end - starfusion - bam_unsorted": {
- "content": [
- [
-
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-05T11:41:39.247036"
- },
- "homo_sapiens - paired_end - starfusion - read_per_gene_tab": {
- "content": null,
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-05T11:41:39.285373"
- },
- "homo_sapiens - paired_end - multiple - log_progress": {
- "content": [
- "test.Log.progress.out"
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-05T12:52:12.923841"
- },
- "homo_sapiens - paired_end - arriba - bam_unsorted": {
- "content": [
- [
-
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-05T11:39:45.641672"
- },
- "homo_sapiens - paired_end - bam_sorted": {
+ "homo_sapiens - paired_end - arriba": {
"content": [
+ "test.Log.final.out",
+ "test.Log.out",
+ "test.Log.progress.out",
[
[
{
"id": "test",
"single_end": false
},
- "test.Aligned.sortedByCoord.out.bam:md5,b6cec9bba6b04b9b92eddbef128bdfbb"
+ "test.Aligned.out.bam:md5,28ecaa85a5dec1a18c877c85d874adf2"
]
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-05T12:40:45.577077"
- },
- "homo_sapiens - single_end - spl_junc_tab": {
- "content": null,
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-05T11:39:12.4135"
- },
- "homo_sapiens - paired_end - starfusion - spl_junc_tab": {
- "content": null,
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-05T11:41:39.298186"
- },
- "homo_sapiens - single_end - log_out": {
- "content": [
- "test.Log.out"
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-05T12:39:59.921499"
- },
- "homo_sapiens - paired_end - log_final": {
- "content": [
- "test.Log.final.out"
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-05T12:40:45.485532"
- },
- "homo_sapiens - paired_end - bam_transcript": {
- "content": [
+ ],
[
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-05T11:39:28.803499"
- },
- "homo_sapiens - single_end - log_final": {
- "content": [
- "test.Log.final.out"
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-05T12:39:59.911473"
- },
- "homo_sapiens - paired_end - starfusion - log_progress": {
- "content": [
- "test.Log.progress.out"
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-05T12:44:02.502543"
- },
- "homo_sapiens - paired_end - multiple - bam_transcript": {
- "content": [
+ ],
[
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-05T11:43:54.413659"
- },
- "homo_sapiens - paired_end - multiple - read_per_gene_tab": {
- "content": null,
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-05T11:43:54.462815"
- },
- "homo_sapiens - single_end - read_per_gene_tab": {
- "content": null,
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-05T11:39:12.409493"
- },
- "homo_sapiens - paired_end - junction": {
- "content": [
+ ],
[
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-05T11:39:28.812836"
- },
- "homo_sapiens - paired_end - spl_junc_tab": {
- "content": null,
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-05T11:39:28.825946"
- },
- "homo_sapiens - paired_end - starfusion - sam": {
- "content": [
+ ],
+ null,
[
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-05T11:41:39.291398"
- },
- "homo_sapiens - paired_end - arriba - bam": {
- "content": [
+ ],
[
[
{
"id": "test",
"single_end": false
},
- "test.Aligned.out.bam:md5,28ecaa85a5dec1a18c877c85d874adf2"
+ "test.Chimeric.out.junction:md5,62760fd60371d5bacae324c370358944"
]
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-05T12:48:07.064585"
- },
- "homo_sapiens - single_end - log_progress": {
- "content": [
+ ],
+ null,
+ [
+
+ ],
+ null,
[
[
{
"id": "test",
- "single_end": true
+ "single_end": false
},
- "test.Log.progress.out:md5,b2bd061d6cbaaf3d6d3b1fed547f69b8"
+ "test.SJ.out.tab:md5,5155c9fd1f787ad6d7d80987fb06219c"
]
+ ],
+ null,
+ [
+ "versions.yml:md5,957a57604ceb366b7af0123738e13559"
]
],
"meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
},
- "timestamp": "2024-03-05T12:40:00.033267"
+ "timestamp": "2024-07-22T20:07:19.724256"
},
- "homo_sapiens - paired_end - starfusion - wig": {
- "content": null,
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-05T11:41:39.311386"
- },
- "homo_sapiens - paired_end - wig": {
- "content": null,
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-05T11:39:28.830843"
- },
- "homo_sapiens - paired_end - starfusion - log_out": {
+ "homo_sapiens - paired_end - starfusion - stub": {
"content": [
- "test.Log.out"
+ {
+ "0": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Log.final.out:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "1": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Log.out:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "10": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Chimeric.out.junction:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "11": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.out.sam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "2": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Log.progress.out:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "3": [
+ "versions.yml:md5,957a57604ceb366b7af0123738e13559"
+ ],
+ "4": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "testXd.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ ],
+ "5": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ ],
+ "6": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.toTranscriptome.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "7": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Aligned.unsort.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "8": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test.unmapped_1.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+ "test.unmapped_2.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ]
+ ],
+ "9": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test.ReadsPerGene.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.SJ.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.tab:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ ],
+ "bam": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "testXd.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ ],
+ "bam_sorted": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ ],
+ "bam_transcript": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.toTranscriptome.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "bam_unsorted": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Aligned.unsort.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "fastq": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test.unmapped_1.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+ "test.unmapped_2.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ]
+ ],
+ "junction": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Chimeric.out.junction:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "log_final": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Log.final.out:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "log_out": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Log.out:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "log_progress": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Log.progress.out:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "sam": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.out.sam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "tab": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test.ReadsPerGene.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.SJ.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.tab:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ ],
+ "versions": [
+ "versions.yml:md5,957a57604ceb366b7af0123738e13559"
+ ]
+ }
],
"meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
},
- "timestamp": "2024-03-05T12:44:02.489254"
+ "timestamp": "2024-07-22T20:13:37.606866"
}
}
\ No newline at end of file
diff --git a/modules/local/star_genomegenerate_igenomes/main.nf b/modules/local/star_genomegenerate_igenomes/main.nf
index e36e04179..4e2fcf6bf 100644
--- a/modules/local/star_genomegenerate_igenomes/main.nf
+++ b/modules/local/star_genomegenerate_igenomes/main.nf
@@ -115,4 +115,5 @@ process STAR_GENOMEGENERATE_IGENOMES {
gawk: \$(echo \$(gawk --version 2>&1) | sed 's/^.*GNU Awk //; s/, .*\$//')
END_VERSIONS
"""
- }}
+ }
+}
diff --git a/modules/local/star_genomegenerate_igenomes/tests/main.nf.test b/modules/local/star_genomegenerate_igenomes/tests/main.nf.test
index aea6305c4..d3bd71891 100644
--- a/modules/local/star_genomegenerate_igenomes/tests/main.nf.test
+++ b/modules/local/star_genomegenerate_igenomes/tests/main.nf.test
@@ -18,21 +18,21 @@ nextflow_process {
then {
assertAll(
{ assert process.success },
- { assert snapshot(file(process.out.index[0][1]).listFiles().collect { it.getName() }.sort().toString()).match("fasta_gtf_index") },
- { assert snapshot(process.out.versions).match("fasta_gtf_versions") }
+ { assert snapshot(
+ file(process.out.index[0][1]).listFiles().collect { it.getName() }.sort().toString(),
+ process.out.versions
+ ).match() }
)
}
}
- test("fasta with gtf - stub") {
-
- options '-stub'
+ test("fasta no gtf") {
when {
process {
"""
input[0] = Channel.of([file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)])
- input[1] = Channel.of([file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true)])
+ input[1] = Channel.of([ ])
"""
}
}
@@ -40,19 +40,24 @@ nextflow_process {
then {
assertAll(
{ assert process.success },
- { assert snapshot(file(process.out.index[0][1]).listFiles().collect { it.getName() }.sort().toString()).match("fasta_gtf_stub_index") },
- { assert snapshot(process.out.versions).match("fasta_gtf_stub_versions") }
+ { assert snapshot(
+ file(process.out.index[0][1]).listFiles().collect { it.getName() }.sort().toString(),
+ process.out.versions
+ ).match() }
)
}
+
}
- test("fasta no gtf") {
+ test("fasta with gtf - stub") {
+
+ options '-stub'
when {
process {
"""
input[0] = Channel.of([file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)])
- input[1] = Channel.of([ ])
+ input[1] = Channel.of([file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true)])
"""
}
}
@@ -60,11 +65,9 @@ nextflow_process {
then {
assertAll(
{ assert process.success },
- { assert snapshot(file(process.out.index[0][1]).listFiles().collect { it.getName() }.sort().toString()).match("fasta_index") },
- { assert snapshot(process.out.versions).match("fasta_versions") }
+ { assert snapshot(process.out).match() }
)
}
-
}
test("fasta no gtf - stub") {
@@ -83,8 +86,7 @@ nextflow_process {
then {
assertAll(
{ assert process.success },
- { assert snapshot(file(process.out.index[0][1]).listFiles().collect { it.getName() }.sort().toString()).match("fasta_stub_index") },
- { assert snapshot(process.out.versions).match("fasta_stub_versions") }
+ { assert snapshot(process.out).match() }
)
}
}
diff --git a/modules/local/star_genomegenerate_igenomes/tests/main.nf.test.snap b/modules/local/star_genomegenerate_igenomes/tests/main.nf.test.snap
index 4a3d6e033..1ba924611 100644
--- a/modules/local/star_genomegenerate_igenomes/tests/main.nf.test.snap
+++ b/modules/local/star_genomegenerate_igenomes/tests/main.nf.test.snap
@@ -1,90 +1,128 @@
{
- "fasta_gtf_versions": {
+ "fasta with gtf": {
"content": [
+ "[]",
[
"versions.yml:md5,562a70f12dd9e695449b59fbf604e98d"
]
],
"meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
},
- "timestamp": "2024-03-05T10:28:05.069709"
+ "timestamp": "2024-07-22T20:14:17.250178"
},
- "fasta_stub_versions": {
+ "fasta no gtf - stub": {
"content": [
- [
- "versions.yml:md5,562a70f12dd9e695449b59fbf604e98d"
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-05T10:31:12.153651"
- },
- "fasta_gtf_stub_index": {
- "content": [
- "[]"
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-05T10:28:16.309869"
- },
- "fasta_gtf_stub_versions": {
- "content": [
- [
- "versions.yml:md5,562a70f12dd9e695449b59fbf604e98d"
- ]
+ {
+ "0": [
+ [
+ "Genome:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "Log.out:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "SA:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "SAindex:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "chrLength.txt:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "chrName.txt:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "chrNameLength.txt:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "chrStart.txt:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "genomeParameters.txt:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "1": [
+ "versions.yml:md5,562a70f12dd9e695449b59fbf604e98d"
+ ],
+ "index": [
+ [
+ "Genome:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "Log.out:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "SA:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "SAindex:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "chrLength.txt:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "chrName.txt:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "chrNameLength.txt:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "chrStart.txt:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "genomeParameters.txt:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "versions": [
+ "versions.yml:md5,562a70f12dd9e695449b59fbf604e98d"
+ ]
+ }
],
"meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
},
- "timestamp": "2024-03-05T10:28:16.337298"
+ "timestamp": "2024-07-22T20:15:09.671637"
},
- "fasta_index": {
- "content": [
- "[]"
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-05T10:30:56.504744"
- },
- "fasta_versions": {
+ "fasta no gtf": {
"content": [
+ "[]",
[
"versions.yml:md5,562a70f12dd9e695449b59fbf604e98d"
]
],
"meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-05T10:30:56.575367"
- },
- "fasta_gtf_index": {
- "content": [
- "[]"
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
},
- "timestamp": "2024-03-05T10:28:05.031195"
+ "timestamp": "2024-07-22T20:14:35.674278"
},
- "fasta_stub_index": {
+ "fasta with gtf - stub": {
"content": [
- "[]"
+ {
+ "0": [
+ [
+ "Genome:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "Log.out:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "SA:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "SAindex:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "chrLength.txt:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "chrName.txt:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "chrNameLength.txt:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "chrStart.txt:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "exonGeTrInfo.tab:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "exonInfo.tab:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "geneInfo.tab:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "genomeParameters.txt:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "sjdbInfo.txt:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "sjdbList.fromGTF.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "sjdbList.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "transcriptInfo.tab:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "1": [
+ "versions.yml:md5,562a70f12dd9e695449b59fbf604e98d"
+ ],
+ "index": [
+ [
+ "Genome:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "Log.out:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "SA:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "SAindex:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "chrLength.txt:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "chrName.txt:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "chrNameLength.txt:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "chrStart.txt:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "exonGeTrInfo.tab:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "exonInfo.tab:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "geneInfo.tab:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "genomeParameters.txt:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "sjdbInfo.txt:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "sjdbList.fromGTF.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "sjdbList.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "transcriptInfo.tab:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "versions": [
+ "versions.yml:md5,562a70f12dd9e695449b59fbf604e98d"
+ ]
+ }
],
"meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
},
- "timestamp": "2024-03-05T10:31:12.12097"
+ "timestamp": "2024-07-22T20:14:52.732323"
}
}
\ No newline at end of file
diff --git a/modules/nf-core/bbmap/bbsplit/main.nf b/modules/nf-core/bbmap/bbsplit/main.nf
index 57bf6398a..f308f6983 100644
--- a/modules/nf-core/bbmap/bbsplit/main.nf
+++ b/modules/nf-core/bbmap/bbsplit/main.nf
@@ -54,7 +54,6 @@ process BBMAP_BBSPLIT {
log.error 'ERROR: Please specify as input a primary fasta file along with names and paths to non-primary fasta files.'
}
} else {
- index_files = ''
if (index) {
index_files = "path=$index"
} else if (primary_ref && other_ref_names && other_ref_paths) {
@@ -109,14 +108,19 @@ process BBMAP_BBSPLIT {
def prefix = task.ext.prefix ?: "${meta.id}"
def other_refs = ''
other_ref_names.eachWithIndex { name, index ->
- other_refs += "echo '' | gzip > ${prefix}_primary_${name}.fastq.gz"
+ other_refs += "echo '' | gzip > ${prefix}_${name}.fastq.gz"
}
"""
- mkdir bbsplit
+ if [ ! -d bbsplit ]; then
+ mkdir bbsplit
+ fi
+
+ if ! (${only_build_index}); then
+ echo '' | gzip > ${prefix}_primary.fastq.gz
+ ${other_refs}
+ touch ${prefix}.stats.txt
+ fi
- echo '' | gzip > ${prefix}_primary.fastq.gz
- ${other_refs}
- touch ${prefix}.stats.txt
touch ${prefix}.log
cat <<-END_VERSIONS > versions.yml
diff --git a/modules/nf-core/bbmap/bbsplit/tests/main.nf.test b/modules/nf-core/bbmap/bbsplit/tests/main.nf.test
index b878366b3..0674d247f 100644
--- a/modules/nf-core/bbmap/bbsplit/tests/main.nf.test
+++ b/modules/nf-core/bbmap/bbsplit/tests/main.nf.test
@@ -3,20 +3,13 @@ nextflow_process {
name "Test Process BBMAP_BBSPLIT"
script "../main.nf"
process "BBMAP_BBSPLIT"
- tag "modules"
- tag "modules_nfcore"
- tag "bbmap"
- tag "bbmap/bbsplit"
test("sarscov2_se_fastq_fasta_chr22_fasta - index") {
when {
- params {
- outdir = "$outputDir"
- }
process {
"""
- input[0] = [[:],[]]
+ input[0] = [[:], []]
input[1] = []
input[2] = Channel.of(file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true))
input[3] = Channel.of([
@@ -43,12 +36,9 @@ nextflow_process {
options "-stub"
when {
- params {
- outdir = "$outputDir"
- }
process {
"""
- input[0] = [[:],[]]
+ input[0] = [[:], []]
input[1] = []
input[2] = Channel.of(file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true))
input[3] = Channel.of([
@@ -76,7 +66,7 @@ nextflow_process {
script "../main.nf"
process {
"""
- input[0] = [[:],[]]
+ input[0] = [[:], []]
input[1] = []
input[2] = Channel.of(file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true))
input[3] = Channel.of([
@@ -90,9 +80,6 @@ nextflow_process {
}
when {
- params {
- outdir = "$outputDir"
- }
process {
"""
input[0] = Channel.of([
@@ -142,9 +129,11 @@ nextflow_process {
assertAll(
{ assert process.success },
{ assert path(process.out.log[0][1]).text.contains("If you wish to regenerate the index") },
- { assert snapshot(filteredFiles).match("bbsplit_index_filtered_files")},
{ assert filesExist : "One or more files to exclude do not exist" },
- { assert snapshot(process.out.versions).match("versions")}
+ { assert snapshot(
+ filteredFiles,
+ process.out.versions
+ ).match()}
)
}
}
@@ -153,17 +142,33 @@ nextflow_process {
options "-stub"
- when {
- params {
- outdir = "$outputDir"
+ setup {
+
+ run("BBMAP_BBSPLIT", alias: "BBMAP_BBSPLIT_INDEX") {
+ script "../main.nf"
+ process {
+ """
+ input[0] = [[:], []]
+ input[1] = []
+ input[2] = Channel.of(file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true))
+ input[3] = Channel.of([
+ [ 'human' ], // meta map
+ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr22/sequence/chr22_23800000-23980000.fa', checkIfExists: true)
+ ])
+ input[4] = true
+ """
+ }
}
+ }
+
+ when {
process {
"""
input[0] = Channel.of([
[ id:'test', single_end:true ], // meta map
file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true)
])
- input[1] = []
+ input[1] = BBMAP_BBSPLIT_INDEX.out.index
input[2] = Channel.of(file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true))
input[3] = Channel.of([
[ 'human' ], // meta map
diff --git a/modules/nf-core/bbmap/bbsplit/tests/main.nf.test.snap b/modules/nf-core/bbmap/bbsplit/tests/main.nf.test.snap
index 6a4889aaa..0d648d7d6 100644
--- a/modules/nf-core/bbmap/bbsplit/tests/main.nf.test.snap
+++ b/modules/nf-core/bbmap/bbsplit/tests/main.nf.test.snap
@@ -1,5 +1,5 @@
{
- "bbsplit_index_filtered_files": {
+ "sarscov2_se_fastq_fasta_chr22_fasta": {
"content": [
[
"chr1.chrom.gz:md5,8fec4c63ec642613ad10adf4cc2e6ade",
@@ -7,25 +7,16 @@
"chr1_index_k13_c13_b1.block2.gz:md5,2556b45206835a0ff7078d683b5fd6e2",
"merged_ref_9222711925172838098.fa.gz:md5,983cef447fb28394b88a5b49b3579f0c",
"namelist.txt:md5,45e7a4cdc7a11a39ada56844ca3a1e30"
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.10.1"
- },
- "timestamp": "2024-02-01T17:15:59.705013452"
- },
- "versions": {
- "content": [
+ ],
[
"versions.yml:md5,cb7f0e697ab2537f8ced951bfade90d4"
]
],
"meta": {
"nf-test": "0.8.4",
- "nextflow": "23.10.1"
+ "nextflow": "24.04.2"
},
- "timestamp": "2024-02-01T17:11:22.441753642"
+ "timestamp": "2024-07-05T11:41:32.116928"
},
"sarscov2_se_fastq_fasta_chr22_fasta - index": {
"content": [
@@ -37,7 +28,7 @@
"nf-test": "0.8.4",
"nextflow": "24.04.2"
},
- "timestamp": "2024-06-20T16:41:29.784895"
+ "timestamp": "2024-07-05T11:41:06.072212"
},
"sarscov2_se_fastq_fasta_chr22_fasta - index - stub": {
"content": [
@@ -48,34 +39,13 @@
]
],
"1": [
- [
- {
-
- },
- [
- "null_primary.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
- "null_primary_human.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
- ]
- ]
+
],
"2": [
- [
- {
-
- },
- [
- "null_primary.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
- "null_primary_human.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
- ]
- ]
+
],
"3": [
- [
- {
-
- },
- "null.stats.txt:md5,d41d8cd98f00b204e9800998ecf8427e"
- ]
+
],
"4": [
[
@@ -89,15 +59,7 @@
"versions.yml:md5,cb7f0e697ab2537f8ced951bfade90d4"
],
"all_fastq": [
- [
- {
-
- },
- [
- "null_primary.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
- "null_primary_human.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
- ]
- ]
+
],
"index": [
[
@@ -113,23 +75,10 @@
]
],
"primary_fastq": [
- [
- {
-
- },
- [
- "null_primary.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
- "null_primary_human.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
- ]
- ]
+
],
"stats": [
- [
- {
-
- },
- "null.stats.txt:md5,d41d8cd98f00b204e9800998ecf8427e"
- ]
+
],
"versions": [
"versions.yml:md5,cb7f0e697ab2537f8ced951bfade90d4"
@@ -140,7 +89,7 @@
"nf-test": "0.8.4",
"nextflow": "24.04.2"
},
- "timestamp": "2024-06-20T18:49:27.280432"
+ "timestamp": "2024-07-05T11:45:21.48352"
},
"sarscov2_se_fastq_fasta_chr22_fasta - stub": {
"content": [
@@ -156,10 +105,7 @@
"id": "test",
"single_end": true
},
- [
- "test_primary.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
- "test_primary_human.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
- ]
+ "test_primary.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
]
],
"2": [
@@ -169,8 +115,8 @@
"single_end": true
},
[
- "test_primary.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
- "test_primary_human.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ "test_human.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+ "test_primary.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
]
]
],
@@ -202,8 +148,8 @@
"single_end": true
},
[
- "test_primary.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
- "test_primary_human.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ "test_human.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+ "test_primary.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
]
]
],
@@ -227,10 +173,7 @@
"id": "test",
"single_end": true
},
- [
- "test_primary.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
- "test_primary_human.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
- ]
+ "test_primary.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
]
],
"stats": [
@@ -251,6 +194,6 @@
"nf-test": "0.8.4",
"nextflow": "24.04.2"
},
- "timestamp": "2024-06-20T16:16:05.793544"
+ "timestamp": "2024-07-05T11:51:38.805111"
}
}
\ No newline at end of file
diff --git a/modules/nf-core/bedtools/genomecov/tests/main.nf.test b/modules/nf-core/bedtools/genomecov/tests/main.nf.test
index 16a03492c..b8caa1e11 100644
--- a/modules/nf-core/bedtools/genomecov/tests/main.nf.test
+++ b/modules/nf-core/bedtools/genomecov/tests/main.nf.test
@@ -4,11 +4,6 @@ nextflow_process {
process "BEDTOOLS_GENOMECOV"
config "./nextflow.config"
- tag "modules"
- tag "modules_nfcore"
- tag "bedtools"
- tag "bedtools/genomecov"
-
test("sarscov2 - no scale") {
when {
process {
diff --git a/modules/nf-core/cat/fastq/main.nf b/modules/nf-core/cat/fastq/main.nf
index f132b2adc..b68e5f911 100644
--- a/modules/nf-core/cat/fastq/main.nf
+++ b/modules/nf-core/cat/fastq/main.nf
@@ -53,9 +53,9 @@ process CAT_FASTQ {
def prefix = task.ext.prefix ?: "${meta.id}"
def readList = reads instanceof List ? reads.collect{ it.toString() } : [reads.toString()]
if (meta.single_end) {
- if (readList.size > 1) {
+ if (readList.size >= 1) {
"""
- touch ${prefix}.merged.fastq.gz
+ echo '' | gzip > ${prefix}.merged.fastq.gz
cat <<-END_VERSIONS > versions.yml
"${task.process}":
@@ -64,10 +64,10 @@ process CAT_FASTQ {
"""
}
} else {
- if (readList.size > 2) {
+ if (readList.size >= 2) {
"""
- touch ${prefix}_1.merged.fastq.gz
- touch ${prefix}_2.merged.fastq.gz
+ echo '' | gzip > ${prefix}_1.merged.fastq.gz
+ echo '' | gzip > ${prefix}_2.merged.fastq.gz
cat <<-END_VERSIONS > versions.yml
"${task.process}":
diff --git a/modules/nf-core/cat/fastq/tests/main.nf.test b/modules/nf-core/cat/fastq/tests/main.nf.test
index 7236c6cd9..6cc7aad15 100644
--- a/modules/nf-core/cat/fastq/tests/main.nf.test
+++ b/modules/nf-core/cat/fastq/tests/main.nf.test
@@ -9,9 +9,6 @@ nextflow_process {
test("test_cat_fastq_single_end") {
when {
- params {
- outdir = "$outputDir"
- }
process {
"""
input[0] = Channel.of([
@@ -34,9 +31,6 @@ nextflow_process {
test("test_cat_fastq_paired_end") {
when {
- params {
- outdir = "$outputDir"
- }
process {
"""
input[0] = Channel.of([
@@ -61,9 +55,6 @@ nextflow_process {
test("test_cat_fastq_single_end_same_name") {
when {
- params {
- outdir = "$outputDir"
- }
process {
"""
input[0] = Channel.of([
@@ -86,9 +77,6 @@ nextflow_process {
test("test_cat_fastq_paired_end_same_name") {
when {
- params {
- outdir = "$outputDir"
- }
process {
"""
input[0] = Channel.of([
@@ -113,9 +101,129 @@ nextflow_process {
test("test_cat_fastq_single_end_single_file") {
when {
- params {
- outdir = "$outputDir"
+ process {
+ """
+ input[0] = Channel.of([
+ [ id:'test', single_end:true ], // meta map
+ [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true)]
+ ])
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert process.success },
+ { assert snapshot(process.out).match() }
+ )
+ }
+ }
+
+ test("test_cat_fastq_single_end - stub") {
+
+ options "-stub"
+
+ when {
+ process {
+ """
+ input[0] = Channel.of([
+ [ id:'test', single_end:true ], // meta map
+ [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)]
+ ])
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert process.success },
+ { assert snapshot(process.out).match() }
+ )
+ }
+ }
+
+ test("test_cat_fastq_paired_end - stub") {
+
+ options "-stub"
+
+ when {
+ process {
+ """
+ input[0] = Channel.of([
+ [ id:'test', single_end:false ], // meta map
+ [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test2_1.fastq.gz', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test2_2.fastq.gz', checkIfExists: true)]
+ ])
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert process.success },
+ { assert snapshot(process.out).match() }
+ )
+ }
+ }
+
+ test("test_cat_fastq_single_end_same_name - stub") {
+
+ options "-stub"
+
+ when {
+ process {
+ """
+ input[0] = Channel.of([
+ [ id:'test', single_end:true ], // meta map
+ [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true)]
+ ])
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert process.success },
+ { assert snapshot(process.out).match() }
+ )
+ }
+ }
+
+ test("test_cat_fastq_paired_end_same_name - stub") {
+
+ options "-stub"
+
+ when {
+ process {
+ """
+ input[0] = Channel.of([
+ [ id:'test', single_end:false ], // meta map
+ [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)]
+ ])
+ """
}
+ }
+
+ then {
+ assertAll(
+ { assert process.success },
+ { assert snapshot(process.out).match() }
+ )
+ }
+ }
+
+ test("test_cat_fastq_single_end_single_file - stub") {
+
+ options "-stub"
+
+ when {
process {
"""
input[0] = Channel.of([
diff --git a/modules/nf-core/cat/fastq/tests/main.nf.test.snap b/modules/nf-core/cat/fastq/tests/main.nf.test.snap
index 43dfe28fc..aec119a94 100644
--- a/modules/nf-core/cat/fastq/tests/main.nf.test.snap
+++ b/modules/nf-core/cat/fastq/tests/main.nf.test.snap
@@ -28,6 +28,10 @@
]
}
],
+ "meta": {
+ "nf-test": "0.8.4",
+ "nextflow": "24.04.2"
+ },
"timestamp": "2024-01-17T17:30:39.816981"
},
"test_cat_fastq_single_end_same_name": {
@@ -59,6 +63,10 @@
]
}
],
+ "meta": {
+ "nf-test": "0.8.4",
+ "nextflow": "24.04.2"
+ },
"timestamp": "2024-01-17T17:32:35.229332"
},
"test_cat_fastq_single_end_single_file": {
@@ -90,6 +98,10 @@
]
}
],
+ "meta": {
+ "nf-test": "0.8.4",
+ "nextflow": "24.04.2"
+ },
"timestamp": "2024-01-17T17:34:00.058829"
},
"test_cat_fastq_paired_end_same_name": {
@@ -127,8 +139,123 @@
]
}
],
+ "meta": {
+ "nf-test": "0.8.4",
+ "nextflow": "24.04.2"
+ },
"timestamp": "2024-01-17T17:33:33.031555"
},
+ "test_cat_fastq_single_end - stub": {
+ "content": [
+ {
+ "0": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ],
+ "1": [
+ "versions.yml:md5,d42d6e24d67004608495883e00bd501b"
+ ],
+ "reads": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ],
+ "versions": [
+ "versions.yml:md5,d42d6e24d67004608495883e00bd501b"
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.8.4",
+ "nextflow": "24.04.2"
+ },
+ "timestamp": "2024-07-05T12:07:28.244999"
+ },
+ "test_cat_fastq_paired_end_same_name - stub": {
+ "content": [
+ {
+ "0": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test_1.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+ "test_2.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ]
+ ],
+ "1": [
+ "versions.yml:md5,d42d6e24d67004608495883e00bd501b"
+ ],
+ "reads": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test_1.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+ "test_2.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ]
+ ],
+ "versions": [
+ "versions.yml:md5,d42d6e24d67004608495883e00bd501b"
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.8.4",
+ "nextflow": "24.04.2"
+ },
+ "timestamp": "2024-07-05T12:07:57.070911"
+ },
+ "test_cat_fastq_single_end_same_name - stub": {
+ "content": [
+ {
+ "0": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ],
+ "1": [
+ "versions.yml:md5,d42d6e24d67004608495883e00bd501b"
+ ],
+ "reads": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ],
+ "versions": [
+ "versions.yml:md5,d42d6e24d67004608495883e00bd501b"
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.8.4",
+ "nextflow": "24.04.2"
+ },
+ "timestamp": "2024-07-05T12:07:46.796254"
+ },
"test_cat_fastq_paired_end": {
"content": [
{
@@ -164,6 +291,86 @@
]
}
],
+ "meta": {
+ "nf-test": "0.8.4",
+ "nextflow": "24.04.2"
+ },
"timestamp": "2024-01-17T17:32:02.270935"
+ },
+ "test_cat_fastq_paired_end - stub": {
+ "content": [
+ {
+ "0": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test_1.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+ "test_2.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ]
+ ],
+ "1": [
+ "versions.yml:md5,d42d6e24d67004608495883e00bd501b"
+ ],
+ "reads": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test_1.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+ "test_2.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ]
+ ],
+ "versions": [
+ "versions.yml:md5,d42d6e24d67004608495883e00bd501b"
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.8.4",
+ "nextflow": "24.04.2"
+ },
+ "timestamp": "2024-07-05T12:07:37.807553"
+ },
+ "test_cat_fastq_single_end_single_file - stub": {
+ "content": [
+ {
+ "0": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ],
+ "1": [
+ "versions.yml:md5,d42d6e24d67004608495883e00bd501b"
+ ],
+ "reads": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ],
+ "versions": [
+ "versions.yml:md5,d42d6e24d67004608495883e00bd501b"
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.8.4",
+ "nextflow": "24.04.2"
+ },
+ "timestamp": "2024-07-05T12:14:51.861264"
}
}
\ No newline at end of file
diff --git a/modules/nf-core/custom/catadditionalfasta/tests/main.nf.test b/modules/nf-core/custom/catadditionalfasta/tests/main.nf.test
index 70227f1c5..878c05d16 100644
--- a/modules/nf-core/custom/catadditionalfasta/tests/main.nf.test
+++ b/modules/nf-core/custom/catadditionalfasta/tests/main.nf.test
@@ -26,9 +26,11 @@ nextflow_process {
then {
assertAll(
{ assert process.success },
- { assert snapshot(process.out.fasta).match("fasta") },
- { assert snapshot(process.out.gtf).match("gtf") },
- { assert snapshot(process.out.versions).match("versions") }
+ { assert snapshot(
+ process.out.fasta,
+ process.out.gtf,
+ process.out.versions
+ ).match() }
)
}
}
diff --git a/modules/nf-core/custom/catadditionalfasta/tests/main.nf.test.snap b/modules/nf-core/custom/catadditionalfasta/tests/main.nf.test.snap
index 9e49a90c9..4767fd9a0 100644
--- a/modules/nf-core/custom/catadditionalfasta/tests/main.nf.test.snap
+++ b/modules/nf-core/custom/catadditionalfasta/tests/main.nf.test.snap
@@ -1,17 +1,5 @@
{
- "versions": {
- "content": [
- [
- "versions.yml:md5,26f47339777a265af57338ac7f0f8798"
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.04.2"
- },
- "timestamp": "2023-12-20T20:52:55.242485"
- },
- "gtf": {
+ "sarscov2 - fastq - gtf": {
"content": [
[
[
@@ -19,33 +7,27 @@
"id": "test",
"single_end": false
},
- "genome_transcriptome.gtf:md5,bc88d95e7f27540e6b9906105d5be361"
+ "genome_transcriptome.fasta:md5,6a20c1a2e465519320a0d01f338f5cb5"
]
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.04.2"
- },
- "timestamp": "2023-12-20T19:46:31.839377"
- },
- "fasta": {
- "content": [
+ ],
[
[
{
"id": "test",
"single_end": false
},
- "genome_transcriptome.fasta:md5,6a20c1a2e465519320a0d01f338f5cb5"
+ "genome_transcriptome.gtf:md5,bc88d95e7f27540e6b9906105d5be361"
]
+ ],
+ [
+ "versions.yml:md5,26f47339777a265af57338ac7f0f8798"
]
],
"meta": {
"nf-test": "0.8.4",
"nextflow": "24.04.2"
},
- "timestamp": "2023-12-20T19:42:47.12194"
+ "timestamp": "2024-07-05T12:19:28.965471"
},
"sarscov2 - fastq - gtf - stub": {
"content": [
@@ -98,6 +80,6 @@
"nf-test": "0.8.4",
"nextflow": "24.04.2"
},
- "timestamp": "2024-06-20T17:10:38.966949"
+ "timestamp": "2024-07-05T12:19:38.549677"
}
}
\ No newline at end of file
diff --git a/modules/nf-core/custom/getchromsizes/main.nf b/modules/nf-core/custom/getchromsizes/main.nf
index 581f4b77d..3edf7c221 100644
--- a/modules/nf-core/custom/getchromsizes/main.nf
+++ b/modules/nf-core/custom/getchromsizes/main.nf
@@ -35,6 +35,9 @@ process CUSTOM_GETCHROMSIZES {
"""
touch ${fasta}.fai
touch ${fasta}.sizes
+ if [[ "${fasta.extension}" == "gz" ]]; then
+ touch ${fasta}.gzi
+ fi
cat <<-END_VERSIONS > versions.yml
"${task.process}":
diff --git a/modules/nf-core/custom/getchromsizes/tests/main.nf.test b/modules/nf-core/custom/getchromsizes/tests/main.nf.test
index 3b18914b1..2dadc1a55 100644
--- a/modules/nf-core/custom/getchromsizes/tests/main.nf.test
+++ b/modules/nf-core/custom/getchromsizes/tests/main.nf.test
@@ -7,9 +7,6 @@ nextflow_process {
test("test_custom_getchromsizes") {
when {
- params {
- outdir = "$outputDir"
- }
process {
"""
input[0] = Channel.of([
@@ -26,15 +23,11 @@ nextflow_process {
{ assert snapshot(process.out).match() }
)
}
-
}
test("test_custom_getchromsizes_bgzip") {
when {
- params {
- outdir = "$outputDir"
- }
process {
"""
input[0] = Channel.of([
@@ -51,7 +44,51 @@ nextflow_process {
{ assert snapshot(process.out).match() }
)
}
+ }
+
+ test("test_custom_getchromsizes - stub") {
+
+ options "-stub"
+
+ when {
+ process {
+ """
+ input[0] = Channel.of([
+ [ id:'test' ], // meta map
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)
+ ])
+ """
+ }
+ }
+ then {
+ assertAll (
+ { assert process.success },
+ { assert snapshot(process.out).match() }
+ )
+ }
}
+ test("test_custom_getchromsizes_bgzip - stub") {
+
+ options "-stub"
+
+ when {
+ process {
+ """
+ input[0] = Channel.of([
+ [ id:'test' ], // meta map
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.gz', checkIfExists: true)
+ ])
+ """
+ }
+ }
+
+ then {
+ assertAll (
+ { assert process.success },
+ { assert snapshot(process.out).match() }
+ )
+ }
+ }
}
diff --git a/modules/nf-core/custom/getchromsizes/tests/main.nf.test.snap b/modules/nf-core/custom/getchromsizes/tests/main.nf.test.snap
index 3c53d4624..c37b284d7 100644
--- a/modules/nf-core/custom/getchromsizes/tests/main.nf.test.snap
+++ b/modules/nf-core/custom/getchromsizes/tests/main.nf.test.snap
@@ -1,4 +1,69 @@
{
+ "test_custom_getchromsizes_bgzip - stub": {
+ "content": [
+ {
+ "0": [
+ [
+ {
+ "id": "test"
+ },
+ "genome.fasta.gz.sizes:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "1": [
+ [
+ {
+ "id": "test"
+ },
+ "genome.fasta.gz.fai:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "2": [
+ [
+ {
+ "id": "test"
+ },
+ "genome.fasta.gz.gzi:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "3": [
+ "versions.yml:md5,0d5a7c33bddcb1edad6bf0705b258e6f"
+ ],
+ "fai": [
+ [
+ {
+ "id": "test"
+ },
+ "genome.fasta.gz.fai:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "gzi": [
+ [
+ {
+ "id": "test"
+ },
+ "genome.fasta.gz.gzi:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "sizes": [
+ [
+ {
+ "id": "test"
+ },
+ "genome.fasta.gz.sizes:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "versions": [
+ "versions.yml:md5,0d5a7c33bddcb1edad6bf0705b258e6f"
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.8.4",
+ "nextflow": "24.04.2"
+ },
+ "timestamp": "2024-07-05T12:38:36.927106"
+ },
"test_custom_getchromsizes": {
"content": [
{
@@ -118,5 +183,60 @@
"nextflow": "24.04.2"
},
"timestamp": "2024-06-20T13:23:06.241379"
+ },
+ "test_custom_getchromsizes - stub": {
+ "content": [
+ {
+ "0": [
+ [
+ {
+ "id": "test"
+ },
+ "genome.fasta.sizes:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "1": [
+ [
+ {
+ "id": "test"
+ },
+ "genome.fasta.fai:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "2": [
+
+ ],
+ "3": [
+ "versions.yml:md5,0d5a7c33bddcb1edad6bf0705b258e6f"
+ ],
+ "fai": [
+ [
+ {
+ "id": "test"
+ },
+ "genome.fasta.fai:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "gzi": [
+
+ ],
+ "sizes": [
+ [
+ {
+ "id": "test"
+ },
+ "genome.fasta.sizes:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "versions": [
+ "versions.yml:md5,0d5a7c33bddcb1edad6bf0705b258e6f"
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.8.4",
+ "nextflow": "24.04.2"
+ },
+ "timestamp": "2024-07-05T12:24:05.697845"
}
}
\ No newline at end of file
diff --git a/modules/nf-core/custom/tx2gene/tests/main.nf.test b/modules/nf-core/custom/tx2gene/tests/main.nf.test
index 8a7a6d1b2..e56a0b8fe 100644
--- a/modules/nf-core/custom/tx2gene/tests/main.nf.test
+++ b/modules/nf-core/custom/tx2gene/tests/main.nf.test
@@ -4,22 +4,21 @@ nextflow_process {
script "../main.nf"
process "CUSTOM_TX2GENE"
- setup {
+ test("saccharomyces_cerevisiae - gtf") {
- run("UNTAR") {
- script "../../../untar/main.nf"
- process {
- """
- input[0] = Channel.of([
- [ id:'test'], // meta map
- file(params.modules_testdata_base_path + 'genomics/eukaryotes/saccharomyces_cerevisiae/kallisto_results.tar.gz', checkIfExists: true)
- ])
- """
+ setup {
+ run("UNTAR") {
+ script "../../../untar/main.nf"
+ process {
+ """
+ input[0] = Channel.of([
+ [ id:'test'], // meta map
+ file(params.modules_testdata_base_path + 'genomics/eukaryotes/saccharomyces_cerevisiae/kallisto_results.tar.gz', checkIfExists: true)
+ ])
+ """
+ }
}
}
- }
-
- test("saccharomyces_cerevisiae - gtf") {
when {
process {
@@ -39,8 +38,7 @@ nextflow_process {
then {
assertAll(
{ assert process.success },
- { assert snapshot(process.out.tx2gene).match('tx2gene') },
- { assert snapshot(process.out.versions).match('versions') }
+ { assert snapshot(process.out).match() }
)
}
}
@@ -49,6 +47,20 @@ nextflow_process {
options "-stub"
+ setup {
+ run("UNTAR") {
+ script "../../../untar/main.nf"
+ process {
+ """
+ input[0] = Channel.of([
+ [ id:'test'], // meta map
+ file(params.modules_testdata_base_path + 'genomics/eukaryotes/saccharomyces_cerevisiae/kallisto_results.tar.gz', checkIfExists: true)
+ ])
+ """
+ }
+ }
+ }
+
when {
process {
"""
@@ -67,8 +79,7 @@ nextflow_process {
then {
assertAll(
{ assert process.success },
- { assert snapshot(process.out.tx2gene).match('tx2gene - stub') },
- { assert snapshot(process.out.versions).match('versions - stub') }
+ { assert snapshot(process.out).match() }
)
}
}
diff --git a/modules/nf-core/custom/tx2gene/tests/main.nf.test.snap b/modules/nf-core/custom/tx2gene/tests/main.nf.test.snap
index 1e76e10d6..c19f10f71 100644
--- a/modules/nf-core/custom/tx2gene/tests/main.nf.test.snap
+++ b/modules/nf-core/custom/tx2gene/tests/main.nf.test.snap
@@ -1,60 +1,68 @@
{
- "versions": {
+ "saccharomyces_cerevisiae - gtf": {
"content": [
- [
- "versions.yml:md5,fb8145d7fbc6043ba031249b23ecda50"
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-02-26T13:14:18.218251"
- },
- "tx2gene": {
- "content": [
- [
- [
- {
- "id": "test"
- },
- "test.tx2gene.tsv:md5,0e2418a69d2eba45097ebffc2f700bfe"
+ {
+ "0": [
+ [
+ {
+ "id": "test"
+ },
+ "test.tx2gene.tsv:md5,0e2418a69d2eba45097ebffc2f700bfe"
+ ]
+ ],
+ "1": [
+ "versions.yml:md5,fb8145d7fbc6043ba031249b23ecda50"
+ ],
+ "tx2gene": [
+ [
+ {
+ "id": "test"
+ },
+ "test.tx2gene.tsv:md5,0e2418a69d2eba45097ebffc2f700bfe"
+ ]
+ ],
+ "versions": [
+ "versions.yml:md5,fb8145d7fbc6043ba031249b23ecda50"
]
- ]
+ }
],
"meta": {
"nf-test": "0.8.4",
- "nextflow": "24.01.0"
+ "nextflow": "24.04.2"
},
- "timestamp": "2024-02-26T13:14:18.21054"
+ "timestamp": "2024-07-05T13:13:11.305047"
},
- "tx2gene - stub": {
+ "saccharomyces_cerevisiae - gtf - stub": {
"content": [
- [
- [
- {
- "id": "test"
- },
- "test.tx2gene.tsv:md5,d41d8cd98f00b204e9800998ecf8427e"
+ {
+ "0": [
+ [
+ {
+ "id": "test"
+ },
+ "test.tx2gene.tsv:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "1": [
+ "versions.yml:md5,5613eefbca41377128f1d8dc09b9fb60"
+ ],
+ "tx2gene": [
+ [
+ {
+ "id": "test"
+ },
+ "test.tx2gene.tsv:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "versions": [
+ "versions.yml:md5,5613eefbca41377128f1d8dc09b9fb60"
]
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-02-26T13:14:25.915434"
- },
- "versions - stub": {
- "content": [
- [
- "versions.yml:md5,5613eefbca41377128f1d8dc09b9fb60"
- ]
+ }
],
"meta": {
"nf-test": "0.8.4",
- "nextflow": "24.01.0"
+ "nextflow": "24.04.3"
},
- "timestamp": "2024-02-26T13:14:25.919243"
+ "timestamp": "2024-07-10T15:15:34.064489"
}
}
\ No newline at end of file
diff --git a/modules/nf-core/dupradar/templates/dupradar.r b/modules/nf-core/dupradar/templates/dupradar.r
index 7653e5873..cbaeded13 100755
--- a/modules/nf-core/dupradar/templates/dupradar.r
+++ b/modules/nf-core/dupradar/templates/dupradar.r
@@ -88,6 +88,7 @@ line="#id: DupInt
# max: 100
# min: 0
# scale: 'RdYlGn-rev'
+# format: '{:.2f}%'
Sample dupRadar_intercept"
write(line,file=paste0(output_prefix, "_dup_intercept_mqc.txt"),append=TRUE)
@@ -114,21 +115,21 @@ line="#id: dupradar
# This plot shows the general linear models - a summary of the gene duplication distributions. \"
#pconfig:
# title: 'DupRadar General Linear Model'
-# xlog: True
+# xLog: True
# xlab: 'expression (reads/kbp)'
# ylab: '% duplicate reads'
# ymax: 100
# ymin: 0
# tt_label: '{point.x:.1f} reads/kbp: {point.y:,.2f}% duplicates'
-# x_lines:
+# xPlotLines:
# - color: 'green'
-# dash: 'LongDash'
+# dashStyle: 'LongDash'
# label:
# text: '0.5 RPKM'
# value: 0.5
# width: 1
# - color: 'red'
-# dash: 'LongDash'
+# dashStyle: 'LongDash'
# label:
# text: '1 read/bp'
# value: 1000
diff --git a/modules/nf-core/dupradar/tests/tags.yml b/modules/nf-core/dupradar/tests/tags.yml
deleted file mode 100644
index 255dc4ef3..000000000
--- a/modules/nf-core/dupradar/tests/tags.yml
+++ /dev/null
@@ -1,2 +0,0 @@
-dupradar:
- - "modules/nf-core/dupradar/**"
diff --git a/modules/nf-core/fastp/main.nf b/modules/nf-core/fastp/main.nf
index df60ff61e..e1b9f5656 100644
--- a/modules/nf-core/fastp/main.nf
+++ b/modules/nf-core/fastp/main.nf
@@ -106,14 +106,16 @@ process FASTP {
stub:
def prefix = task.ext.prefix ?: "${meta.id}"
def is_single_output = task.ext.args?.contains('--interleaved_in') || meta.single_end
- def touch_reads = (is_single_output && !discard_trimmed_pass) ? "echo '' | gzip > ${prefix}.fastp.fastq.gz" : "echo '' | gzip > ${prefix}_1.fastp.fastq.gz ; echo '' | gzip > ${prefix}_2.fastp.fastq.gz"
+ def touch_reads = (discard_trimmed_pass) ? "" : (is_single_output) ? "echo '' | gzip > ${prefix}.fastp.fastq.gz" : "echo '' | gzip > ${prefix}_1.fastp.fastq.gz ; echo '' | gzip > ${prefix}_2.fastp.fastq.gz"
def touch_merged = (!is_single_output && save_merged) ? "echo '' | gzip > ${prefix}.merged.fastq.gz" : ""
+ def touch_fail_fastq = (!save_trimmed_fail) ? "" : meta.single_end ? "echo '' | gzip > ${prefix}.fail.fastq.gz" : "echo '' | gzip > ${prefix}.paired.fail.fastq.gz ; echo '' | gzip > ${prefix}_1.fail.fastq.gz ; echo '' | gzip > ${prefix}_2.fail.fastq.gz"
"""
$touch_reads
+ $touch_fail_fastq
+ $touch_merged
touch "${prefix}.fastp.json"
touch "${prefix}.fastp.html"
touch "${prefix}.fastp.log"
- $touch_merged
cat <<-END_VERSIONS > versions.yml
"${task.process}":
diff --git a/modules/nf-core/fastp/tests/main.nf.test b/modules/nf-core/fastp/tests/main.nf.test
index ed5fa5ed6..c4e119aff 100644
--- a/modules/nf-core/fastp/tests/main.nf.test
+++ b/modules/nf-core/fastp/tests/main.nf.test
@@ -25,28 +25,33 @@ nextflow_process {
then {
assertAll(
{ assert process.success },
+ { assert path(process.out.html.get(0).get(1)).getText().contains("single end (151 cycles)") },
+ { assert path(process.out.log.get(0).get(1)).getText().contains("reads passed filter: 99") },
{ assert snapshot(
- process.out.reads,
process.out.json,
- process.out.versions).match() },
- { assert process.out.reads_fail == [] },
- { assert process.out.reads_merged == [] },
- { assert path(process.out.log.get(0).get(1)).getText().contains("reads passed filter: 99") },
- { assert path(process.out.html.get(0).get(1)).getText().contains("single end (151 cycles)") }
+ process.out.reads,
+ process.out.reads_fail,
+ process.out.reads_merged,
+ process.out.versions).match() }
)
}
}
- test("test_fastp_single_end-stub") {
-
- options '-stub'
+ test("test_fastp_paired_end") {
when {
+
process {
"""
+ adapter_fasta = []
+ save_trimmed_pass = true
+ save_trimmed_fail = false
+ save_merged = false
+
input[0] = Channel.of([
- [ id:'test', single_end:true ],
- [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ]
+ [ id:'test', single_end:false ], // meta map
+ [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ]
])
input[1] = []
input[2] = false
@@ -57,29 +62,29 @@ nextflow_process {
}
then {
-
assertAll(
{ assert process.success },
- { assert snapshot(process.out).match() }
+ { assert path(process.out.html.get(0).get(1)).getText().contains("The input has little adapter percentage (~0.000000%), probably it's trimmed before.") },
+ { assert path(process.out.log.get(0).get(1)).getText().contains("Q30 bases: 12281(88.3716%)") },
+ { assert snapshot(
+ process.out.json,
+ process.out.reads,
+ process.out.reads_fail,
+ process.out.reads_merged,
+ process.out.versions).match() }
)
}
}
- test("test_fastp_paired_end") {
+ test("fastp test_fastp_interleaved") {
+ config './nextflow.interleaved.config'
when {
-
process {
"""
- adapter_fasta = []
- save_trimmed_pass = true
- save_trimmed_fail = false
- save_merged = false
-
input[0] = Channel.of([
- [ id:'test', single_end:false ], // meta map
- [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
- file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ]
+ [ id:'test', single_end:true ], // meta map
+ [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_interleaved.fastq.gz', checkIfExists: true) ]
])
input[1] = []
input[2] = false
@@ -92,34 +97,31 @@ nextflow_process {
then {
assertAll(
{ assert process.success },
+ { assert path(process.out.html.get(0).get(1)).getText().contains("paired end (151 cycles + 151 cycles)") },
+ { assert path(process.out.log.get(0).get(1)).getText().contains("reads passed filter: 162") },
+ { assert process.out.reads_fail == [] },
+ { assert process.out.reads_merged == [] },
{ assert snapshot(
process.out.reads,
process.out.json,
- process.out.versions).match() },
- { assert process.out.reads_fail == [] },
- { assert process.out.reads_merged == [] },
- { assert path(process.out.log.get(0).get(1)).getText().contains("Q30 bases: 12281(88.3716%)") },
- { assert path(process.out.html.get(0).get(1)).getText().contains("The input has little adapter percentage (~0.000000%), probably it's trimmed before.") }
+ process.out.versions).match() }
)
}
}
- test("test_fastp_paired_end - stub") {
-
- options '-stub'
+ test("test_fastp_single_end_trim_fail") {
when {
process {
"""
input[0] = Channel.of([
- [ id:'test', single_end:false ], // meta map
- [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
- file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ]
+ [ id:'test', single_end:true ], // meta map
+ [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ]
])
input[1] = []
input[2] = false
- input[3] = false
+ input[3] = true
input[4] = false
"""
}
@@ -128,24 +130,32 @@ nextflow_process {
then {
assertAll(
{ assert process.success },
- { assert snapshot(process.out).match() },
+ { assert path(process.out.html.get(0).get(1)).getText().contains("single end (151 cycles)") },
+ { assert path(process.out.log.get(0).get(1)).getText().contains("reads passed filter: 99") },
+ { assert snapshot(
+ process.out.json,
+ process.out.reads,
+ process.out.reads_fail,
+ process.out.reads_merged,
+ process.out.versions).match() }
)
}
}
- test("fastp test_fastp_interleaved") {
+ test("test_fastp_paired_end_trim_fail") {
- config './nextflow.interleaved.config'
+ config './nextflow.save_failed.config'
when {
process {
"""
input[0] = Channel.of([
- [ id:'test', single_end:true ], // meta map
- [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_interleaved.fastq.gz', checkIfExists: true) ]
+ [ id:'test', single_end:false ], // meta map
+ [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)]
])
input[1] = []
input[2] = false
- input[3] = false
+ input[3] = true
input[4] = false
"""
}
@@ -154,35 +164,32 @@ nextflow_process {
then {
assertAll(
{ assert process.success },
+ { assert path(process.out.html.get(0).get(1)).getText().contains("The input has little adapter percentage (~0.000000%), probably it's trimmed before.") },
+ { assert path(process.out.log.get(0).get(1)).getText().contains("reads passed filter: 162") },
{ assert snapshot(
process.out.reads,
+ process.out.reads_fail,
+ process.out.reads_merged,
process.out.json,
- process.out.versions).match() },
- { assert process.out.reads_fail == [] },
- { assert process.out.reads_merged == [] },
- { assert path(process.out.log.get(0).get(1)).getText().contains("reads passed filter: 162") },
- { assert path(process.out.html.get(0).get(1)).getText().contains("paired end (151 cycles + 151 cycles)") }
+ process.out.versions).match() }
)
}
}
- test("fastp test_fastp_interleaved - stub") {
-
- options '-stub'
+ test("test_fastp_paired_end_merged") {
- config './nextflow.interleaved.config'
when {
-
process {
"""
input[0] = Channel.of([
- [ id:'test', single_end:true ], // meta map
- [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_interleaved.fastq.gz', checkIfExists: true) ]
+ [ id:'test', single_end:false ], // meta map
+ [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ]
])
input[1] = []
input[2] = false
input[3] = false
- input[4] = false
+ input[4] = true
"""
}
}
@@ -190,25 +197,32 @@ nextflow_process {
then {
assertAll(
{ assert process.success },
- { assert snapshot(process.out).match() },
+ { assert path(process.out.html.get(0).get(1)).getText().contains("The input has little adapter percentage (~0.000000%), probably it's trimmed before.") },
+ { assert path(process.out.log.get(0).get(1)).getText().contains("total reads: 75") },
+ { assert snapshot(
+ process.out.json,
+ process.out.reads,
+ process.out.reads_fail,
+ process.out.reads_merged,
+ process.out.versions).match() },
)
}
}
- test("test_fastp_single_end_trim_fail") {
+ test("test_fastp_paired_end_merged_adapterlist") {
when {
-
process {
"""
input[0] = Channel.of([
- [ id:'test', single_end:true ], // meta map
- [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ]
+ [ id:'test', single_end:false ], // meta map
+ [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ]
])
- input[1] = []
+ input[1] = Channel.of([ file(params.modules_testdata_base_path + 'delete_me/fastp/adapters.fasta', checkIfExists: true) ])
input[2] = false
- input[3] = true
- input[4] = false
+ input[3] = false
+ input[4] = true
"""
}
}
@@ -216,32 +230,30 @@ nextflow_process {
then {
assertAll(
{ assert process.success },
+ { assert path(process.out.html.get(0).get(1)).getText().contains("
") },
+ { assert path(process.out.log.get(0).get(1)).getText().contains("total bases: 13683") },
{ assert snapshot(
+ process.out.json,
process.out.reads,
process.out.reads_fail,
- process.out.json,
- process.out.versions).match() },
- { assert process.out.reads_merged == [] },
- { assert path(process.out.log.get(0).get(1)).getText().contains("reads passed filter: 99") },
- { assert path(process.out.html.get(0).get(1)).getText().contains("single end (151 cycles)") },
+ process.out.reads_merged,
+ process.out.versions).match() }
)
}
}
- test("test_fastp_paired_end_trim_fail") {
+ test("test_fastp_single_end_qc_only") {
- config './nextflow.save_failed.config'
when {
process {
"""
input[0] = Channel.of([
- [ id:'test', single_end:false ], // meta map
- [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
- file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)]
+ [ id:'test', single_end:true ],
+ [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ]
])
input[1] = []
- input[2] = false
- input[3] = true
+ input[2] = true
+ input[3] = false
input[4] = false
"""
}
@@ -250,19 +262,22 @@ nextflow_process {
then {
assertAll(
{ assert process.success },
+ { assert path(process.out.html.get(0).get(1)).getText().contains("single end (151 cycles)") },
+ { assert path(process.out.log.get(0).get(1)).getText().contains("reads passed filter: 99") },
{ assert snapshot(
+ process.out.json,
+ process.out.reads,
process.out.reads,
process.out.reads_fail,
- process.out.json,
- process.out.versions).match() },
- { assert process.out.reads_merged == [] },
- { assert path(process.out.log.get(0).get(1)).getText().contains("reads passed filter: 162") },
- { assert path(process.out.html.get(0).get(1)).getText().contains("The input has little adapter percentage (~0.000000%), probably it's trimmed before.") }
+ process.out.reads_fail,
+ process.out.reads_merged,
+ process.out.reads_merged,
+ process.out.versions).match() }
)
}
}
- test("test_fastp_paired_end_merged") {
+ test("test_fastp_paired_end_qc_only") {
when {
process {
@@ -273,9 +288,9 @@ nextflow_process {
file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ]
])
input[1] = []
- input[2] = false
+ input[2] = true
input[3] = false
- input[4] = true
+ input[4] = false
"""
}
}
@@ -283,34 +298,37 @@ nextflow_process {
then {
assertAll(
{ assert process.success },
+ { assert path(process.out.html.get(0).get(1)).getText().contains("The input has little adapter percentage (~0.000000%), probably it's trimmed before.") },
+ { assert path(process.out.log.get(0).get(1)).getText().contains("Q30 bases: 12281(88.3716%)") },
{ assert snapshot(
+ process.out.json,
process.out.reads,
+ process.out.reads,
+ process.out.reads_fail,
+ process.out.reads_fail,
process.out.reads_merged,
- process.out.json,
- process.out.versions).match() },
- { assert process.out.reads_fail == [] },
- { assert path(process.out.log.get(0).get(1)).getText().contains("total reads: 75") },
- { assert path(process.out.html.get(0).get(1)).getText().contains("The input has little adapter percentage (~0.000000%), probably it's trimmed before.") }
+ process.out.reads_merged,
+ process.out.versions).match() }
)
}
}
- test("test_fastp_paired_end_merged-stub") {
+ test("test_fastp_single_end - stub") {
- options '-stub'
+ options "-stub"
when {
+
process {
"""
input[0] = Channel.of([
- [ id:'test', single_end:false ], // meta map
- [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
- file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ]
+ [ id:'test', single_end:true ],
+ [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ]
])
input[1] = []
input[2] = false
input[3] = false
- input[4] = true
+ input[4] = false
"""
}
}
@@ -318,25 +336,33 @@ nextflow_process {
then {
assertAll(
{ assert process.success },
- { assert snapshot(process.out).match() },
+ { assert snapshot(process.out).match() }
)
}
}
- test("test_fastp_paired_end_merged_adapterlist") {
+ test("test_fastp_paired_end - stub") {
+
+ options "-stub"
when {
+
process {
"""
+ adapter_fasta = []
+ save_trimmed_pass = true
+ save_trimmed_fail = false
+ save_merged = false
+
input[0] = Channel.of([
[ id:'test', single_end:false ], // meta map
[ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ]
])
- input[1] = Channel.of([ file(params.modules_testdata_base_path + 'delete_me/fastp/adapters.fasta', checkIfExists: true) ])
+ input[1] = []
input[2] = false
input[3] = false
- input[4] = true
+ input[4] = false
"""
}
}
@@ -344,29 +370,25 @@ nextflow_process {
then {
assertAll(
{ assert process.success },
- { assert snapshot(
- process.out.reads,
- process.out.reads_merged,
- process.out.json,
- process.out.versions).match() },
- { assert process.out.reads_fail == [] },
- { assert path(process.out.log.get(0).get(1)).getText().contains("total bases: 13683") },
- { assert path(process.out.html.get(0).get(1)).getText().contains("
") }
+ { assert snapshot(process.out).match() }
)
}
}
- test("test_fastp_single_end_qc_only") {
+ test("fastp - stub test_fastp_interleaved") {
+
+ options "-stub"
+ config './nextflow.interleaved.config'
when {
process {
"""
input[0] = Channel.of([
- [ id:'test', single_end:true ],
- [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ]
+ [ id:'test', single_end:true ], // meta map
+ [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_interleaved.fastq.gz', checkIfExists: true) ]
])
input[1] = []
- input[2] = true
+ input[2] = false
input[3] = false
input[4] = false
"""
@@ -376,55 +398,101 @@ nextflow_process {
then {
assertAll(
{ assert process.success },
- { assert snapshot(
- process.out.reads,
- process.out.reads_fail,
- process.out.reads_merged,
- process.out.json,
- process.out.versions).match() },
- { assert process.out.reads == [] },
- { assert process.out.reads_fail == [] },
- { assert process.out.reads_merged == [] },
- { assert path(process.out.log.get(0).get(1)).getText().contains("reads passed filter: 99") },
- { assert path(process.out.html.get(0).get(1)).getText().contains("single end (151 cycles)") },
+ { assert snapshot(process.out).match() }
)
}
}
- test("test_fastp_single_end_qc_only-stub") {
+ test("test_fastp_single_end_trim_fail - stub") {
- options '-stub'
+ options "-stub"
when {
+
process {
"""
input[0] = Channel.of([
- [ id:'test', single_end:true ],
+ [ id:'test', single_end:true ], // meta map
[ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ]
])
input[1] = []
- input[2] = true
- input[3] = false
+ input[2] = false
+ input[3] = true
input[4] = false
"""
}
}
then {
+ assertAll(
+ { assert process.success },
+ { assert snapshot(process.out).match() }
+ )
+ }
+ }
+
+ test("test_fastp_paired_end_trim_fail - stub") {
+ options "-stub"
+
+ config './nextflow.save_failed.config'
+ when {
+ process {
+ """
+ input[0] = Channel.of([
+ [ id:'test', single_end:false ], // meta map
+ [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)]
+ ])
+ input[1] = []
+ input[2] = false
+ input[3] = true
+ input[4] = false
+ """
+ }
+ }
+
+ then {
assertAll(
{ assert process.success },
- { assert snapshot(process.out).match() },
+ { assert snapshot(process.out).match() }
)
}
}
- test("test_fastp_paired_end_qc_only") {
+ test("test_fastp_paired_end_merged - stub") {
+
+ options "-stub"
when {
- params {
- outdir = "$outputDir"
+ process {
+ """
+ input[0] = Channel.of([
+ [ id:'test', single_end:false ], // meta map
+ [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ]
+ ])
+ input[1] = []
+ input[2] = false
+ input[3] = false
+ input[4] = true
+ """
}
+ }
+
+ then {
+ assertAll(
+ { assert process.success },
+ { assert snapshot(process.out).match() }
+ )
+ }
+ }
+
+ test("test_fastp_paired_end_merged_adapterlist - stub") {
+
+ options "-stub"
+
+ when {
process {
"""
input[0] = Channel.of([
@@ -432,6 +500,33 @@ nextflow_process {
[ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ]
])
+ input[1] = Channel.of([ file(params.modules_testdata_base_path + 'delete_me/fastp/adapters.fasta', checkIfExists: true) ])
+ input[2] = false
+ input[3] = false
+ input[4] = true
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert process.success },
+ { assert snapshot(process.out).match() }
+ )
+ }
+ }
+
+ test("test_fastp_single_end_qc_only - stub") {
+
+ options "-stub"
+
+ when {
+ process {
+ """
+ input[0] = Channel.of([
+ [ id:'test', single_end:true ],
+ [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ]
+ ])
input[1] = []
input[2] = true
input[3] = false
@@ -443,24 +538,14 @@ nextflow_process {
then {
assertAll(
{ assert process.success },
- { assert snapshot(
- process.out.reads,
- process.out.reads_merged,
- process.out.reads_fail,
- process.out.json,
- process.out.versions).match() },
- { assert process.out.reads == [] },
- { assert process.out.reads_fail == [] },
- { assert process.out.reads_merged == [] },
- { assert path(process.out.log.get(0).get(1)).getText().contains("Q30 bases: 12281(88.3716%)") },
- { assert path(process.out.html.get(0).get(1)).getText().contains("The input has little adapter percentage (~0.000000%), probably it's trimmed before.") },
+ { assert snapshot(process.out).match() }
)
}
}
- test("test_fastp_paired_end_qc_only-stub") {
+ test("test_fastp_paired_end_qc_only - stub") {
- options '-stub'
+ options "-stub"
when {
process {
@@ -481,7 +566,7 @@ nextflow_process {
then {
assertAll(
{ assert process.success },
- { assert snapshot(process.out).match() },
+ { assert snapshot(process.out).match() }
)
}
}
diff --git a/modules/nf-core/fastp/tests/main.nf.test.snap b/modules/nf-core/fastp/tests/main.nf.test.snap
index b609b9a2a..54be7e45f 100644
--- a/modules/nf-core/fastp/tests/main.nf.test.snap
+++ b/modules/nf-core/fastp/tests/main.nf.test.snap
@@ -1,24 +1,15 @@
{
- "test_fastp_paired_end_qc_only-stub": {
+ "test_fastp_single_end_qc_only - stub": {
"content": [
{
"0": [
- [
- {
- "id": "test",
- "single_end": false
- },
- [
- "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
- "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
- ]
- ]
+
],
"1": [
[
{
"id": "test",
- "single_end": false
+ "single_end": true
},
"test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e"
]
@@ -27,7 +18,7 @@
[
{
"id": "test",
- "single_end": false
+ "single_end": true
},
"test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e"
]
@@ -36,7 +27,7 @@
[
{
"id": "test",
- "single_end": false
+ "single_end": true
},
"test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e"
]
@@ -54,7 +45,7 @@
[
{
"id": "test",
- "single_end": false
+ "single_end": true
},
"test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e"
]
@@ -63,7 +54,7 @@
[
{
"id": "test",
- "single_end": false
+ "single_end": true
},
"test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e"
]
@@ -72,22 +63,13 @@
[
{
"id": "test",
- "single_end": false
+ "single_end": true
},
"test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e"
]
],
"reads": [
- [
- {
- "id": "test",
- "single_end": false
- },
- [
- "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
- "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
- ]
- ]
+
],
"reads_fail": [
@@ -104,10 +86,19 @@
"nf-test": "0.8.4",
"nextflow": "24.04.2"
},
- "timestamp": "2024-06-08T05:42:26.603745039"
+ "timestamp": "2024-07-05T14:31:10.841098"
},
"test_fastp_paired_end": {
"content": [
+ [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.json:md5,1e0f8e27e71728e2b63fc64086be95cd"
+ ]
+ ],
[
[
{
@@ -119,6 +110,48 @@
"test_2.fastp.fastq.gz:md5,25cbdca08e2083dbd4f0502de6b62f39"
]
]
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+ "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02"
+ ]
+ ],
+ "meta": {
+ "nf-test": "0.8.4",
+ "nextflow": "24.04.2"
+ },
+ "timestamp": "2024-07-05T13:43:28.665779"
+ },
+ "test_fastp_paired_end_merged_adapterlist": {
+ "content": [
+ [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.json:md5,5914ca3f21ce162123a824e33e8564f6"
+ ]
+ ],
+ [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test_1.fastp.fastq.gz:md5,54b726a55e992a869fd3fa778afe1672",
+ "test_2.fastp.fastq.gz:md5,29d3b33b869f7b63417b8ff07bb128ba"
+ ]
+ ]
+ ],
+ [
+
],
[
[
@@ -126,7 +159,95 @@
"id": "test",
"single_end": false
},
- "test.fastp.json:md5,1e0f8e27e71728e2b63fc64086be95cd"
+ "test.merged.fastq.gz:md5,c873bb1ab3fa859dcc47306465e749d5"
+ ]
+ ],
+ [
+ "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02"
+ ]
+ ],
+ "meta": {
+ "nf-test": "0.8.4",
+ "nextflow": "24.04.2"
+ },
+ "timestamp": "2024-07-05T13:44:18.210375"
+ },
+ "test_fastp_single_end_qc_only": {
+ "content": [
+ [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.fastp.json:md5,5cc5f01e449309e0e689ed6f51a2294a"
+ ]
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+ "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02"
+ ]
+ ],
+ "meta": {
+ "nf-test": "0.8.4",
+ "nextflow": "24.04.2"
+ },
+ "timestamp": "2024-07-05T13:44:27.380974"
+ },
+ "test_fastp_paired_end_trim_fail": {
+ "content": [
+ [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test_1.fastp.fastq.gz:md5,6ff32a64c5188b9a9192be1398c262c7",
+ "test_2.fastp.fastq.gz:md5,db0cb7c9977e94ac2b4b446ebd017a8a"
+ ]
+ ]
+ ],
+ [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test.paired.fail.fastq.gz:md5,409b687c734cedd7a1fec14d316e1366",
+ "test_1.fail.fastq.gz:md5,4f273cf3159c13f79e8ffae12f5661f6",
+ "test_2.fail.fastq.gz:md5,f97b9edefb5649aab661fbc9e71fc995"
+ ]
+ ]
+ ],
+ [
+
+ ],
+ [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.json:md5,4c3268ddb50ea5b33125984776aa3519"
]
],
[
@@ -137,9 +258,9 @@
"nf-test": "0.8.4",
"nextflow": "24.04.2"
},
- "timestamp": "2024-06-10T13:02:09.747686552"
+ "timestamp": "2024-07-05T13:43:58.749589"
},
- "fastp test_fastp_interleaved - stub": {
+ "fastp - stub test_fastp_interleaved": {
"content": [
{
"0": [
@@ -238,97 +359,248 @@
"nf-test": "0.8.4",
"nextflow": "24.04.2"
},
- "timestamp": "2024-06-10T13:03:09.374379128"
+ "timestamp": "2024-07-05T13:50:00.270029"
},
- "test_fastp_paired_end_merged_adapterlist": {
+ "test_fastp_single_end - stub": {
"content": [
- [
- [
- {
- "id": "test",
- "single_end": false
- },
+ {
+ "0": [
[
- "test_1.fastp.fastq.gz:md5,54b726a55e992a869fd3fa778afe1672",
- "test_2.fastp.fastq.gz:md5,29d3b33b869f7b63417b8ff07bb128ba"
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
]
+ ],
+ "1": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "2": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "3": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "4": [
+
+ ],
+ "5": [
+
+ ],
+ "6": [
+ "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02"
+ ],
+ "html": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "json": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "log": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "reads": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ],
+ "reads_fail": [
+
+ ],
+ "reads_merged": [
+
+ ],
+ "versions": [
+ "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02"
]
- ],
- [
- [
- {
- "id": "test",
- "single_end": false
- },
- "test.merged.fastq.gz:md5,c873bb1ab3fa859dcc47306465e749d5"
- ]
- ],
- [
- [
- {
- "id": "test",
- "single_end": false
- },
- "test.fastp.json:md5,5914ca3f21ce162123a824e33e8564f6"
- ]
- ],
- [
- "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02"
- ]
+ }
],
"meta": {
"nf-test": "0.8.4",
"nextflow": "24.04.2"
},
- "timestamp": "2024-06-10T13:04:47.637461379"
+ "timestamp": "2024-07-05T13:49:42.502789"
},
- "test_fastp_single_end_qc_only": {
+ "test_fastp_paired_end_merged_adapterlist - stub": {
"content": [
- [
-
- ],
- [
-
- ],
- [
-
- ],
- [
- [
- {
- "id": "test",
- "single_end": true
- },
- "test.fastp.json:md5,5cc5f01e449309e0e689ed6f51a2294a"
+ {
+ "0": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+ "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ]
+ ],
+ "1": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "2": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "3": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "4": [
+
+ ],
+ "5": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ],
+ "6": [
+ "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02"
+ ],
+ "html": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "json": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "log": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "reads": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+ "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ]
+ ],
+ "reads_fail": [
+
+ ],
+ "reads_merged": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ],
+ "versions": [
+ "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02"
]
- ],
- [
- "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02"
- ]
+ }
],
"meta": {
"nf-test": "0.8.4",
"nextflow": "24.04.2"
},
- "timestamp": "2024-06-10T20:11:50.885505279"
+ "timestamp": "2024-07-05T13:54:53.458252"
},
- "test_fastp_single_end-stub": {
+ "test_fastp_paired_end_merged - stub": {
"content": [
{
"0": [
[
{
"id": "test",
- "single_end": true
+ "single_end": false
},
- "test.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ [
+ "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+ "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
]
],
"1": [
[
{
"id": "test",
- "single_end": true
+ "single_end": false
},
"test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e"
]
@@ -337,7 +609,7 @@
[
{
"id": "test",
- "single_end": true
+ "single_end": false
},
"test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e"
]
@@ -346,7 +618,7 @@
[
{
"id": "test",
- "single_end": true
+ "single_end": false
},
"test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e"
]
@@ -355,7 +627,13 @@
],
"5": [
-
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
],
"6": [
"versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02"
@@ -364,7 +642,7 @@
[
{
"id": "test",
- "single_end": true
+ "single_end": false
},
"test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e"
]
@@ -373,7 +651,7 @@
[
{
"id": "test",
- "single_end": true
+ "single_end": false
},
"test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e"
]
@@ -382,7 +660,7 @@
[
{
"id": "test",
- "single_end": true
+ "single_end": false
},
"test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e"
]
@@ -391,16 +669,25 @@
[
{
"id": "test",
- "single_end": true
+ "single_end": false
},
- "test.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ [
+ "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+ "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
]
],
"reads_fail": [
],
"reads_merged": [
-
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
],
"versions": [
"versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02"
@@ -411,9 +698,9 @@
"nf-test": "0.8.4",
"nextflow": "24.04.2"
},
- "timestamp": "2024-06-10T13:01:55.987280865"
+ "timestamp": "2024-07-05T13:50:27.689379"
},
- "test_fastp_paired_end_trim_fail": {
+ "test_fastp_paired_end_merged": {
"content": [
[
[
@@ -421,10 +708,7 @@
"id": "test",
"single_end": false
},
- [
- "test_1.fastp.fastq.gz:md5,6ff32a64c5188b9a9192be1398c262c7",
- "test_2.fastp.fastq.gz:md5,db0cb7c9977e94ac2b4b446ebd017a8a"
- ]
+ "test.fastp.json:md5,b712fd68ed0322f4bec49ff2a5237fcc"
]
],
[
@@ -434,11 +718,13 @@
"single_end": false
},
[
- "test.paired.fail.fastq.gz:md5,409b687c734cedd7a1fec14d316e1366",
- "test_1.fail.fastq.gz:md5,4f273cf3159c13f79e8ffae12f5661f6",
- "test_2.fail.fastq.gz:md5,f97b9edefb5649aab661fbc9e71fc995"
+ "test_1.fastp.fastq.gz:md5,54b726a55e992a869fd3fa778afe1672",
+ "test_2.fastp.fastq.gz:md5,29d3b33b869f7b63417b8ff07bb128ba"
]
]
+ ],
+ [
+
],
[
[
@@ -446,7 +732,7 @@
"id": "test",
"single_end": false
},
- "test.fastp.json:md5,4c3268ddb50ea5b33125984776aa3519"
+ "test.merged.fastq.gz:md5,c873bb1ab3fa859dcc47306465e749d5"
]
],
[
@@ -457,7 +743,7 @@
"nf-test": "0.8.4",
"nextflow": "24.04.2"
},
- "timestamp": "2024-06-10T13:03:46.458766801"
+ "timestamp": "2024-07-05T13:44:08.68476"
},
"test_fastp_paired_end - stub": {
"content": [
@@ -564,52 +850,19 @@
"nf-test": "0.8.4",
"nextflow": "24.04.2"
},
- "timestamp": "2024-06-08T05:36:36.446112695"
+ "timestamp": "2024-07-05T13:49:51.679221"
},
- "test_fastp_paired_end_merged": {
+ "test_fastp_single_end": {
"content": [
[
[
{
"id": "test",
- "single_end": false
- },
- [
- "test_1.fastp.fastq.gz:md5,54b726a55e992a869fd3fa778afe1672",
- "test_2.fastp.fastq.gz:md5,29d3b33b869f7b63417b8ff07bb128ba"
- ]
- ]
- ],
- [
- [
- {
- "id": "test",
- "single_end": false
- },
- "test.merged.fastq.gz:md5,c873bb1ab3fa859dcc47306465e749d5"
- ]
- ],
- [
- [
- {
- "id": "test",
- "single_end": false
+ "single_end": true
},
- "test.fastp.json:md5,b712fd68ed0322f4bec49ff2a5237fcc"
+ "test.fastp.json:md5,c852d7a6dba5819e4ac8d9673bedcacc"
]
],
- [
- "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02"
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.04.2"
- },
- "timestamp": "2024-06-10T13:04:09.964580373"
- },
- "test_fastp_single_end": {
- "content": [
[
[
{
@@ -620,13 +873,10 @@
]
],
[
- [
- {
- "id": "test",
- "single_end": true
- },
- "test.fastp.json:md5,c852d7a6dba5819e4ac8d9673bedcacc"
- ]
+
+ ],
+ [
+
],
[
"versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02"
@@ -636,28 +886,25 @@
"nf-test": "0.8.4",
"nextflow": "24.04.2"
},
- "timestamp": "2024-06-10T13:01:34.044931225"
+ "timestamp": "2024-07-05T13:43:18.834322"
},
- "test_fastp_paired_end_merged-stub": {
+ "test_fastp_single_end_trim_fail - stub": {
"content": [
{
"0": [
[
{
"id": "test",
- "single_end": false
+ "single_end": true
},
- [
- "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
- "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
- ]
+ "test.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
]
],
"1": [
[
{
"id": "test",
- "single_end": false
+ "single_end": true
},
"test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e"
]
@@ -666,7 +913,7 @@
[
{
"id": "test",
- "single_end": false
+ "single_end": true
},
"test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e"
]
@@ -675,22 +922,22 @@
[
{
"id": "test",
- "single_end": false
+ "single_end": true
},
"test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e"
]
],
"4": [
-
- ],
- "5": [
[
{
"id": "test",
- "single_end": false
+ "single_end": true
},
- "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ "test.fail.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
]
+ ],
+ "5": [
+
],
"6": [
"versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02"
@@ -699,7 +946,7 @@
[
{
"id": "test",
- "single_end": false
+ "single_end": true
},
"test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e"
]
@@ -708,7 +955,7 @@
[
{
"id": "test",
- "single_end": false
+ "single_end": true
},
"test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e"
]
@@ -717,7 +964,7 @@
[
{
"id": "test",
- "single_end": false
+ "single_end": true
},
"test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e"
]
@@ -726,25 +973,22 @@
[
{
"id": "test",
- "single_end": false
+ "single_end": true
},
- [
- "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
- "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
- ]
+ "test.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
]
],
"reads_fail": [
-
- ],
- "reads_merged": [
[
{
"id": "test",
- "single_end": false
+ "single_end": true
},
- "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ "test.fail.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
]
+ ],
+ "reads_merged": [
+
],
"versions": [
"versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02"
@@ -755,16 +999,16 @@
"nf-test": "0.8.4",
"nextflow": "24.04.2"
},
- "timestamp": "2024-06-08T05:39:42.022707162"
+ "timestamp": "2024-07-05T14:05:36.898142"
},
- "test_fastp_single_end_qc_only-stub": {
+ "test_fastp_paired_end_trim_fail - stub": {
"content": [
{
"0": [
[
{
"id": "test",
- "single_end": true
+ "single_end": false
},
[
"test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
@@ -776,7 +1020,7 @@
[
{
"id": "test",
- "single_end": true
+ "single_end": false
},
"test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e"
]
@@ -785,7 +1029,7 @@
[
{
"id": "test",
- "single_end": true
+ "single_end": false
},
"test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e"
]
@@ -794,13 +1038,23 @@
[
{
"id": "test",
- "single_end": true
+ "single_end": false
},
"test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e"
]
],
"4": [
-
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test.paired.fail.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+ "test_1.fail.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+ "test_2.fail.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ]
],
"5": [
@@ -812,7 +1066,7 @@
[
{
"id": "test",
- "single_end": true
+ "single_end": false
},
"test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e"
]
@@ -821,7 +1075,7 @@
[
{
"id": "test",
- "single_end": true
+ "single_end": false
},
"test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e"
]
@@ -830,7 +1084,7 @@
[
{
"id": "test",
- "single_end": true
+ "single_end": false
},
"test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e"
]
@@ -839,7 +1093,7 @@
[
{
"id": "test",
- "single_end": true
+ "single_end": false
},
[
"test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
@@ -848,7 +1102,17 @@
]
],
"reads_fail": [
-
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test.paired.fail.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+ "test_1.fail.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+ "test_2.fail.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ]
],
"reads_merged": [
@@ -862,7 +1126,7 @@
"nf-test": "0.8.4",
"nextflow": "24.04.2"
},
- "timestamp": "2024-06-10T13:05:31.722431847"
+ "timestamp": "2024-07-05T14:05:49.212847"
},
"fastp test_fastp_interleaved": {
"content": [
@@ -892,7 +1156,7 @@
"nf-test": "0.8.4",
"nextflow": "24.04.2"
},
- "timestamp": "2024-06-07T22:35:04.608948751"
+ "timestamp": "2024-07-05T13:43:38.910832"
},
"test_fastp_single_end_trim_fail": {
"content": [
@@ -902,7 +1166,7 @@
"id": "test",
"single_end": true
},
- "test.fastp.fastq.gz:md5,67b2bbae47f073e05a97a9c2edce23c7"
+ "test.fastp.json:md5,9a7ee180f000e8d00c7fb67f06293eb5"
]
],
[
@@ -911,7 +1175,7 @@
"id": "test",
"single_end": true
},
- "test.fail.fastq.gz:md5,3e4aaadb66a5b8fc9b881bf39c227abd"
+ "test.fastp.fastq.gz:md5,67b2bbae47f073e05a97a9c2edce23c7"
]
],
[
@@ -920,8 +1184,11 @@
"id": "test",
"single_end": true
},
- "test.fastp.json:md5,9a7ee180f000e8d00c7fb67f06293eb5"
+ "test.fail.fastq.gz:md5,3e4aaadb66a5b8fc9b881bf39c227abd"
]
+ ],
+ [
+
],
[
"versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02"
@@ -931,10 +1198,19 @@
"nf-test": "0.8.4",
"nextflow": "24.04.2"
},
- "timestamp": "2024-06-10T13:03:23.130471376"
+ "timestamp": "2024-07-05T13:43:48.22378"
},
"test_fastp_paired_end_qc_only": {
"content": [
+ [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.json:md5,623064a45912dac6f2b64e3f2e9901df"
+ ]
+ ],
[
],
@@ -945,13 +1221,13 @@
],
[
- [
- {
- "id": "test",
- "single_end": false
- },
- "test.fastp.json:md5,623064a45912dac6f2b64e3f2e9901df"
- ]
+
+ ],
+ [
+
+ ],
+ [
+
],
[
"versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02"
@@ -961,6 +1237,95 @@
"nf-test": "0.8.4",
"nextflow": "24.04.2"
},
- "timestamp": "2024-06-10T20:12:14.00927619"
+ "timestamp": "2024-07-05T13:44:36.334938"
+ },
+ "test_fastp_paired_end_qc_only - stub": {
+ "content": [
+ {
+ "0": [
+
+ ],
+ "1": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "2": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "3": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "4": [
+
+ ],
+ "5": [
+
+ ],
+ "6": [
+ "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02"
+ ],
+ "html": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "json": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "log": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "reads": [
+
+ ],
+ "reads_fail": [
+
+ ],
+ "reads_merged": [
+
+ ],
+ "versions": [
+ "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02"
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.8.4",
+ "nextflow": "24.04.2"
+ },
+ "timestamp": "2024-07-05T14:31:27.096468"
}
}
\ No newline at end of file
diff --git a/modules/nf-core/fastqc/tests/main.nf.test b/modules/nf-core/fastqc/tests/main.nf.test
index c69808d8c..a67f92777 100644
--- a/modules/nf-core/fastqc/tests/main.nf.test
+++ b/modules/nf-core/fastqc/tests/main.nf.test
@@ -19,17 +19,14 @@ nextflow_process {
then {
assertAll (
- { assert process.success },
-
- // NOTE The report contains the date inside it, which means that the md5sum is stable per day, but not longer than that. So you can't md5sum it.
- // looks like this:
- // https://github.com/nf-core/modules/pull/3903#issuecomment-1743620039
-
- { assert process.out.html[0][1] ==~ ".*/test_fastqc.html" },
- { assert process.out.zip[0][1] ==~ ".*/test_fastqc.zip" },
- { assert path(process.out.html[0][1]).text.contains("
File type | Conventional base calls |
") },
-
- { assert snapshot(process.out.versions).match("fastqc_versions_single") }
+ { assert process.success },
+ // NOTE The report contains the date inside it, which means that the md5sum is stable per day, but not longer than that. So you can't md5sum it.
+ // looks like this:
+ // https://github.com/nf-core/modules/pull/3903#issuecomment-1743620039
+ { assert process.out.html[0][1] ==~ ".*/test_fastqc.html" },
+ { assert process.out.zip[0][1] ==~ ".*/test_fastqc.zip" },
+ { assert path(process.out.html[0][1]).text.contains("File type | Conventional base calls |
") },
+ { assert snapshot(process.out.versions).match() }
)
}
}
@@ -50,16 +47,14 @@ nextflow_process {
then {
assertAll (
- { assert process.success },
-
- { assert process.out.html[0][1][0] ==~ ".*/test_1_fastqc.html" },
- { assert process.out.html[0][1][1] ==~ ".*/test_2_fastqc.html" },
- { assert process.out.zip[0][1][0] ==~ ".*/test_1_fastqc.zip" },
- { assert process.out.zip[0][1][1] ==~ ".*/test_2_fastqc.zip" },
- { assert path(process.out.html[0][1][0]).text.contains("File type | Conventional base calls |
") },
- { assert path(process.out.html[0][1][1]).text.contains("File type | Conventional base calls |
") },
-
- { assert snapshot(process.out.versions).match("fastqc_versions_paired") }
+ { assert process.success },
+ { assert process.out.html[0][1][0] ==~ ".*/test_1_fastqc.html" },
+ { assert process.out.html[0][1][1] ==~ ".*/test_2_fastqc.html" },
+ { assert process.out.zip[0][1][0] ==~ ".*/test_1_fastqc.zip" },
+ { assert process.out.zip[0][1][1] ==~ ".*/test_2_fastqc.zip" },
+ { assert path(process.out.html[0][1][0]).text.contains("File type | Conventional base calls |
") },
+ { assert path(process.out.html[0][1][1]).text.contains("File type | Conventional base calls |
") },
+ { assert snapshot(process.out.versions).match() }
)
}
}
@@ -79,13 +74,11 @@ nextflow_process {
then {
assertAll (
- { assert process.success },
-
- { assert process.out.html[0][1] ==~ ".*/test_fastqc.html" },
- { assert process.out.zip[0][1] ==~ ".*/test_fastqc.zip" },
- { assert path(process.out.html[0][1]).text.contains("File type | Conventional base calls |
") },
-
- { assert snapshot(process.out.versions).match("fastqc_versions_interleaved") }
+ { assert process.success },
+ { assert process.out.html[0][1] ==~ ".*/test_fastqc.html" },
+ { assert process.out.zip[0][1] ==~ ".*/test_fastqc.zip" },
+ { assert path(process.out.html[0][1]).text.contains("File type | Conventional base calls |
") },
+ { assert snapshot(process.out.versions).match() }
)
}
}
@@ -105,13 +98,11 @@ nextflow_process {
then {
assertAll (
- { assert process.success },
-
- { assert process.out.html[0][1] ==~ ".*/test_fastqc.html" },
- { assert process.out.zip[0][1] ==~ ".*/test_fastqc.zip" },
- { assert path(process.out.html[0][1]).text.contains("File type | Conventional base calls |
") },
-
- { assert snapshot(process.out.versions).match("fastqc_versions_bam") }
+ { assert process.success },
+ { assert process.out.html[0][1] ==~ ".*/test_fastqc.html" },
+ { assert process.out.zip[0][1] ==~ ".*/test_fastqc.zip" },
+ { assert path(process.out.html[0][1]).text.contains("File type | Conventional base calls |
") },
+ { assert snapshot(process.out.versions).match() }
)
}
}
@@ -134,22 +125,20 @@ nextflow_process {
then {
assertAll (
- { assert process.success },
-
- { assert process.out.html[0][1][0] ==~ ".*/test_1_fastqc.html" },
- { assert process.out.html[0][1][1] ==~ ".*/test_2_fastqc.html" },
- { assert process.out.html[0][1][2] ==~ ".*/test_3_fastqc.html" },
- { assert process.out.html[0][1][3] ==~ ".*/test_4_fastqc.html" },
- { assert process.out.zip[0][1][0] ==~ ".*/test_1_fastqc.zip" },
- { assert process.out.zip[0][1][1] ==~ ".*/test_2_fastqc.zip" },
- { assert process.out.zip[0][1][2] ==~ ".*/test_3_fastqc.zip" },
- { assert process.out.zip[0][1][3] ==~ ".*/test_4_fastqc.zip" },
- { assert path(process.out.html[0][1][0]).text.contains("File type | Conventional base calls |
") },
- { assert path(process.out.html[0][1][1]).text.contains("File type | Conventional base calls |
") },
- { assert path(process.out.html[0][1][2]).text.contains("File type | Conventional base calls |
") },
- { assert path(process.out.html[0][1][3]).text.contains("File type | Conventional base calls |
") },
-
- { assert snapshot(process.out.versions).match("fastqc_versions_multiple") }
+ { assert process.success },
+ { assert process.out.html[0][1][0] ==~ ".*/test_1_fastqc.html" },
+ { assert process.out.html[0][1][1] ==~ ".*/test_2_fastqc.html" },
+ { assert process.out.html[0][1][2] ==~ ".*/test_3_fastqc.html" },
+ { assert process.out.html[0][1][3] ==~ ".*/test_4_fastqc.html" },
+ { assert process.out.zip[0][1][0] ==~ ".*/test_1_fastqc.zip" },
+ { assert process.out.zip[0][1][1] ==~ ".*/test_2_fastqc.zip" },
+ { assert process.out.zip[0][1][2] ==~ ".*/test_3_fastqc.zip" },
+ { assert process.out.zip[0][1][3] ==~ ".*/test_4_fastqc.zip" },
+ { assert path(process.out.html[0][1][0]).text.contains("File type | Conventional base calls |
") },
+ { assert path(process.out.html[0][1][1]).text.contains("File type | Conventional base calls |
") },
+ { assert path(process.out.html[0][1][2]).text.contains("File type | Conventional base calls |
") },
+ { assert path(process.out.html[0][1][3]).text.contains("File type | Conventional base calls |
") },
+ { assert snapshot(process.out.versions).match() }
)
}
}
@@ -169,21 +158,18 @@ nextflow_process {
then {
assertAll (
- { assert process.success },
-
- { assert process.out.html[0][1] ==~ ".*/mysample_fastqc.html" },
- { assert process.out.zip[0][1] ==~ ".*/mysample_fastqc.zip" },
- { assert path(process.out.html[0][1]).text.contains("File type | Conventional base calls |
") },
-
- { assert snapshot(process.out.versions).match("fastqc_versions_custom_prefix") }
+ { assert process.success },
+ { assert process.out.html[0][1] ==~ ".*/mysample_fastqc.html" },
+ { assert process.out.zip[0][1] ==~ ".*/mysample_fastqc.zip" },
+ { assert path(process.out.html[0][1]).text.contains("File type | Conventional base calls |
") },
+ { assert snapshot(process.out.versions).match() }
)
}
}
test("sarscov2 single-end [fastq] - stub") {
- options "-stub"
-
+ options "-stub"
when {
process {
"""
@@ -197,12 +183,123 @@ nextflow_process {
then {
assertAll (
- { assert process.success },
- { assert snapshot(process.out.html.collect { file(it[1]).getName() } +
- process.out.zip.collect { file(it[1]).getName() } +
- process.out.versions ).match("fastqc_stub") }
+ { assert process.success },
+ { assert snapshot(process.out).match() }
)
}
}
+ test("sarscov2 paired-end [fastq] - stub") {
+
+ options "-stub"
+ when {
+ process {
+ """
+ input[0] = Channel.of([
+ [id: 'test', single_end: false], // meta map
+ [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ]
+ ])
+ """
+ }
+ }
+
+ then {
+ assertAll (
+ { assert process.success },
+ { assert snapshot(process.out).match() }
+ )
+ }
+ }
+
+ test("sarscov2 interleaved [fastq] - stub") {
+
+ options "-stub"
+ when {
+ process {
+ """
+ input[0] = Channel.of([
+ [id: 'test', single_end: false], // meta map
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_interleaved.fastq.gz', checkIfExists: true)
+ ])
+ """
+ }
+ }
+
+ then {
+ assertAll (
+ { assert process.success },
+ { assert snapshot(process.out).match() }
+ )
+ }
+ }
+
+ test("sarscov2 paired-end [bam] - stub") {
+
+ options "-stub"
+ when {
+ process {
+ """
+ input[0] = Channel.of([
+ [id: 'test', single_end: false], // meta map
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true)
+ ])
+ """
+ }
+ }
+
+ then {
+ assertAll (
+ { assert process.success },
+ { assert snapshot(process.out).match() }
+ )
+ }
+ }
+
+ test("sarscov2 multiple [fastq] - stub") {
+
+ options "-stub"
+ when {
+ process {
+ """
+ input[0] = Channel.of([
+ [id: 'test', single_end: false], // meta map
+ [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test2_1.fastq.gz', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test2_2.fastq.gz', checkIfExists: true) ]
+ ])
+ """
+ }
+ }
+
+ then {
+ assertAll (
+ { assert process.success },
+ { assert snapshot(process.out).match() }
+ )
+ }
+ }
+
+ test("sarscov2 custom_prefix - stub") {
+
+ options "-stub"
+ when {
+ process {
+ """
+ input[0] = Channel.of([
+ [ id:'mysample', single_end:true ], // meta map
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true)
+ ])
+ """
+ }
+ }
+
+ then {
+ assertAll (
+ { assert process.success },
+ { assert snapshot(process.out).match() }
+ )
+ }
+ }
}
diff --git a/modules/nf-core/fastqc/tests/main.nf.test.snap b/modules/nf-core/fastqc/tests/main.nf.test.snap
index 86f7c3115..d5db3092f 100644
--- a/modules/nf-core/fastqc/tests/main.nf.test.snap
+++ b/modules/nf-core/fastqc/tests/main.nf.test.snap
@@ -1,88 +1,392 @@
{
- "fastqc_versions_interleaved": {
+ "sarscov2 custom_prefix": {
"content": [
[
"versions.yml:md5,e1cc25ca8af856014824abd842e93978"
]
],
"meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.10.1"
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
},
- "timestamp": "2024-01-31T17:40:07.293713"
+ "timestamp": "2024-07-22T11:02:16.374038"
},
- "fastqc_stub": {
+ "sarscov2 single-end [fastq] - stub": {
"content": [
- [
- "test.html",
- "test.zip",
- "versions.yml:md5,e1cc25ca8af856014824abd842e93978"
- ]
+ {
+ "0": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "1": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "2": [
+ "versions.yml:md5,e1cc25ca8af856014824abd842e93978"
+ ],
+ "html": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "versions": [
+ "versions.yml:md5,e1cc25ca8af856014824abd842e93978"
+ ],
+ "zip": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
+ },
+ "timestamp": "2024-07-22T11:02:24.993809"
+ },
+ "sarscov2 custom_prefix - stub": {
+ "content": [
+ {
+ "0": [
+ [
+ {
+ "id": "mysample",
+ "single_end": true
+ },
+ "mysample.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "1": [
+ [
+ {
+ "id": "mysample",
+ "single_end": true
+ },
+ "mysample.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "2": [
+ "versions.yml:md5,e1cc25ca8af856014824abd842e93978"
+ ],
+ "html": [
+ [
+ {
+ "id": "mysample",
+ "single_end": true
+ },
+ "mysample.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "versions": [
+ "versions.yml:md5,e1cc25ca8af856014824abd842e93978"
+ ],
+ "zip": [
+ [
+ {
+ "id": "mysample",
+ "single_end": true
+ },
+ "mysample.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ }
],
"meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.10.1"
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
},
- "timestamp": "2024-01-31T17:31:01.425198"
+ "timestamp": "2024-07-22T11:03:10.93942"
},
- "fastqc_versions_multiple": {
+ "sarscov2 interleaved [fastq]": {
"content": [
[
"versions.yml:md5,e1cc25ca8af856014824abd842e93978"
]
],
"meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.10.1"
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
},
- "timestamp": "2024-01-31T17:40:55.797907"
+ "timestamp": "2024-07-22T11:01:42.355718"
},
- "fastqc_versions_bam": {
+ "sarscov2 paired-end [bam]": {
"content": [
[
"versions.yml:md5,e1cc25ca8af856014824abd842e93978"
]
],
"meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.10.1"
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
},
- "timestamp": "2024-01-31T17:40:26.795862"
+ "timestamp": "2024-07-22T11:01:53.276274"
},
- "fastqc_versions_single": {
+ "sarscov2 multiple [fastq]": {
"content": [
[
"versions.yml:md5,e1cc25ca8af856014824abd842e93978"
]
],
"meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.10.1"
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
},
- "timestamp": "2024-01-31T17:39:27.043675"
+ "timestamp": "2024-07-22T11:02:05.527626"
},
- "fastqc_versions_paired": {
+ "sarscov2 paired-end [fastq]": {
"content": [
[
"versions.yml:md5,e1cc25ca8af856014824abd842e93978"
]
],
"meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.10.1"
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
+ },
+ "timestamp": "2024-07-22T11:01:31.188871"
+ },
+ "sarscov2 paired-end [fastq] - stub": {
+ "content": [
+ {
+ "0": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "1": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "2": [
+ "versions.yml:md5,e1cc25ca8af856014824abd842e93978"
+ ],
+ "html": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "versions": [
+ "versions.yml:md5,e1cc25ca8af856014824abd842e93978"
+ ],
+ "zip": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
+ },
+ "timestamp": "2024-07-22T11:02:34.273566"
+ },
+ "sarscov2 multiple [fastq] - stub": {
+ "content": [
+ {
+ "0": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "1": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "2": [
+ "versions.yml:md5,e1cc25ca8af856014824abd842e93978"
+ ],
+ "html": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "versions": [
+ "versions.yml:md5,e1cc25ca8af856014824abd842e93978"
+ ],
+ "zip": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
},
- "timestamp": "2024-01-31T17:39:47.584191"
+ "timestamp": "2024-07-22T11:03:02.304411"
},
- "fastqc_versions_custom_prefix": {
+ "sarscov2 single-end [fastq]": {
"content": [
[
"versions.yml:md5,e1cc25ca8af856014824abd842e93978"
]
],
"meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.10.1"
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
+ },
+ "timestamp": "2024-07-22T11:01:19.095607"
+ },
+ "sarscov2 interleaved [fastq] - stub": {
+ "content": [
+ {
+ "0": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "1": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "2": [
+ "versions.yml:md5,e1cc25ca8af856014824abd842e93978"
+ ],
+ "html": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "versions": [
+ "versions.yml:md5,e1cc25ca8af856014824abd842e93978"
+ ],
+ "zip": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
+ },
+ "timestamp": "2024-07-22T11:02:44.640184"
+ },
+ "sarscov2 paired-end [bam] - stub": {
+ "content": [
+ {
+ "0": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "1": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "2": [
+ "versions.yml:md5,e1cc25ca8af856014824abd842e93978"
+ ],
+ "html": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "versions": [
+ "versions.yml:md5,e1cc25ca8af856014824abd842e93978"
+ ],
+ "zip": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
},
- "timestamp": "2024-01-31T17:41:14.576531"
+ "timestamp": "2024-07-22T11:02:53.550742"
}
}
\ No newline at end of file
diff --git a/modules/nf-core/gunzip/environment.yml b/modules/nf-core/gunzip/environment.yml
index 25910b340..dfc02a7b5 100644
--- a/modules/nf-core/gunzip/environment.yml
+++ b/modules/nf-core/gunzip/environment.yml
@@ -4,4 +4,6 @@ channels:
- bioconda
- defaults
dependencies:
- - conda-forge::sed=4.7
+ - conda-forge::grep=3.11
+ - conda-forge::sed=4.8
+ - conda-forge::tar=1.34
diff --git a/modules/nf-core/gunzip/main.nf b/modules/nf-core/gunzip/main.nf
index 4ae609fb1..5e67e3b9b 100644
--- a/modules/nf-core/gunzip/main.nf
+++ b/modules/nf-core/gunzip/main.nf
@@ -4,8 +4,8 @@ process GUNZIP {
conda "${moduleDir}/environment.yml"
container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
- 'https://depot.galaxyproject.org/singularity/ubuntu:20.04' :
- 'nf-core/ubuntu:20.04' }"
+ 'https://depot.galaxyproject.org/singularity/ubuntu:22.04' :
+ 'nf-core/ubuntu:22.04' }"
input:
tuple val(meta), path(archive)
diff --git a/modules/nf-core/kallisto/index/main.nf b/modules/nf-core/kallisto/index/main.nf
index 28a47dbeb..bbd226c93 100644
--- a/modules/nf-core/kallisto/index/main.nf
+++ b/modules/nf-core/kallisto/index/main.nf
@@ -34,7 +34,7 @@ process KALLISTO_INDEX {
stub:
"""
- touch kallisto
+ mkdir kallisto
cat <<-END_VERSIONS > versions.yml
"${task.process}":
diff --git a/modules/nf-core/kallisto/index/tests/main.nf.test b/modules/nf-core/kallisto/index/tests/main.nf.test
index 7999daf41..c5e86e87c 100644
--- a/modules/nf-core/kallisto/index/tests/main.nf.test
+++ b/modules/nf-core/kallisto/index/tests/main.nf.test
@@ -24,4 +24,27 @@ nextflow_process {
)
}
}
+
+ test("sarscov2 transcriptome.fasta - stub") {
+
+ options "-stub"
+
+ when {
+ process {
+ """
+ input[0] = Channel.of([
+ [ id:'transcriptome' ], // meta map
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/transcriptome.fasta', checkIfExists: true)
+ ])
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert process.success },
+ { assert snapshot(process.out).match() }
+ )
+ }
+ }
}
diff --git a/modules/nf-core/kallisto/index/tests/main.nf.test.snap b/modules/nf-core/kallisto/index/tests/main.nf.test.snap
index 054f36e21..b2891a4a3 100644
--- a/modules/nf-core/kallisto/index/tests/main.nf.test.snap
+++ b/modules/nf-core/kallisto/index/tests/main.nf.test.snap
@@ -1,4 +1,41 @@
{
+ "sarscov2 transcriptome.fasta - stub": {
+ "content": [
+ {
+ "0": [
+ [
+ {
+ "id": "transcriptome"
+ },
+ [
+
+ ]
+ ]
+ ],
+ "1": [
+ "versions.yml:md5,178f9b57d4228edc356911d571b958a4"
+ ],
+ "index": [
+ [
+ {
+ "id": "transcriptome"
+ },
+ [
+
+ ]
+ ]
+ ],
+ "versions": [
+ "versions.yml:md5,178f9b57d4228edc356911d571b958a4"
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.8.4",
+ "nextflow": "24.04.2"
+ },
+ "timestamp": "2024-07-03T15:27:54.464205"
+ },
"sarscov2 transcriptome.fasta": {
"content": [
{
@@ -26,6 +63,10 @@
]
}
],
+ "meta": {
+ "nf-test": "0.8.4",
+ "nextflow": "24.04.2"
+ },
"timestamp": "2024-01-19T09:17:56.733532"
}
-}
+}
\ No newline at end of file
diff --git a/modules/nf-core/kallisto/quant/main.nf b/modules/nf-core/kallisto/quant/main.nf
index f5444d791..acfc8c9c7 100644
--- a/modules/nf-core/kallisto/quant/main.nf
+++ b/modules/nf-core/kallisto/quant/main.nf
@@ -69,7 +69,13 @@ process KALLISTO_QUANT {
"""
stub:
+ prefix = task.ext.prefix ?: "${meta.id}"
+
"""
+ mkdir -p $prefix
+ touch ${prefix}.log
+ touch ${prefix}.run_info.json
+
cat <<-END_VERSIONS > versions.yml
"${task.process}":
kallisto: \$(echo \$(kallisto version) | sed "s/kallisto, version //g" )
diff --git a/modules/nf-core/kallisto/quant/tests/main.nf.test b/modules/nf-core/kallisto/quant/tests/main.nf.test
index cb7e480a1..ec6e3d60c 100644
--- a/modules/nf-core/kallisto/quant/tests/main.nf.test
+++ b/modules/nf-core/kallisto/quant/tests/main.nf.test
@@ -16,14 +16,22 @@ nextflow_process {
"""
}
}
+
+ run("KALLISTO_INDEX", alias: "KALLISTO_INDEX_STUB") {
+ script "../../index/main.nf"
+ process {
+ """
+ input[0] = Channel.of([
+ [ id:'transcriptome' ], // meta map
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/transcriptome.fasta', checkIfExists: true)
+ ])
+ """
+ }
+ }
}
test("sarscov2 single-end") {
when {
- params{
- outdir = "$outputDir"
- }
-
process {
"""
gtf = []
@@ -47,19 +55,85 @@ nextflow_process {
then {
assertAll(
{ assert process.success },
- { assert snapshot(path("${process.out.results[0][1]}/abundance.tsv")).match("se_abundance_tsv") },
- { assert snapshot(process.out.log).match("se_log") },
- { assert snapshot(process.out.versions).match("se_versions") }
+ { assert snapshot(
+ path("${process.out.results[0][1]}/abundance.tsv"),
+ process.out.log,
+ process.out.versions).match() }
)
}
}
test("sarscov2 paired-end") {
when {
- params{
- outdir = "$outputDir"
+ process {
+ """
+ gtf = []
+ chromosomes = []
+ fragment_length = []
+ fragment_length_sd = []
+
+ input[0] = Channel.of([
+ [ id:'test', single_end:false ], // meta map
+ [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ]
+ ])
+ input[1] = KALLISTO_INDEX.out.index
+ input[2] = gtf
+ input[3] = chromosomes
+ input[4] = fragment_length
+ input[5] = fragment_length_sd
+ """
}
+ }
+ then {
+ assertAll(
+ { assert process.success },
+ { assert snapshot(
+ path("${process.out.results[0][1]}/abundance.tsv"),
+ process.out.log,
+ process.out.versions).match() }
+ )
+ }
+ }
+
+ test("sarscov2 single-end - stub") {
+ options "-stub"
+
+ when {
+ process {
+ """
+ gtf = []
+ chromosomes = []
+ fragment_length = 150
+ fragment_length_sd = 75
+
+ input[0] = Channel.of([
+ [ id:'test', single_end:true ],
+ [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ]
+ ])
+ input[1] = KALLISTO_INDEX_STUB.out.index
+ input[2] = gtf
+ input[3] = chromosomes
+ input[4] = fragment_length
+ input[5] = fragment_length_sd
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert process.success },
+ { assert snapshot(process.out).match() }
+ )
+ }
+ }
+
+ test("sarscov2 paired-end - stub") {
+
+ options "-stub"
+
+ when {
process {
"""
gtf = []
@@ -72,7 +146,7 @@ nextflow_process {
[ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ]
])
- input[1] = KALLISTO_INDEX.out.index
+ input[1] = KALLISTO_INDEX_STUB.out.index
input[2] = gtf
input[3] = chromosomes
input[4] = fragment_length
@@ -83,9 +157,7 @@ nextflow_process {
then {
assertAll(
{ assert process.success },
- { assert snapshot(path("${process.out.results[0][1]}/abundance.tsv")).match("pe_abundance_tsv") },
- { assert snapshot(process.out.log).match("pe_log") },
- { assert snapshot(process.out.versions).match("pe_versions") }
+ { assert snapshot(process.out).match() }
)
}
}
diff --git a/modules/nf-core/kallisto/quant/tests/main.nf.test.snap b/modules/nf-core/kallisto/quant/tests/main.nf.test.snap
index f957e6c8b..cf0d73304 100644
--- a/modules/nf-core/kallisto/quant/tests/main.nf.test.snap
+++ b/modules/nf-core/kallisto/quant/tests/main.nf.test.snap
@@ -1,6 +1,7 @@
{
- "pe_log": {
+ "sarscov2 paired-end": {
"content": [
+ "abundance.tsv:md5,f0a9a2543f8fc0c8442be0a939d70f66",
[
[
{
@@ -9,32 +10,170 @@
},
"test.log:md5,8a5987f8e779cd12ca708e2212f771f5"
]
- ]
- ],
- "timestamp": "2024-01-19T09:31:05.549084"
- },
- "se_versions": {
- "content": [
+ ],
[
"versions.yml:md5,f981ad0cc089194a8fb00a47948eea94"
]
],
- "timestamp": "2024-01-19T09:30:00.138848"
+ "meta": {
+ "nf-test": "0.8.4",
+ "nextflow": "24.04.2"
+ },
+ "timestamp": "2024-07-03T15:25:27.043048"
},
- "se_abundance_tsv": {
+ "sarscov2 paired-end - stub": {
"content": [
- "abundance.tsv:md5,8a4afe91e6a75b4e619daaf664eb7d9b"
+ {
+ "0": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+
+ ]
+ ]
+ ],
+ "1": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.run_info.json:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "2": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "3": [
+ "versions.yml:md5,f981ad0cc089194a8fb00a47948eea94"
+ ],
+ "json_info": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.run_info.json:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "log": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "results": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+
+ ]
+ ]
+ ],
+ "versions": [
+ "versions.yml:md5,f981ad0cc089194a8fb00a47948eea94"
+ ]
+ }
],
- "timestamp": "2024-01-19T09:30:00.127992"
+ "meta": {
+ "nf-test": "0.8.4",
+ "nextflow": "24.04.2"
+ },
+ "timestamp": "2024-07-03T15:26:04.484652"
},
- "pe_abundance_tsv": {
+ "sarscov2 single-end - stub": {
"content": [
- "abundance.tsv:md5,f0a9a2543f8fc0c8442be0a939d70f66"
+ {
+ "0": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ [
+
+ ]
+ ]
+ ],
+ "1": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.run_info.json:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "2": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "3": [
+ "versions.yml:md5,f981ad0cc089194a8fb00a47948eea94"
+ ],
+ "json_info": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.run_info.json:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "log": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "results": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ [
+
+ ]
+ ]
+ ],
+ "versions": [
+ "versions.yml:md5,f981ad0cc089194a8fb00a47948eea94"
+ ]
+ }
],
- "timestamp": "2024-01-19T09:31:05.544756"
+ "meta": {
+ "nf-test": "0.8.4",
+ "nextflow": "24.04.2"
+ },
+ "timestamp": "2024-07-03T15:25:46.479136"
},
- "se_log": {
+ "sarscov2 single-end": {
"content": [
+ "abundance.tsv:md5,8a4afe91e6a75b4e619daaf664eb7d9b",
[
[
{
@@ -43,16 +182,15 @@
},
"test.log:md5,9c166f0c50cd4fdbdbf1bff9d5d8aba2"
]
- ]
- ],
- "timestamp": "2024-01-19T09:30:00.135036"
- },
- "pe_versions": {
- "content": [
+ ],
[
"versions.yml:md5,f981ad0cc089194a8fb00a47948eea94"
]
],
- "timestamp": "2024-01-19T09:31:05.553993"
+ "meta": {
+ "nf-test": "0.8.4",
+ "nextflow": "24.04.2"
+ },
+ "timestamp": "2024-07-03T15:25:08.348876"
}
}
\ No newline at end of file
diff --git a/modules/nf-core/multiqc/tests/tags.yml b/modules/nf-core/multiqc/tests/tags.yml
deleted file mode 100644
index bea6c0d37..000000000
--- a/modules/nf-core/multiqc/tests/tags.yml
+++ /dev/null
@@ -1,2 +0,0 @@
-multiqc:
- - modules/nf-core/multiqc/**
diff --git a/modules/nf-core/picard/markduplicates/picard-markduplicates.diff b/modules/nf-core/picard/markduplicates/picard-markduplicates.diff
new file mode 100644
index 000000000..bf684640d
--- /dev/null
+++ b/modules/nf-core/picard/markduplicates/picard-markduplicates.diff
@@ -0,0 +1,25 @@
+Changes in module 'nf-core/picard/markduplicates'
+--- modules/nf-core/picard/markduplicates/main.nf
++++ modules/nf-core/picard/markduplicates/main.nf
+@@ -4,8 +4,8 @@
+
+ conda "${moduleDir}/environment.yml"
+ container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
+- 'https://depot.galaxyproject.org/singularity/picard:3.2.0--hdfd78af_0' :
+- 'biocontainers/picard:3.2.0--hdfd78af_0' }"
++ 'https://depot.galaxyproject.org/singularity/picard:3.1.1--hdfd78af_0' :
++ 'biocontainers/picard:3.1.1--hdfd78af_0' }"
+
+ input:
+ tuple val(meta), path(reads)
+
+--- modules/nf-core/picard/markduplicates/environment.yml
++++ modules/nf-core/picard/markduplicates/environment.yml
+@@ -4,4 +4,4 @@
+ - bioconda
+ - defaults
+ dependencies:
+- - bioconda::picard=3.2.0
++ - bioconda::picard=3.1.1
+
+************************************************************
diff --git a/modules/nf-core/picard/markduplicates/tests/main.nf.test b/modules/nf-core/picard/markduplicates/tests/main.nf.test
index 04eff3581..1abea33e3 100644
--- a/modules/nf-core/picard/markduplicates/tests/main.nf.test
+++ b/modules/nf-core/picard/markduplicates/tests/main.nf.test
@@ -23,9 +23,11 @@ nextflow_process {
then {
assertAll(
{ assert process.success },
- { assert snapshot(file(process.out.bam[0][1]).name).match("unsorted_bam_name") },
- { assert snapshot(path(process.out.metrics.get(0).get(1)).readLines()[0..2]).match("unsorted_bam_metrics") },
- { assert snapshot(process.out.versions).match("unsorted_bam_versions") }
+ { assert snapshot(
+ file(process.out.bam[0][1]).name,
+ path(process.out.metrics.get(0).get(1)).readLines()[0..2],
+ process.out.versions)
+ .match() }
)
}
}
@@ -48,9 +50,11 @@ nextflow_process {
then {
assertAll(
{ assert process.success },
- { assert snapshot(file(process.out.bam[0][1]).name).match("sorted_bam_name") },
- { assert snapshot(path(process.out.metrics.get(0).get(1)).readLines()[0..2]).match("sorted_bam_metrics") },
- { assert snapshot(process.out.versions).match("sorted_bam_versions") }
+ { assert snapshot(
+ file(process.out.bam[0][1]).name,
+ path(process.out.metrics.get(0).get(1)).readLines()[0..2],
+ process.out.versions)
+ .match() }
)
}
}
@@ -79,9 +83,86 @@ nextflow_process {
then {
assertAll(
{ assert process.success },
- { assert snapshot(file(process.out.cram[0][1]).name).match("cram_name") },
- { assert snapshot(path(process.out.metrics.get(0).get(1)).readLines()[0..2]).match("cram_metrics") },
- { assert snapshot(process.out.versions).match("cram_versions") }
+ { assert snapshot(
+ file(process.out.cram[0][1]).name,
+ path(process.out.metrics.get(0).get(1)).readLines()[0..2],
+ process.out.versions)
+ .match() }
+ )
+ }
+ }
+
+ test("sarscov2 [unsorted bam] - stub") {
+ options "-stub"
+ when {
+ process {
+ """
+ input[0] = Channel.of([
+ [ id:'test', single_end:false ], // meta map
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.bam', checkIfExists: true)
+ ])
+ input[1] = [ [:], [] ]
+ input[2] = [ [:], [] ]
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert process.success },
+ { assert snapshot(process.out).match() }
+ )
+ }
+ }
+
+ test("sarscov2 [sorted bam] - stub") {
+ options "-stub"
+ when {
+ process {
+ """
+ input[0] = Channel.of([
+ [ id:'test', single_end:false ], // meta map
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true)
+ ])
+ input[1] = [ [:], [] ]
+ input[2] = [ [:], [] ]
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert process.success },
+ { assert snapshot(process.out).match() }
+ )
+ }
+ }
+
+ test("homo_sapiens [cram] - stub") {
+ options "-stub"
+ when {
+ process {
+ """
+ input[0] = Channel.of([
+ [ id:'test', single_end:false ], // meta map
+ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram', checkIfExists: true)
+ ])
+ input[1] = Channel.of([
+ [ id:'genome' ],
+ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)
+ ])
+ input[2] = Channel.of([
+ [ id:'genome' ],
+ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true)
+ ])
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert process.success },
+ { assert snapshot(process.out).match() }
)
}
}
diff --git a/modules/nf-core/picard/markduplicates/tests/main.nf.test.snap b/modules/nf-core/picard/markduplicates/tests/main.nf.test.snap
index eb17111e4..1a6598aa9 100644
--- a/modules/nf-core/picard/markduplicates/tests/main.nf.test.snap
+++ b/modules/nf-core/picard/markduplicates/tests/main.nf.test.snap
@@ -1,110 +1,251 @@
{
- "sorted_bam_versions": {
+ "sarscov2 [sorted bam] - stub": {
"content": [
- [
- "versions.yml:md5,b699af51b1956f3810f8a7c066e0ab17"
- ]
+ {
+ "0": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.marked.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "1": [
+
+ ],
+ "2": [
+
+ ],
+ "3": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.marked.MarkDuplicates.metrics.txt:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "4": [
+ "versions.yml:md5,b699af51b1956f3810f8a7c066e0ab17"
+ ],
+ "bai": [
+
+ ],
+ "bam": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.marked.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "cram": [
+
+ ],
+ "metrics": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.marked.MarkDuplicates.metrics.txt:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "versions": [
+ "versions.yml:md5,b699af51b1956f3810f8a7c066e0ab17"
+ ]
+ }
],
"meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.10.1"
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
},
- "timestamp": "2024-03-20T15:31:50.928021"
+ "timestamp": "2024-07-22T19:34:20.663558"
},
- "unsorted_bam_name": {
+ "sarscov2 [unsorted bam] - stub": {
"content": [
- "test.marked.bam"
+ {
+ "0": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.marked.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "1": [
+
+ ],
+ "2": [
+
+ ],
+ "3": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.marked.MarkDuplicates.metrics.txt:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "4": [
+ "versions.yml:md5,b699af51b1956f3810f8a7c066e0ab17"
+ ],
+ "bai": [
+
+ ],
+ "bam": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.marked.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "cram": [
+
+ ],
+ "metrics": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.marked.MarkDuplicates.metrics.txt:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "versions": [
+ "versions.yml:md5,b699af51b1956f3810f8a7c066e0ab17"
+ ]
+ }
],
"meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.10.1"
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
},
- "timestamp": "2024-01-19T10:26:28.100755"
+ "timestamp": "2024-07-22T19:34:01.021052"
},
- "cram_metrics": {
+ "sarscov2 [unsorted bam]": {
"content": [
+ "test.marked.bam",
[
"## htsjdk.samtools.metrics.StringHeader",
- "# MarkDuplicates --INPUT test.paired_end.sorted.cram --OUTPUT test.marked.cram --METRICS_FILE test.marked.MarkDuplicates.metrics.txt --ASSUME_SORT_ORDER queryname --REFERENCE_SEQUENCE genome.fasta --MAX_SEQUENCES_FOR_DISK_READ_ENDS_MAP 50000 --MAX_FILE_HANDLES_FOR_READ_ENDS_MAP 8000 --SORTING_COLLECTION_SIZE_RATIO 0.25 --TAG_DUPLICATE_SET_MEMBERS false --REMOVE_SEQUENCING_DUPLICATES false --TAGGING_POLICY DontTag --CLEAR_DT true --DUPLEX_UMI false --FLOW_MODE false --FLOW_QUALITY_SUM_STRATEGY false --USE_END_IN_UNPAIRED_READS false --USE_UNPAIRED_CLIPPED_END false --UNPAIRED_END_UNCERTAINTY 0 --FLOW_SKIP_FIRST_N_FLOWS 0 --FLOW_Q_IS_KNOWN_END false --FLOW_EFFECTIVE_QUALITY_THRESHOLD 15 --ADD_PG_TAG_TO_READS true --REMOVE_DUPLICATES false --ASSUME_SORTED false --DUPLICATE_SCORING_STRATEGY SUM_OF_BASE_QUALITIES --PROGRAM_RECORD_ID MarkDuplicates --PROGRAM_GROUP_NAME MarkDuplicates --READ_NAME_REGEX --OPTICAL_DUPLICATE_PIXEL_DISTANCE 100 --MAX_OPTICAL_DUPLICATE_SET_SIZE 300000 --VERBOSITY INFO --QUIET false --VALIDATION_STRINGENCY STRICT --COMPRESSION_LEVEL 5 --MAX_RECORDS_IN_RAM 500000 --CREATE_INDEX false --CREATE_MD5_FILE false --help false --version false --showHidden false --USE_JDK_DEFLATER false --USE_JDK_INFLATER false",
+ "# MarkDuplicates --INPUT test.paired_end.bam --OUTPUT test.marked.bam --METRICS_FILE test.marked.MarkDuplicates.metrics.txt --ASSUME_SORT_ORDER queryname --MAX_SEQUENCES_FOR_DISK_READ_ENDS_MAP 50000 --MAX_FILE_HANDLES_FOR_READ_ENDS_MAP 8000 --SORTING_COLLECTION_SIZE_RATIO 0.25 --TAG_DUPLICATE_SET_MEMBERS false --REMOVE_SEQUENCING_DUPLICATES false --TAGGING_POLICY DontTag --CLEAR_DT true --DUPLEX_UMI false --FLOW_MODE false --FLOW_QUALITY_SUM_STRATEGY false --USE_END_IN_UNPAIRED_READS false --USE_UNPAIRED_CLIPPED_END false --UNPAIRED_END_UNCERTAINTY 0 --FLOW_SKIP_FIRST_N_FLOWS 0 --FLOW_Q_IS_KNOWN_END false --FLOW_EFFECTIVE_QUALITY_THRESHOLD 15 --ADD_PG_TAG_TO_READS true --REMOVE_DUPLICATES false --ASSUME_SORTED false --DUPLICATE_SCORING_STRATEGY SUM_OF_BASE_QUALITIES --PROGRAM_RECORD_ID MarkDuplicates --PROGRAM_GROUP_NAME MarkDuplicates --READ_NAME_REGEX --OPTICAL_DUPLICATE_PIXEL_DISTANCE 100 --MAX_OPTICAL_DUPLICATE_SET_SIZE 300000 --VERBOSITY INFO --QUIET false --VALIDATION_STRINGENCY STRICT --COMPRESSION_LEVEL 5 --MAX_RECORDS_IN_RAM 500000 --CREATE_INDEX false --CREATE_MD5_FILE false --help false --version false --showHidden false --USE_JDK_DEFLATER false --USE_JDK_INFLATER false",
"## htsjdk.samtools.metrics.StringHeader"
+ ],
+ [
+ "versions.yml:md5,b699af51b1956f3810f8a7c066e0ab17"
]
],
"meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.10.1"
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
},
- "timestamp": "2024-03-20T15:25:47.518152"
+ "timestamp": "2024-07-22T19:32:49.777427"
},
- "sorted_bam_metrics": {
+ "sarscov2 [sorted bam]": {
"content": [
+ "test.marked.bam",
[
"## htsjdk.samtools.metrics.StringHeader",
"# MarkDuplicates --INPUT test.paired_end.sorted.bam --OUTPUT test.marked.bam --METRICS_FILE test.marked.MarkDuplicates.metrics.txt --ASSUME_SORT_ORDER queryname --MAX_SEQUENCES_FOR_DISK_READ_ENDS_MAP 50000 --MAX_FILE_HANDLES_FOR_READ_ENDS_MAP 8000 --SORTING_COLLECTION_SIZE_RATIO 0.25 --TAG_DUPLICATE_SET_MEMBERS false --REMOVE_SEQUENCING_DUPLICATES false --TAGGING_POLICY DontTag --CLEAR_DT true --DUPLEX_UMI false --FLOW_MODE false --FLOW_QUALITY_SUM_STRATEGY false --USE_END_IN_UNPAIRED_READS false --USE_UNPAIRED_CLIPPED_END false --UNPAIRED_END_UNCERTAINTY 0 --FLOW_SKIP_FIRST_N_FLOWS 0 --FLOW_Q_IS_KNOWN_END false --FLOW_EFFECTIVE_QUALITY_THRESHOLD 15 --ADD_PG_TAG_TO_READS true --REMOVE_DUPLICATES false --ASSUME_SORTED false --DUPLICATE_SCORING_STRATEGY SUM_OF_BASE_QUALITIES --PROGRAM_RECORD_ID MarkDuplicates --PROGRAM_GROUP_NAME MarkDuplicates --READ_NAME_REGEX --OPTICAL_DUPLICATE_PIXEL_DISTANCE 100 --MAX_OPTICAL_DUPLICATE_SET_SIZE 300000 --VERBOSITY INFO --QUIET false --VALIDATION_STRINGENCY STRICT --COMPRESSION_LEVEL 5 --MAX_RECORDS_IN_RAM 500000 --CREATE_INDEX false --CREATE_MD5_FILE false --help false --version false --showHidden false --USE_JDK_DEFLATER false --USE_JDK_INFLATER false",
"## htsjdk.samtools.metrics.StringHeader"
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.10.1"
- },
- "timestamp": "2024-03-21T11:39:10.318331"
- },
- "cram_name": {
- "content": [
- "test.marked.cram"
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.10.1"
- },
- "timestamp": "2024-03-20T15:25:47.459663"
- },
- "cram_versions": {
- "content": [
+ ],
[
"versions.yml:md5,b699af51b1956f3810f8a7c066e0ab17"
]
],
"meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.10.1"
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
},
- "timestamp": "2024-01-19T10:27:03.26989"
+ "timestamp": "2024-07-22T19:33:14.462596"
},
- "unsorted_bam_versions": {
- "content": [
- [
- "versions.yml:md5,b699af51b1956f3810f8a7c066e0ab17"
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.10.1"
- },
- "timestamp": "2024-03-20T15:31:24.040403"
- },
- "unsorted_bam_metrics": {
+ "homo_sapiens [cram]": {
"content": [
+ "test.marked.cram",
[
"## htsjdk.samtools.metrics.StringHeader",
- "# MarkDuplicates --INPUT test.paired_end.bam --OUTPUT test.marked.bam --METRICS_FILE test.marked.MarkDuplicates.metrics.txt --ASSUME_SORT_ORDER queryname --MAX_SEQUENCES_FOR_DISK_READ_ENDS_MAP 50000 --MAX_FILE_HANDLES_FOR_READ_ENDS_MAP 8000 --SORTING_COLLECTION_SIZE_RATIO 0.25 --TAG_DUPLICATE_SET_MEMBERS false --REMOVE_SEQUENCING_DUPLICATES false --TAGGING_POLICY DontTag --CLEAR_DT true --DUPLEX_UMI false --FLOW_MODE false --FLOW_QUALITY_SUM_STRATEGY false --USE_END_IN_UNPAIRED_READS false --USE_UNPAIRED_CLIPPED_END false --UNPAIRED_END_UNCERTAINTY 0 --FLOW_SKIP_FIRST_N_FLOWS 0 --FLOW_Q_IS_KNOWN_END false --FLOW_EFFECTIVE_QUALITY_THRESHOLD 15 --ADD_PG_TAG_TO_READS true --REMOVE_DUPLICATES false --ASSUME_SORTED false --DUPLICATE_SCORING_STRATEGY SUM_OF_BASE_QUALITIES --PROGRAM_RECORD_ID MarkDuplicates --PROGRAM_GROUP_NAME MarkDuplicates --READ_NAME_REGEX --OPTICAL_DUPLICATE_PIXEL_DISTANCE 100 --MAX_OPTICAL_DUPLICATE_SET_SIZE 300000 --VERBOSITY INFO --QUIET false --VALIDATION_STRINGENCY STRICT --COMPRESSION_LEVEL 5 --MAX_RECORDS_IN_RAM 500000 --CREATE_INDEX false --CREATE_MD5_FILE false --help false --version false --showHidden false --USE_JDK_DEFLATER false --USE_JDK_INFLATER false",
+ "# MarkDuplicates --INPUT test.paired_end.sorted.cram --OUTPUT test.marked.cram --METRICS_FILE test.marked.MarkDuplicates.metrics.txt --ASSUME_SORT_ORDER queryname --REFERENCE_SEQUENCE genome.fasta --MAX_SEQUENCES_FOR_DISK_READ_ENDS_MAP 50000 --MAX_FILE_HANDLES_FOR_READ_ENDS_MAP 8000 --SORTING_COLLECTION_SIZE_RATIO 0.25 --TAG_DUPLICATE_SET_MEMBERS false --REMOVE_SEQUENCING_DUPLICATES false --TAGGING_POLICY DontTag --CLEAR_DT true --DUPLEX_UMI false --FLOW_MODE false --FLOW_QUALITY_SUM_STRATEGY false --USE_END_IN_UNPAIRED_READS false --USE_UNPAIRED_CLIPPED_END false --UNPAIRED_END_UNCERTAINTY 0 --FLOW_SKIP_FIRST_N_FLOWS 0 --FLOW_Q_IS_KNOWN_END false --FLOW_EFFECTIVE_QUALITY_THRESHOLD 15 --ADD_PG_TAG_TO_READS true --REMOVE_DUPLICATES false --ASSUME_SORTED false --DUPLICATE_SCORING_STRATEGY SUM_OF_BASE_QUALITIES --PROGRAM_RECORD_ID MarkDuplicates --PROGRAM_GROUP_NAME MarkDuplicates --READ_NAME_REGEX --OPTICAL_DUPLICATE_PIXEL_DISTANCE 100 --MAX_OPTICAL_DUPLICATE_SET_SIZE 300000 --VERBOSITY INFO --QUIET false --VALIDATION_STRINGENCY STRICT --COMPRESSION_LEVEL 5 --MAX_RECORDS_IN_RAM 500000 --CREATE_INDEX false --CREATE_MD5_FILE false --help false --version false --showHidden false --USE_JDK_DEFLATER false --USE_JDK_INFLATER false",
"## htsjdk.samtools.metrics.StringHeader"
+ ],
+ [
+ "versions.yml:md5,b699af51b1956f3810f8a7c066e0ab17"
]
],
"meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.10.1"
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
},
- "timestamp": "2024-03-21T10:51:12.831787"
+ "timestamp": "2024-07-22T19:33:40.215159"
},
- "sorted_bam_name": {
+ "homo_sapiens [cram] - stub": {
"content": [
- "test.marked.bam"
+ {
+ "0": [
+
+ ],
+ "1": [
+
+ ],
+ "2": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.marked.cram:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "3": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.marked.MarkDuplicates.metrics.txt:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "4": [
+ "versions.yml:md5,b699af51b1956f3810f8a7c066e0ab17"
+ ],
+ "bai": [
+
+ ],
+ "bam": [
+
+ ],
+ "cram": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.marked.cram:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "metrics": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.marked.MarkDuplicates.metrics.txt:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "versions": [
+ "versions.yml:md5,b699af51b1956f3810f8a7c066e0ab17"
+ ]
+ }
],
"meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.10.1"
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
},
- "timestamp": "2024-01-19T10:26:45.080116"
+ "timestamp": "2024-07-22T19:34:51.753515"
}
}
\ No newline at end of file
diff --git a/modules/nf-core/preseq/lcextrap/tests/main.nf.test b/modules/nf-core/preseq/lcextrap/tests/main.nf.test
index d1af1f0ed..50e44157e 100644
--- a/modules/nf-core/preseq/lcextrap/tests/main.nf.test
+++ b/modules/nf-core/preseq/lcextrap/tests/main.nf.test
@@ -3,10 +3,6 @@ nextflow_process {
name "Test Process PRESEQ_LCEXTRAP"
script "../main.nf"
process "PRESEQ_LCEXTRAP"
- tag "modules"
- tag "modules_nfcore"
- tag "preseq"
- tag "preseq/lcextrap"
test("sarscov2 - single_end") {
when {
diff --git a/modules/nf-core/qualimap/rnaseq/tests/main.nf.test b/modules/nf-core/qualimap/rnaseq/tests/main.nf.test
index 42403c502..ff4197eeb 100644
--- a/modules/nf-core/qualimap/rnaseq/tests/main.nf.test
+++ b/modules/nf-core/qualimap/rnaseq/tests/main.nf.test
@@ -5,11 +5,38 @@ nextflow_process {
process "QUALIMAP_RNASEQ"
test("homo_sapiens [bam]") {
-
when {
- params {
- outdir = "$outputDir"
+ process {
+ """
+ input[0] = Channel.of([
+ [ id:'test', single_end:false ], // meta map
+ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true)
+ ])
+ input[1] = Channel.of([
+ [ id:'test_fasta_gtf' ], // meta map
+ [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true) ]
+ ])
+ """
}
+ }
+
+ then {
+ assertAll (
+ { assert process.success },
+ { assert snapshot(
+ file("${process.out.results[0][1]}/qualimapReport.html").name,
+ path("${process.out.results[0][1]}/rnaseq_qc_results.txt"),
+ process.out.versions
+ ).match() }
+ )
+ }
+ }
+
+ test("homo_sapiens [bam] - stub") {
+
+ options "-stub"
+
+ when {
process {
"""
input[0] = Channel.of([
@@ -27,9 +54,7 @@ nextflow_process {
then {
assertAll (
{ assert process.success },
- { assert path("${process.out.results[0][1]}/qualimapReport.html").exists() },
- { assert snapshot(path("${process.out.results[0][1]}/rnaseq_qc_results.txt")).match("rnaseq_qc_results") },
- { assert snapshot(process.out.versions).match("versions") }
+ { assert snapshot(process.out).match() }
)
}
}
diff --git a/modules/nf-core/qualimap/rnaseq/tests/main.nf.test.snap b/modules/nf-core/qualimap/rnaseq/tests/main.nf.test.snap
index 7d1c72811..682462639 100644
--- a/modules/nf-core/qualimap/rnaseq/tests/main.nf.test.snap
+++ b/modules/nf-core/qualimap/rnaseq/tests/main.nf.test.snap
@@ -1,16 +1,55 @@
{
- "rnaseq_qc_results": {
+ "homo_sapiens [bam] - stub": {
"content": [
- "rnaseq_qc_results.txt:md5,b77878cac45beaa79a892af54aad2da3"
+ {
+ "0": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+
+ ]
+ ]
+ ],
+ "1": [
+ "versions.yml:md5,a6868ab89f7d31361a7791db2dea98e7"
+ ],
+ "results": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+
+ ]
+ ]
+ ],
+ "versions": [
+ "versions.yml:md5,a6868ab89f7d31361a7791db2dea98e7"
+ ]
+ }
],
- "timestamp": "2024-01-19T12:07:55.509784"
+ "meta": {
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
+ },
+ "timestamp": "2024-07-22T11:27:41.158111"
},
- "versions": {
+ "homo_sapiens [bam]": {
"content": [
+ "qualimapReport.html",
+ "rnaseq_qc_results.txt:md5,b77878cac45beaa79a892af54aad2da3",
[
"versions.yml:md5,a6868ab89f7d31361a7791db2dea98e7"
]
],
- "timestamp": "2024-01-19T12:07:55.512116"
+ "meta": {
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
+ },
+ "timestamp": "2024-07-22T11:27:30.782304"
}
}
\ No newline at end of file
diff --git a/modules/nf-core/salmon/quant/tests/main.nf.test b/modules/nf-core/salmon/quant/tests/main.nf.test
index 1bd264e96..24d8dd700 100644
--- a/modules/nf-core/salmon/quant/tests/main.nf.test
+++ b/modules/nf-core/salmon/quant/tests/main.nf.test
@@ -4,7 +4,7 @@ nextflow_process {
script "../main.nf"
process "SALMON_QUANT"
config "./nextflow.config"
-
+
setup {
run("SALMON_INDEX") {
script "../../../salmon/index/main.nf"
diff --git a/modules/nf-core/samtools/flagstat/tests/main.nf.test b/modules/nf-core/samtools/flagstat/tests/main.nf.test
index 4d3742361..b899f1fc7 100644
--- a/modules/nf-core/samtools/flagstat/tests/main.nf.test
+++ b/modules/nf-core/samtools/flagstat/tests/main.nf.test
@@ -7,9 +7,30 @@ nextflow_process {
test("BAM") {
when {
- params {
- outdir = "$outputDir"
+ process {
+ """
+ input[0] = Channel.of([
+ [ id:'test', single_end:false ], // meta map
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true)
+ ])
+ """
}
+ }
+
+ then {
+ assertAll (
+ { assert process.success },
+ { assert snapshot(process.out).match() }
+ )
+ }
+ }
+
+ test("BAM - stub") {
+
+ options "-stub"
+
+ when {
process {
"""
input[0] = Channel.of([
@@ -24,8 +45,7 @@ nextflow_process {
then {
assertAll (
{ assert process.success },
- { assert snapshot(process.out.flagstat).match("flagstat") },
- { assert snapshot(process.out.versions).match("versions") }
+ { assert snapshot(process.out).match() }
)
}
}
diff --git a/modules/nf-core/samtools/flagstat/tests/main.nf.test.snap b/modules/nf-core/samtools/flagstat/tests/main.nf.test.snap
index e9f85efa9..23989c612 100644
--- a/modules/nf-core/samtools/flagstat/tests/main.nf.test.snap
+++ b/modules/nf-core/samtools/flagstat/tests/main.nf.test.snap
@@ -1,32 +1,72 @@
{
- "flagstat": {
+ "BAM - stub": {
"content": [
- [
- [
- {
- "id": "test",
- "single_end": false
- },
- "test.flagstat:md5,4f7ffd1e6a5e85524d443209ac97d783"
+ {
+ "0": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "1": [
+ "versions.yml:md5,f606681ef971cbb548a4d9e3fbabdbc2"
+ ],
+ "flagstat": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "versions": [
+ "versions.yml:md5,f606681ef971cbb548a4d9e3fbabdbc2"
]
- ]
+ }
],
"meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.04.3"
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
},
- "timestamp": "2024-02-12T18:31:37.783927"
+ "timestamp": "2024-07-22T14:17:28.002887"
},
- "versions": {
+ "BAM": {
"content": [
- [
- "versions.yml:md5,f606681ef971cbb548a4d9e3fbabdbc2"
- ]
+ {
+ "0": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.flagstat:md5,4f7ffd1e6a5e85524d443209ac97d783"
+ ]
+ ],
+ "1": [
+ "versions.yml:md5,f606681ef971cbb548a4d9e3fbabdbc2"
+ ],
+ "flagstat": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.flagstat:md5,4f7ffd1e6a5e85524d443209ac97d783"
+ ]
+ ],
+ "versions": [
+ "versions.yml:md5,f606681ef971cbb548a4d9e3fbabdbc2"
+ ]
+ }
],
"meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.10.1"
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
},
- "timestamp": "2024-05-28T15:41:52.516253882"
+ "timestamp": "2024-07-22T14:17:13.330971"
}
}
\ No newline at end of file
diff --git a/modules/nf-core/samtools/idxstats/tests/main.nf.test b/modules/nf-core/samtools/idxstats/tests/main.nf.test
index e6c427053..bf4c31047 100644
--- a/modules/nf-core/samtools/idxstats/tests/main.nf.test
+++ b/modules/nf-core/samtools/idxstats/tests/main.nf.test
@@ -7,9 +7,6 @@ nextflow_process {
test("bam") {
when {
- params {
- outdir = "$outputDir"
- }
process {
"""
input[0] = Channel.of([
@@ -24,9 +21,29 @@ nextflow_process {
then {
assertAll (
{ assert process.success },
- { assert snapshot(process.out.idxstats).match("idxstats") },
- { assert snapshot(process.out.versions).match("versions") }
+ { assert snapshot(process.out).match() }
)
}
}
-}
+
+ test("bam - stub") {
+ options "-stub"
+ when {
+ process {
+ """
+ input[0] = Channel.of([
+ [ id:'test', single_end:false ], // meta map
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true)
+ ])
+ """
+ }
+ }
+
+ then {
+ assertAll (
+ { assert process.success },
+ { assert snapshot(process.out).match() }
+ )
+ }
+ }}
diff --git a/modules/nf-core/samtools/idxstats/tests/main.nf.test.snap b/modules/nf-core/samtools/idxstats/tests/main.nf.test.snap
index 4eacdb90f..a5ac8104e 100644
--- a/modules/nf-core/samtools/idxstats/tests/main.nf.test.snap
+++ b/modules/nf-core/samtools/idxstats/tests/main.nf.test.snap
@@ -1,32 +1,72 @@
{
- "versions": {
+ "bam - stub": {
"content": [
- [
- "versions.yml:md5,7acbcb2a8ec6436ba7b2916d3ff13351"
- ]
+ {
+ "0": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.idxstats:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "1": [
+ "versions.yml:md5,7acbcb2a8ec6436ba7b2916d3ff13351"
+ ],
+ "idxstats": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.idxstats:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "versions": [
+ "versions.yml:md5,7acbcb2a8ec6436ba7b2916d3ff13351"
+ ]
+ }
],
"meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.10.1"
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
},
- "timestamp": "2024-05-28T15:46:46.617989517"
+ "timestamp": "2024-07-22T14:17:56.180093"
},
- "idxstats": {
+ "bam": {
"content": [
- [
- [
- {
- "id": "test",
- "single_end": false
- },
- "test.idxstats:md5,df60a8c8d6621100d05178c93fb053a2"
+ {
+ "0": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.idxstats:md5,df60a8c8d6621100d05178c93fb053a2"
+ ]
+ ],
+ "1": [
+ "versions.yml:md5,7acbcb2a8ec6436ba7b2916d3ff13351"
+ ],
+ "idxstats": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.idxstats:md5,df60a8c8d6621100d05178c93fb053a2"
+ ]
+ ],
+ "versions": [
+ "versions.yml:md5,7acbcb2a8ec6436ba7b2916d3ff13351"
]
- ]
+ }
],
"meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.04.3"
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
},
- "timestamp": "2024-02-12T18:36:41.561026"
+ "timestamp": "2024-07-22T14:17:41.408704"
}
}
\ No newline at end of file
diff --git a/modules/nf-core/samtools/index/main.nf b/modules/nf-core/samtools/index/main.nf
index b523c21b4..e002585b9 100644
--- a/modules/nf-core/samtools/index/main.nf
+++ b/modules/nf-core/samtools/index/main.nf
@@ -35,10 +35,11 @@ process SAMTOOLS_INDEX {
"""
stub:
+ def args = task.ext.args ?: ''
+ def extension = file(input).getExtension() == 'cram' ?
+ "crai" : args.contains("-c") ? "csi" : "bai"
"""
- touch ${input}.bai
- touch ${input}.crai
- touch ${input}.csi
+ touch ${input}.${extension}
cat <<-END_VERSIONS > versions.yml
"${task.process}":
diff --git a/modules/nf-core/samtools/index/tests/main.nf.test b/modules/nf-core/samtools/index/tests/main.nf.test
index e3f918965..b59a25b38 100644
--- a/modules/nf-core/samtools/index/tests/main.nf.test
+++ b/modules/nf-core/samtools/index/tests/main.nf.test
@@ -5,11 +5,7 @@ nextflow_process {
process "SAMTOOLS_INDEX"
test("bai") {
-
when {
- params {
- outdir = "$outputDir"
- }
process {
"""
input[0] = Channel.of([
@@ -23,18 +19,13 @@ nextflow_process {
then {
assertAll (
{ assert process.success },
- { assert snapshot(process.out.bai).match("bai") },
- { assert snapshot(process.out.versions).match("bai_versions") }
+ { assert snapshot(process.out).match() }
)
}
}
test("crai") {
-
when {
- params {
- outdir = "$outputDir"
- }
process {
"""
input[0] = Channel.of([
@@ -48,20 +39,83 @@ nextflow_process {
then {
assertAll (
{ assert process.success },
- { assert snapshot(process.out.crai).match("crai") },
- { assert snapshot(process.out.versions).match("crai_versions") }
+ { assert snapshot(process.out).match() }
)
}
}
test("csi") {
-
config "./csi.nextflow.config"
when {
- params {
- outdir = "$outputDir"
+ process {
+ """
+ input[0] = Channel.of([
+ [ id:'test', single_end:false ], // meta map
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true)
+ ])
+ """
+ }
+ }
+
+ then {
+ assertAll (
+ { assert process.success },
+ { assert snapshot(
+ file(process.out.csi[0][1]).name,
+ process.out.versions
+ ).match() }
+ )
+ }
+ }
+
+ test("bai - stub") {
+ options "-stub"
+ when {
+ process {
+ """
+ input[0] = Channel.of([
+ [ id:'test', single_end:false ], // meta map
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true)
+ ])
+ """
+ }
+ }
+
+ then {
+ assertAll (
+ { assert process.success },
+ { assert snapshot(process.out).match() }
+ )
+ }
+ }
+
+ test("crai - stub") {
+ options "-stub"
+ when {
+ process {
+ """
+ input[0] = Channel.of([
+ [ id:'test', single_end:false ], // meta map
+ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.recalibrated.sorted.cram', checkIfExists: true)
+ ])
+ """
}
+ }
+
+ then {
+ assertAll (
+ { assert process.success },
+ { assert snapshot(process.out).match() }
+ )
+ }
+ }
+
+ test("csi - stub") {
+ options "-stub"
+ config "./csi.nextflow.config"
+
+ when {
process {
"""
input[0] = Channel.of([
@@ -75,8 +129,7 @@ nextflow_process {
then {
assertAll (
{ assert process.success },
- { assert path(process.out.csi.get(0).get(1)).exists() },
- { assert snapshot(process.out.versions).match("csi_versions") }
+ { assert snapshot(process.out).match() }
)
}
}
diff --git a/modules/nf-core/samtools/index/tests/main.nf.test.snap b/modules/nf-core/samtools/index/tests/main.nf.test.snap
index 52756e85c..799d199ce 100644
--- a/modules/nf-core/samtools/index/tests/main.nf.test.snap
+++ b/modules/nf-core/samtools/index/tests/main.nf.test.snap
@@ -1,74 +1,250 @@
{
- "crai_versions": {
+ "csi - stub": {
"content": [
- [
- "versions.yml:md5,802c9776d9c5e95314e888cf18e96d77"
- ]
+ {
+ "0": [
+
+ ],
+ "1": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.paired_end.sorted.bam.csi:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "2": [
+
+ ],
+ "3": [
+ "versions.yml:md5,802c9776d9c5e95314e888cf18e96d77"
+ ],
+ "bai": [
+
+ ],
+ "crai": [
+
+ ],
+ "csi": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.paired_end.sorted.bam.csi:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "versions": [
+ "versions.yml:md5,802c9776d9c5e95314e888cf18e96d77"
+ ]
+ }
],
"meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.10.1"
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
},
- "timestamp": "2024-05-28T15:42:04.203740976"
+ "timestamp": "2024-07-22T16:51:53.9057"
},
- "csi_versions": {
+ "crai - stub": {
"content": [
- [
- "versions.yml:md5,802c9776d9c5e95314e888cf18e96d77"
- ]
+ {
+ "0": [
+
+ ],
+ "1": [
+
+ ],
+ "2": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.paired_end.recalibrated.sorted.cram.crai:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "3": [
+ "versions.yml:md5,802c9776d9c5e95314e888cf18e96d77"
+ ],
+ "bai": [
+
+ ],
+ "crai": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.paired_end.recalibrated.sorted.cram.crai:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "csi": [
+
+ ],
+ "versions": [
+ "versions.yml:md5,802c9776d9c5e95314e888cf18e96d77"
+ ]
+ }
],
"meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.10.1"
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
},
- "timestamp": "2024-05-28T15:42:09.57475878"
+ "timestamp": "2024-07-22T16:51:45.931558"
},
- "crai": {
+ "bai - stub": {
"content": [
- [
- [
- {
- "id": "test",
- "single_end": false
- },
- "test.paired_end.recalibrated.sorted.cram.crai:md5,14bc3bd5c89cacc8f4541f9062429029"
+ {
+ "0": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.paired_end.sorted.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "1": [
+
+ ],
+ "2": [
+
+ ],
+ "3": [
+ "versions.yml:md5,802c9776d9c5e95314e888cf18e96d77"
+ ],
+ "bai": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.paired_end.sorted.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "crai": [
+
+ ],
+ "csi": [
+
+ ],
+ "versions": [
+ "versions.yml:md5,802c9776d9c5e95314e888cf18e96d77"
]
- ]
+ }
],
"meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.04.3"
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
},
- "timestamp": "2024-02-12T18:41:38.446424"
+ "timestamp": "2024-07-22T16:51:34.807525"
},
- "bai": {
+ "csi": {
"content": [
+ "test.paired_end.sorted.bam.csi",
[
- [
- {
- "id": "test",
- "single_end": false
- },
- "test.paired_end.sorted.bam.bai:md5,704c10dd1326482448ca3073fdebc2f4"
- ]
+ "versions.yml:md5,802c9776d9c5e95314e888cf18e96d77"
]
],
"meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.04.3"
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
},
- "timestamp": "2024-02-12T18:40:46.579747"
+ "timestamp": "2024-07-22T16:52:55.688799"
},
- "bai_versions": {
+ "crai": {
"content": [
- [
- "versions.yml:md5,802c9776d9c5e95314e888cf18e96d77"
- ]
+ {
+ "0": [
+
+ ],
+ "1": [
+
+ ],
+ "2": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.paired_end.recalibrated.sorted.cram.crai:md5,14bc3bd5c89cacc8f4541f9062429029"
+ ]
+ ],
+ "3": [
+ "versions.yml:md5,802c9776d9c5e95314e888cf18e96d77"
+ ],
+ "bai": [
+
+ ],
+ "crai": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.paired_end.recalibrated.sorted.cram.crai:md5,14bc3bd5c89cacc8f4541f9062429029"
+ ]
+ ],
+ "csi": [
+
+ ],
+ "versions": [
+ "versions.yml:md5,802c9776d9c5e95314e888cf18e96d77"
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
+ },
+ "timestamp": "2024-07-22T16:51:17.609533"
+ },
+ "bai": {
+ "content": [
+ {
+ "0": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.paired_end.sorted.bam.bai:md5,704c10dd1326482448ca3073fdebc2f4"
+ ]
+ ],
+ "1": [
+
+ ],
+ "2": [
+
+ ],
+ "3": [
+ "versions.yml:md5,802c9776d9c5e95314e888cf18e96d77"
+ ],
+ "bai": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.paired_end.sorted.bam.bai:md5,704c10dd1326482448ca3073fdebc2f4"
+ ]
+ ],
+ "crai": [
+
+ ],
+ "csi": [
+
+ ],
+ "versions": [
+ "versions.yml:md5,802c9776d9c5e95314e888cf18e96d77"
+ ]
+ }
],
"meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.10.1"
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
},
- "timestamp": "2024-05-28T15:41:57.929287369"
+ "timestamp": "2024-07-22T16:51:04.16585"
}
}
\ No newline at end of file
diff --git a/modules/nf-core/samtools/sort/main.nf b/modules/nf-core/samtools/sort/main.nf
index 596c6f7e9..8e019099c 100644
--- a/modules/nf-core/samtools/sort/main.nf
+++ b/modules/nf-core/samtools/sort/main.nf
@@ -50,10 +50,20 @@ process SAMTOOLS_SORT {
"""
stub:
+ def args = task.ext.args ?: ''
def prefix = task.ext.prefix ?: "${meta.id}"
+ def extension = args.contains("--output-fmt sam") ? "sam" :
+ args.contains("--output-fmt cram") ? "cram" :
+ "bam"
"""
- touch ${prefix}.bam
- touch ${prefix}.bam.csi
+ touch ${prefix}.${extension}
+ if [ "${extension}" == "bam" ];
+ then
+ touch ${prefix}.${extension}.csi
+ elif [ "${extension}" == "cram" ];
+ then
+ touch ${prefix}.${extension}.crai
+ fi
cat <<-END_VERSIONS > versions.yml
"${task.process}":
diff --git a/modules/nf-core/samtools/sort/tests/main.nf.test b/modules/nf-core/samtools/sort/tests/main.nf.test
index cb97ca66b..41c2fca7f 100644
--- a/modules/nf-core/samtools/sort/tests/main.nf.test
+++ b/modules/nf-core/samtools/sort/tests/main.nf.test
@@ -28,16 +28,16 @@ nextflow_process {
{ assert process.success },
{ assert snapshot(
process.out.bam,
- process.out.csi.collect { it.collect { it instanceof Map ? it : file(it).name } }
- ).match("test_bam")
- }
+ process.out.csi.collect { it.collect { it instanceof Map ? it : file(it).name } },
+ process.out.versions
+ ).match()}
)
}
}
test("cram") {
- config "./nextflow.config"
+ config "./nextflow_cram.config"
when {
process {
@@ -58,23 +58,20 @@ nextflow_process {
assertAll (
{ assert process.success },
{ assert snapshot(
- process.out.bam,
- process.out.csi.collect { it.collect { it instanceof Map ? it : file(it).name } }
- ).match("test_cram")
- }
+ process.out.cram.collect { it.collect { it instanceof Map ? it : file(it).name } },
+ process.out.crai.collect { it.collect { it instanceof Map ? it : file(it).name } },
+ process.out.versions
+ ).match()}
)
}
}
- test("bam_stub") {
+ test("bam - stub") {
- config "./nextflow.config"
options "-stub"
+ config "./nextflow.config"
when {
- params {
- outdir = "$outputDir"
- }
process {
"""
input[0] = Channel.of([
@@ -92,8 +89,35 @@ nextflow_process {
then {
assertAll (
{ assert process.success },
- { assert snapshot(file(process.out.bam[0][1]).name).match("bam_stub_bam") },
- { assert snapshot(process.out.versions).match("bam_stub_versions") }
+ { assert snapshot(process.out).match() }
+ )
+ }
+ }
+
+ test("cram - stub") {
+
+ options "-stub"
+ config "./nextflow_cram.config"
+
+ when {
+ process {
+ """
+ input[0] = Channel.of([
+ [ id:'test', single_end:false ], // meta map
+ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram', checkIfExists: true)
+ ])
+ input[1] = Channel.of([
+ [ id:'fasta' ], // meta map
+ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)
+ ])
+ """
+ }
+ }
+
+ then {
+ assertAll (
+ { assert process.success },
+ { assert snapshot(process.out).match() }
)
}
}
diff --git a/modules/nf-core/samtools/sort/tests/main.nf.test.snap b/modules/nf-core/samtools/sort/tests/main.nf.test.snap
index 5a27de1d1..da38d5d15 100644
--- a/modules/nf-core/samtools/sort/tests/main.nf.test.snap
+++ b/modules/nf-core/samtools/sort/tests/main.nf.test.snap
@@ -7,54 +7,159 @@
"id": "test",
"single_end": false
},
- "test.sorted.bam:md5,21c992d59615936b99f2ad008aa54400"
+ "test.sorted.cram"
]
+ ],
+ [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.sorted.cram.crai"
+ ]
+ ],
+ [
+ "versions.yml:md5,7a360de20e1d7a6f15a5e8fbe0a9c062"
]
],
"meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.04.2"
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
},
- "timestamp": "2024-05-31T08:13:54.512837189"
+ "timestamp": "2024-07-22T17:19:37.196205"
},
- "bam_stub_bam": {
+ "bam - stub": {
"content": [
- "test.sorted.bam"
+ {
+ "0": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.sorted.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "1": [
+
+ ],
+ "2": [
+
+ ],
+ "3": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.sorted.bam.csi:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "4": [
+ "versions.yml:md5,7a360de20e1d7a6f15a5e8fbe0a9c062"
+ ],
+ "bam": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.sorted.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "crai": [
+
+ ],
+ "cram": [
+
+ ],
+ "csi": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.sorted.bam.csi:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "versions": [
+ "versions.yml:md5,7a360de20e1d7a6f15a5e8fbe0a9c062"
+ ]
+ }
],
"meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.04.2"
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
},
- "timestamp": "2024-05-31T07:29:00.761845507"
+ "timestamp": "2024-07-22T15:54:46.580756"
},
- "test_cram": {
+ "cram - stub": {
"content": [
- [
- [
- {
- "id": "test",
- "single_end": false
- },
- "test.sorted.bam:md5,22b2093be34a7637f5fbc84272b89d06"
- ]
- ],
- [
- [
- {
- "id": "test",
- "single_end": false
- },
- "test.sorted.bam.csi"
+ {
+ "0": [
+
+ ],
+ "1": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.sorted.cram:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "2": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.sorted.cram.crai:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "3": [
+
+ ],
+ "4": [
+ "versions.yml:md5,7a360de20e1d7a6f15a5e8fbe0a9c062"
+ ],
+ "bam": [
+
+ ],
+ "crai": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.sorted.cram.crai:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "cram": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.sorted.cram:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "csi": [
+
+ ],
+ "versions": [
+ "versions.yml:md5,7a360de20e1d7a6f15a5e8fbe0a9c062"
]
- ]
+ }
],
"meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.04.2"
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
},
- "timestamp": "2024-05-31T09:16:51.924951855"
+ "timestamp": "2024-07-22T15:57:30.505698"
},
- "test_bam": {
+ "bam": {
"content": [
[
[
@@ -73,42 +178,15 @@
},
"test.sorted.bam.csi"
]
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.04.2"
- },
- "timestamp": "2024-05-31T08:28:12.15952312"
- },
- "bam_stub_versions": {
- "content": [
+ ],
[
"versions.yml:md5,7a360de20e1d7a6f15a5e8fbe0a9c062"
]
],
"meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.04.2"
- },
- "timestamp": "2024-05-31T07:29:00.765038811"
- },
- "bam": {
- "content": [
- [
- [
- {
- "id": "test",
- "single_end": false
- },
- "test.sorted.bam:md5,21c992d59615936b99f2ad008aa54400"
- ]
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.04.2"
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
},
- "timestamp": "2024-05-31T08:13:48.538030517"
+ "timestamp": "2024-07-22T15:54:25.872954"
}
}
\ No newline at end of file
diff --git a/modules/nf-core/samtools/sort/tests/nextflow_cram.config b/modules/nf-core/samtools/sort/tests/nextflow_cram.config
new file mode 100644
index 000000000..3a8c0188b
--- /dev/null
+++ b/modules/nf-core/samtools/sort/tests/nextflow_cram.config
@@ -0,0 +1,8 @@
+process {
+
+ withName: SAMTOOLS_SORT {
+ ext.prefix = { "${meta.id}.sorted" }
+ ext.args = "--write-index --output-fmt cram"
+ }
+
+}
diff --git a/modules/nf-core/samtools/stats/tests/main.nf.test b/modules/nf-core/samtools/stats/tests/main.nf.test
index a28964666..6416ae127 100644
--- a/modules/nf-core/samtools/stats/tests/main.nf.test
+++ b/modules/nf-core/samtools/stats/tests/main.nf.test
@@ -7,9 +7,6 @@ nextflow_process {
test("bam") {
when {
- params {
- outdir = "$outputDir"
- }
process {
"""
input[0] = Channel.of([
@@ -33,9 +30,59 @@ nextflow_process {
test("cram") {
when {
- params {
- outdir = "$outputDir"
+ process {
+ """
+ input[0] = Channel.of([
+ [ id:'test', single_end:false ], // meta map
+ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.recalibrated.sorted.cram', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.recalibrated.sorted.cram.crai', checkIfExists: true)
+ ])
+ input[1] = Channel.of([
+ [ id:'genome' ], // meta map
+ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta', checkIfExists: true)
+ ])
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ {assert process.success},
+ {assert snapshot(process.out).match()}
+ )
+ }
+ }
+
+ test("bam - stub") {
+
+ options "-stub"
+
+ when {
+ process {
+ """
+ input[0] = Channel.of([
+ [ id:'test', single_end:false ], // meta map
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true)
+ ])
+ input[1] = [[],[]]
+ """
}
+ }
+
+ then {
+ assertAll(
+ {assert process.success},
+ {assert snapshot(process.out).match()}
+ )
+ }
+ }
+
+ test("cram - stub") {
+
+ options "-stub"
+
+ when {
process {
"""
input[0] = Channel.of([
@@ -45,7 +92,7 @@ nextflow_process {
])
input[1] = Channel.of([
[ id:'genome' ], // meta map
- file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)
+ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta', checkIfExists: true)
])
"""
}
diff --git a/modules/nf-core/samtools/stats/tests/main.nf.test.snap b/modules/nf-core/samtools/stats/tests/main.nf.test.snap
index 2747fd6c6..3828f3788 100644
--- a/modules/nf-core/samtools/stats/tests/main.nf.test.snap
+++ b/modules/nf-core/samtools/stats/tests/main.nf.test.snap
@@ -29,10 +29,80 @@
}
],
"meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.10.1"
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
},
- "timestamp": "2024-05-28T15:45:24.403941966"
+ "timestamp": "2024-07-22T14:20:24.885816"
+ },
+ "bam - stub": {
+ "content": [
+ {
+ "0": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.stats:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "1": [
+ "versions.yml:md5,b3b70b126f867fdbb7dcea5e36e49d4a"
+ ],
+ "stats": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.stats:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "versions": [
+ "versions.yml:md5,b3b70b126f867fdbb7dcea5e36e49d4a"
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
+ },
+ "timestamp": "2024-07-22T14:20:39.310713"
+ },
+ "cram - stub": {
+ "content": [
+ {
+ "0": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.stats:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "1": [
+ "versions.yml:md5,b3b70b126f867fdbb7dcea5e36e49d4a"
+ ],
+ "stats": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.stats:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "versions": [
+ "versions.yml:md5,b3b70b126f867fdbb7dcea5e36e49d4a"
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
+ },
+ "timestamp": "2024-07-22T14:21:04.771199"
},
"bam": {
"content": [
@@ -64,9 +134,9 @@
}
],
"meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.10.1"
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
},
- "timestamp": "2024-05-28T15:45:06.711251947"
+ "timestamp": "2024-07-22T14:19:06.645466"
}
}
\ No newline at end of file
diff --git a/modules/nf-core/sortmerna/tests/main.nf.test b/modules/nf-core/sortmerna/tests/main.nf.test
index 4388cda0c..1954bdfb0 100644
--- a/modules/nf-core/sortmerna/tests/main.nf.test
+++ b/modules/nf-core/sortmerna/tests/main.nf.test
@@ -5,7 +5,7 @@ nextflow_process {
process "SORTMERNA"
test("sarscov2 indexing only") {
-
+
config './indexing_only.config'
when {
diff --git a/modules/nf-core/star/align/main.nf b/modules/nf-core/star/align/main.nf
index 8e9c48b1c..ae67e0040 100644
--- a/modules/nf-core/star/align/main.nf
+++ b/modules/nf-core/star/align/main.nf
@@ -81,6 +81,8 @@ process STAR_ALIGN {
stub:
def prefix = task.ext.prefix ?: "${meta.id}"
"""
+ echo "" | gzip > ${prefix}.unmapped_1.fastq.gz
+ echo "" | gzip > ${prefix}.unmapped_2.fastq.gz
touch ${prefix}Xd.out.bam
touch ${prefix}.Log.final.out
touch ${prefix}.Log.out
@@ -89,8 +91,6 @@ process STAR_ALIGN {
touch ${prefix}.toTranscriptome.out.bam
touch ${prefix}.Aligned.unsort.out.bam
touch ${prefix}.Aligned.sortedByCoord.out.bam
- touch ${prefix}.unmapped_1.fastq.gz
- touch ${prefix}.unmapped_2.fastq.gz
touch ${prefix}.tab
touch ${prefix}.SJ.out.tab
touch ${prefix}.ReadsPerGene.out.tab
diff --git a/modules/nf-core/star/align/tests/main.nf.test b/modules/nf-core/star/align/tests/main.nf.test
index 4cd6f2a52..69f655ef4 100644
--- a/modules/nf-core/star/align/tests/main.nf.test
+++ b/modules/nf-core/star/align/tests/main.nf.test
@@ -4,27 +4,367 @@ nextflow_process {
script "../main.nf"
process "STAR_ALIGN"
- setup {
- run("STAR_GENOMEGENERATE") {
- script "../../../star/genomegenerate/main.nf"
+ test("homo_sapiens - single_end") {
+ config "./nextflow.config"
+
+ setup {
+ run("STAR_GENOMEGENERATE") {
+ script "../../../star/genomegenerate/main.nf"
+ process {
+ """
+ input[0] = Channel.of([
+ [ id:'test_fasta' ],
+ [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) ]
+ ])
+ input[1] = Channel.of([
+ [ id:'test_gtf' ],
+ [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true) ]
+ ])
+ """
+ }
+ }
+ }
+
+ when {
process {
"""
input[0] = Channel.of([
- [ id:'test_fasta' ],
- [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) ]
+ [ id:'test', single_end:true ], // meta map
+ [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_rnaseq_1.fastq.gz', checkIfExists: true) ]
])
- input[1] = Channel.of([
+ input[1] = STAR_GENOMEGENERATE.out.index
+ input[2] = Channel.of([
[ id:'test_gtf' ],
[ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true) ]
])
+ input[3] = false
+ input[4] = 'illumina'
+ input[5] = false
"""
}
}
+
+ then {
+ assertAll(
+ { assert process.success },
+ { assert snapshot(
+ file(process.out.log_final[0][1]).name,
+ file(process.out.log_out[0][1]).name,
+ file(process.out.log_progress[0][1]).name,
+ process.out.bam,
+ process.out.bam_sorted,
+ process.out.bam_transcript,
+ process.out.bam_unsorted,
+ process.out.bedgraph,
+ process.out.fastq,
+ process.out.junction,
+ process.out.read_per_gene_tab,
+ process.out.sam,
+ process.out.spl_junc_tab,
+ process.out.tab,
+ process.out.wig,
+ process.out.versions
+ ).match() }
+ )
+ }
}
- test("homo_sapiens - single_end") {
+ test("homo_sapiens - paired_end") {
+ config "./nextflow.config"
+
+ setup {
+ run("STAR_GENOMEGENERATE") {
+ script "../../../star/genomegenerate/main.nf"
+ process {
+ """
+ input[0] = Channel.of([
+ [ id:'test_fasta' ],
+ [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) ]
+ ])
+ input[1] = Channel.of([
+ [ id:'test_gtf' ],
+ [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true) ]
+ ])
+ """
+ }
+ }
+ }
+
+ when {
+ process {
+ """
+ input[0] = Channel.of([
+ [ id:'test', single_end:false ], // meta map
+ [
+ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_rnaseq_1.fastq.gz', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_rnaseq_2.fastq.gz', checkIfExists: true)
+ ]
+ ])
+ input[1] = STAR_GENOMEGENERATE.out.index
+ input[2] = Channel.of([
+ [ id:'test_gtf' ],
+ [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true) ]
+ ])
+ input[3] = false
+ input[4] = 'illumina'
+ input[5] = false
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert process.success },
+ { assert snapshot(
+ file(process.out.log_final[0][1]).name,
+ file(process.out.log_out[0][1]).name,
+ file(process.out.log_progress[0][1]).name,
+ process.out.bam,
+ process.out.bam_sorted,
+ process.out.bam_transcript,
+ process.out.bam_unsorted,
+ process.out.bedgraph,
+ process.out.fastq,
+ process.out.junction,
+ process.out.read_per_gene_tab,
+ process.out.sam,
+ process.out.spl_junc_tab,
+ process.out.tab,
+ process.out.wig,
+ process.out.versions
+ ).match() }
+ )
+ }
+ }
+
+ test("homo_sapiens - paired_end - arriba") {
+ config "./nextflow.arriba.config"
+
+ setup {
+ run("STAR_GENOMEGENERATE") {
+ script "../../../star/genomegenerate/main.nf"
+ process {
+ """
+ input[0] = Channel.of([
+ [ id:'test_fasta' ],
+ [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) ]
+ ])
+ input[1] = Channel.of([
+ [ id:'test_gtf' ],
+ [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true) ]
+ ])
+ """
+ }
+ }
+ }
+
+ when {
+ process {
+ """
+ input[0] = Channel.of([
+ [ id:'test', single_end:false ], // meta map
+ [
+ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_rnaseq_1.fastq.gz', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_rnaseq_2.fastq.gz', checkIfExists: true)
+ ]
+ ])
+ input[1] = STAR_GENOMEGENERATE.out.index
+ input[2] = Channel.of([
+ [ id:'test_gtf' ],
+ [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true) ]
+ ])
+ input[3] = false
+ input[4] = 'illumina'
+ input[5] = false
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert process.success },
+ { assert snapshot(
+ file(process.out.log_final[0][1]).name,
+ file(process.out.log_out[0][1]).name,
+ file(process.out.log_progress[0][1]).name,
+ process.out.bam,
+ process.out.bam_sorted,
+ process.out.bam_transcript,
+ process.out.bam_unsorted,
+ process.out.bedgraph,
+ process.out.fastq,
+ process.out.junction,
+ process.out.read_per_gene_tab,
+ process.out.sam,
+ process.out.spl_junc_tab,
+ process.out.tab,
+ process.out.wig,
+ process.out.versions
+ ).match() }
+ )
+ }
+ }
+
+ test("homo_sapiens - paired_end - starfusion") {
+ config "./nextflow.starfusion.config"
+
+ setup {
+ run("STAR_GENOMEGENERATE") {
+ script "../../../star/genomegenerate/main.nf"
+ process {
+ """
+ input[0] = Channel.of([
+ [ id:'test_fasta' ],
+ [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) ]
+ ])
+ input[1] = Channel.of([
+ [ id:'test_gtf' ],
+ [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true) ]
+ ])
+ """
+ }
+ }
+ }
+
+ when {
+ process {
+ """
+ input[0] = Channel.of([
+ [ id:'test', single_end:false ], // meta map
+ [
+ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_rnaseq_1.fastq.gz', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_rnaseq_2.fastq.gz', checkIfExists: true)
+ ]
+ ])
+ input[1] = STAR_GENOMEGENERATE.out.index
+ input[2] = Channel.of([
+ [ id:'test_gtf' ],
+ [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true) ]
+ ])
+ input[3] = false
+ input[4] = 'illumina'
+ input[5] = false
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert process.success },
+ { assert snapshot(
+ file(process.out.log_final[0][1]).name,
+ file(process.out.log_out[0][1]).name,
+ file(process.out.log_progress[0][1]).name,
+ process.out.bam,
+ process.out.bam_sorted,
+ process.out.bam_transcript,
+ process.out.bam_unsorted,
+ process.out.bedgraph,
+ process.out.fastq,
+ process.out.junction,
+ process.out.read_per_gene_tab,
+ process.out.sam,
+ process.out.spl_junc_tab,
+ process.out.tab,
+ process.out.wig,
+ process.out.versions
+ ).match() }
+ )
+ }
+ }
+
+ test("homo_sapiens - paired_end - multiple") {
config "./nextflow.config"
+ setup {
+ run("STAR_GENOMEGENERATE") {
+ script "../../../star/genomegenerate/main.nf"
+ process {
+ """
+ input[0] = Channel.of([
+ [ id:'test_fasta' ],
+ [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) ]
+ ])
+ input[1] = Channel.of([
+ [ id:'test_gtf' ],
+ [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true) ]
+ ])
+ """
+ }
+ }
+ }
+
+ when {
+ process {
+ """
+ input[0] = Channel.of([
+ [ id:'test', single_end:false ], // meta map
+ [
+ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_rnaseq_1.fastq.gz', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_rnaseq_2.fastq.gz', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_rnaseq_1.fastq.gz', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_rnaseq_2.fastq.gz', checkIfExists: true)
+ ]
+ ])
+ input[1] = STAR_GENOMEGENERATE.out.index
+ input[2] = Channel.of([
+ [ id:'test_gtf' ],
+ [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true) ]
+ ])
+ input[3] = false
+ input[4] = 'illumina'
+ input[5] = false
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert process.success },
+ { assert snapshot(
+ file(process.out.log_final[0][1]).name,
+ file(process.out.log_out[0][1]).name,
+ file(process.out.log_progress[0][1]).name,
+ process.out.bam,
+ process.out.bam_sorted,
+ process.out.bam_transcript,
+ process.out.bam_unsorted,
+ process.out.bedgraph,
+ process.out.fastq,
+ process.out.junction,
+ process.out.read_per_gene_tab,
+ process.out.sam,
+ process.out.spl_junc_tab,
+ process.out.tab,
+ process.out.wig,
+ process.out.versions
+ ).match() }
+ )
+ }
+ }
+
+ test("homo_sapiens - single_end - stub") {
+ options "-stub"
+ config "./nextflow.config"
+
+ setup {
+ run("STAR_GENOMEGENERATE") {
+ script "../../../star/genomegenerate/main.nf"
+ process {
+ """
+ input[0] = Channel.of([
+ [ id:'test_fasta' ],
+ [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) ]
+ ])
+ input[1] = Channel.of([
+ [ id:'test_gtf' ],
+ [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true) ]
+ ])
+ """
+ }
+ }
+ }
+
when {
process {
"""
@@ -47,29 +387,33 @@ nextflow_process {
then {
assertAll(
{ assert process.success },
- { assert snapshot(file(process.out.log_final[0][1]).name).match("homo_sapiens - single_end - log_final") },
- { assert snapshot(file(process.out.log_out[0][1]).name).match("homo_sapiens - single_end - log_out") },
- { assert snapshot(process.out.bam).match("homo_sapiens - single_end - bam") },
- { assert snapshot(process.out.bam_sorted).match("homo_sapiens - single_end - bam_sorted") },
- { assert snapshot(process.out.bam_transcript).match("homo_sapiens - single_end - bam_transcript") },
- { assert snapshot(process.out.bam_unsorted).match("homo_sapiens - single_end - bam_unsorted") },
- { assert snapshot(process.out.bedgraph).match("homo_sapiens - single_end - bedgraph") },
- { assert snapshot(process.out.fastq).match("homo_sapiens - single_end - fastq") },
- { assert snapshot(process.out.junction).match("homo_sapiens - single_end - junction") },
- { assert snapshot(process.out.log_progress).match("homo_sapiens - single_end - log_progress") },
- { assert snapshot(process.out.read_per_gene_tab).match("homo_sapiens - single_end - read_per_gene_tab") },
- { assert snapshot(process.out.sam).match("homo_sapiens - single_end - sam") },
- { assert snapshot(process.out.spl_junc_tab).match("homo_sapiens - single_end - spl_junc_tab") },
- { assert snapshot(process.out.tab).match("homo_sapiens - single_end - tab") },
- { assert snapshot(process.out.wig).match("homo_sapiens - single_end - wig") },
- { assert snapshot(process.out.versions).match("homo_sapiens - single_end - versions") }
+ { assert snapshot(process.out).match() }
)
}
}
- test("homo_sapiens - paired_end") {
+ test("homo_sapiens - paired_end - stub") {
+ options "-stub"
config "./nextflow.config"
+ setup {
+ run("STAR_GENOMEGENERATE") {
+ script "../../../star/genomegenerate/main.nf"
+ process {
+ """
+ input[0] = Channel.of([
+ [ id:'test_fasta' ],
+ [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) ]
+ ])
+ input[1] = Channel.of([
+ [ id:'test_gtf' ],
+ [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true) ]
+ ])
+ """
+ }
+ }
+ }
+
when {
process {
"""
@@ -95,29 +439,33 @@ nextflow_process {
then {
assertAll(
{ assert process.success },
- { assert snapshot(file(process.out.log_final[0][1]).name).match("homo_sapiens - paired_end - log_final") },
- { assert snapshot(file(process.out.log_out[0][1]).name).match("homo_sapiens - paired_end - log_out") },
- { assert snapshot(process.out.bam).match("homo_sapiens - paired_end - bam") },
- { assert snapshot(process.out.bam_sorted).match("homo_sapiens - paired_end - bam_sorted") },
- { assert snapshot(process.out.bam_transcript).match("homo_sapiens - paired_end - bam_transcript") },
- { assert snapshot(process.out.bam_unsorted).match("homo_sapiens - paired_end - bam_unsorted") },
- { assert snapshot(process.out.bedgraph).match("homo_sapiens - paired_end - bedgraph") },
- { assert snapshot(process.out.fastq).match("homo_sapiens - paired_end - fastq") },
- { assert snapshot(process.out.junction).match("homo_sapiens - paired_end - junction") },
- { assert snapshot(process.out.log_progress).match("homo_sapiens - paired_end - log_progress") },
- { assert snapshot(process.out.read_per_gene_tab).match("homo_sapiens - paired_end - read_per_gene_tab") },
- { assert snapshot(process.out.sam).match("homo_sapiens - paired_end - sam") },
- { assert snapshot(process.out.spl_junc_tab).match("homo_sapiens - paired_end - spl_junc_tab") },
- { assert snapshot(process.out.tab).match("homo_sapiens - paired_end - tab") },
- { assert snapshot(process.out.wig).match("homo_sapiens - paired_end - wig") },
- { assert snapshot(process.out.versions).match("homo_sapiens - paired_end - versions") }
+ { assert snapshot(process.out).match() }
)
}
}
- test("homo_sapiens - paired_end - arriba") {
+ test("homo_sapiens - paired_end - arriba - stub") {
+ options "-stub"
config "./nextflow.arriba.config"
+ setup {
+ run("STAR_GENOMEGENERATE") {
+ script "../../../star/genomegenerate/main.nf"
+ process {
+ """
+ input[0] = Channel.of([
+ [ id:'test_fasta' ],
+ [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) ]
+ ])
+ input[1] = Channel.of([
+ [ id:'test_gtf' ],
+ [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true) ]
+ ])
+ """
+ }
+ }
+ }
+
when {
process {
"""
@@ -143,29 +491,33 @@ nextflow_process {
then {
assertAll(
{ assert process.success },
- { assert snapshot(file(process.out.log_final[0][1]).name).match("homo_sapiens - paired_end - arriba - log_final") },
- { assert snapshot(file(process.out.log_out[0][1]).name).match("homo_sapiens - paired_end - arriba - log_out") },
- { assert snapshot(file(process.out.log_progress[0][1]).name).match("homo_sapiens - paired_end - arriba - log_progress") },
- { assert snapshot(process.out.bam).match("homo_sapiens - paired_end - arriba - bam") },
- { assert snapshot(process.out.bam_sorted).match("homo_sapiens - paired_end - arriba - bam_sorted") },
- { assert snapshot(process.out.bam_transcript).match("homo_sapiens - paired_end - arriba - bam_transcript") },
- { assert snapshot(process.out.bam_unsorted).match("homo_sapiens - paired_end - arriba - bam_unsorted") },
- { assert snapshot(process.out.bedgraph).match("homo_sapiens - paired_end - arriba - bedgraph") },
- { assert snapshot(process.out.fastq).match("homo_sapiens - paired_end - arriba - fastq") },
- { assert snapshot(process.out.junction).match("homo_sapiens - paired_end - arriba - junction") },
- { assert snapshot(process.out.read_per_gene_tab).match("homo_sapiens - paired_end - arriba - read_per_gene_tab") },
- { assert snapshot(process.out.sam).match("homo_sapiens - paired_end - arriba - sam") },
- { assert snapshot(process.out.spl_junc_tab).match("homo_sapiens - paired_end - arriba - spl_junc_tab") },
- { assert snapshot(process.out.tab).match("homo_sapiens - paired_end - arriba - tab") },
- { assert snapshot(process.out.wig).match("homo_sapiens - paired_end - arriba - wig") },
- { assert snapshot(process.out.versions).match("homo_sapiens - paired_end - arriba - versions") }
+ { assert snapshot(process.out).match() }
)
}
}
- test("homo_sapiens - paired_end - starfusion") {
+ test("homo_sapiens - paired_end - starfusion - stub") {
+ options "-stub"
config "./nextflow.starfusion.config"
+ setup {
+ run("STAR_GENOMEGENERATE") {
+ script "../../../star/genomegenerate/main.nf"
+ process {
+ """
+ input[0] = Channel.of([
+ [ id:'test_fasta' ],
+ [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) ]
+ ])
+ input[1] = Channel.of([
+ [ id:'test_gtf' ],
+ [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true) ]
+ ])
+ """
+ }
+ }
+ }
+
when {
process {
"""
@@ -191,29 +543,33 @@ nextflow_process {
then {
assertAll(
{ assert process.success },
- { assert snapshot(file(process.out.log_final[0][1]).name).match("homo_sapiens - paired_end - starfusion - log_final") },
- { assert snapshot(file(process.out.log_out[0][1]).name).match("homo_sapiens - paired_end - starfusion - log_out") },
- { assert snapshot(file(process.out.log_progress[0][1]).name).match("homo_sapiens - paired_end - starfusion - log_progress") },
- { assert snapshot(process.out.bam).match("homo_sapiens - paired_end - starfusion - bam") },
- { assert snapshot(process.out.bam_sorted).match("homo_sapiens - paired_end - starfusion - bam_sorted") },
- { assert snapshot(process.out.bam_transcript).match("homo_sapiens - paired_end - starfusion - bam_transcript") },
- { assert snapshot(process.out.bam_unsorted).match("homo_sapiens - paired_end - starfusion - bam_unsorted") },
- { assert snapshot(process.out.bedgraph).match("homo_sapiens - paired_end - starfusion - bedgraph") },
- { assert snapshot(process.out.fastq).match("homo_sapiens - paired_end - starfusion - fastq") },
- { assert snapshot(process.out.junction).match("homo_sapiens - paired_end - starfusion - junction") },
- { assert snapshot(process.out.read_per_gene_tab).match("homo_sapiens - paired_end - starfusion - read_per_gene_tab") },
- { assert snapshot(process.out.sam).match("homo_sapiens - paired_end - starfusion - sam") },
- { assert snapshot(process.out.spl_junc_tab).match("homo_sapiens - paired_end - starfusion - spl_junc_tab") },
- { assert snapshot(process.out.tab).match("homo_sapiens - paired_end - starfusion - tab") },
- { assert snapshot(process.out.wig).match("homo_sapiens - paired_end - starfusion - wig") },
- { assert snapshot(process.out.versions).match("homo_sapiens - paired_end - starfusion - versions") }
+ { assert snapshot(process.out).match() }
)
}
}
- test("homo_sapiens - paired_end - multiple") {
+ test("homo_sapiens - paired_end - multiple - stub") {
+ options "-stub"
config "./nextflow.config"
+ setup {
+ run("STAR_GENOMEGENERATE") {
+ script "../../../star/genomegenerate/main.nf"
+ process {
+ """
+ input[0] = Channel.of([
+ [ id:'test_fasta' ],
+ [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) ]
+ ])
+ input[1] = Channel.of([
+ [ id:'test_gtf' ],
+ [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true) ]
+ ])
+ """
+ }
+ }
+ }
+
when {
process {
"""
@@ -241,22 +597,7 @@ nextflow_process {
then {
assertAll(
{ assert process.success },
- { assert snapshot(file(process.out.log_final[0][1]).name).match("homo_sapiens - paired_end - multiple - log_final") },
- { assert snapshot(file(process.out.log_out[0][1]).name).match("homo_sapiens - paired_end - multiple - log_out") },
- { assert snapshot(file(process.out.log_progress[0][1]).name).match("homo_sapiens - paired_end - multiple - log_progress") },
- { assert snapshot(process.out.bam).match("homo_sapiens - paired_end - multiple - bam") },
- { assert snapshot(process.out.bam_sorted).match("homo_sapiens - paired_end - multiple - bam_sorted") },
- { assert snapshot(process.out.bam_transcript).match("homo_sapiens - paired_end - multiple - bam_transcript") },
- { assert snapshot(process.out.bam_unsorted).match("homo_sapiens - paired_end - multiple - bam_unsorted") },
- { assert snapshot(process.out.bedgraph).match("homo_sapiens - paired_end - multiple - bedgraph") },
- { assert snapshot(process.out.fastq).match("homo_sapiens - paired_end - multiple - fastq") },
- { assert snapshot(process.out.junction).match("homo_sapiens - paired_end - multiple - junction") },
- { assert snapshot(process.out.read_per_gene_tab).match("homo_sapiens - paired_end - multiple - read_per_gene_tab") },
- { assert snapshot(process.out.sam).match("homo_sapiens - paired_end - multiple - sam") },
- { assert snapshot(process.out.spl_junc_tab).match("homo_sapiens - paired_end - multiple - spl_junc_tab") },
- { assert snapshot(process.out.tab).match("homo_sapiens - paired_end - multiple - tab") },
- { assert snapshot(process.out.wig).match("homo_sapiens - paired_end - multiple - wig") },
- { assert snapshot(process.out.versions).match("homo_sapiens - paired_end - multiple - versions") }
+ { assert snapshot(process.out).match() }
)
}
}
diff --git a/modules/nf-core/star/align/tests/main.nf.test.snap b/modules/nf-core/star/align/tests/main.nf.test.snap
index 08edb914b..c814eb56c 100644
--- a/modules/nf-core/star/align/tests/main.nf.test.snap
+++ b/modules/nf-core/star/align/tests/main.nf.test.snap
@@ -1,382 +1,1170 @@
{
- "homo_sapiens - paired_end - multiple - bam_sorted": {
+ "homo_sapiens - single_end - stub": {
"content": [
- [
- [
- {
- "id": "test",
- "single_end": false
- },
- "test.Aligned.sortedByCoord.out.bam:md5,ab07c21d63ab0a6c07d171d213c81d5a"
+ {
+ "0": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.Log.final.out:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "1": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.Log.out:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "10": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.SJ.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "11": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.ReadsPerGene.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "12": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.Chimeric.out.junction:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "13": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.out.sam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "14": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.Signal.UniqueMultiple.str1.out.wig:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "15": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.Signal.UniqueMultiple.str1.out.bg:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "2": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.Log.progress.out:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "3": [
+ "versions.yml:md5,2e6b6d8809f5a17f38f4d27c45dcb22f"
+ ],
+ "4": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ [
+ "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "testXd.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ ],
+ "5": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ [
+ "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ ],
+ "6": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.toTranscriptome.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "7": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.Aligned.unsort.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "8": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ [
+ "test.unmapped_1.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+ "test.unmapped_2.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ]
+ ],
+ "9": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ [
+ "test.ReadsPerGene.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.SJ.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.tab:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ ],
+ "bam": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ [
+ "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "testXd.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ ],
+ "bam_sorted": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ [
+ "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ ],
+ "bam_transcript": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.toTranscriptome.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "bam_unsorted": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.Aligned.unsort.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "bedgraph": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.Signal.UniqueMultiple.str1.out.bg:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "fastq": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ [
+ "test.unmapped_1.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+ "test.unmapped_2.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ]
+ ],
+ "junction": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.Chimeric.out.junction:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "log_final": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.Log.final.out:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "log_out": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.Log.out:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "log_progress": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.Log.progress.out:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "read_per_gene_tab": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.ReadsPerGene.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "sam": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.out.sam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "spl_junc_tab": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.SJ.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "tab": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ [
+ "test.ReadsPerGene.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.SJ.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.tab:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ ],
+ "versions": [
+ "versions.yml:md5,2e6b6d8809f5a17f38f4d27c45dcb22f"
+ ],
+ "wig": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.Signal.UniqueMultiple.str1.out.wig:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
]
- ]
+ }
],
- "timestamp": "2023-12-04T18:01:19.968225733"
+ "meta": {
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
+ },
+ "timestamp": "2024-07-22T15:16:04.712114"
},
- "homo_sapiens - paired_end - multiple - wig": {
+ "homo_sapiens - paired_end - arriba - stub": {
"content": [
- [
-
- ]
+ {
+ "0": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Log.final.out:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "1": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Log.out:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "10": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.SJ.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "11": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.ReadsPerGene.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "12": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Chimeric.out.junction:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "13": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.out.sam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "14": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Signal.UniqueMultiple.str1.out.wig:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "15": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Signal.UniqueMultiple.str1.out.bg:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "2": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Log.progress.out:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "3": [
+ "versions.yml:md5,2e6b6d8809f5a17f38f4d27c45dcb22f"
+ ],
+ "4": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "testXd.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ ],
+ "5": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ ],
+ "6": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.toTranscriptome.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "7": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Aligned.unsort.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "8": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test.unmapped_1.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+ "test.unmapped_2.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ]
+ ],
+ "9": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test.ReadsPerGene.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.SJ.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.tab:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ ],
+ "bam": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "testXd.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ ],
+ "bam_sorted": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ ],
+ "bam_transcript": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.toTranscriptome.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "bam_unsorted": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Aligned.unsort.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "bedgraph": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Signal.UniqueMultiple.str1.out.bg:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "fastq": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test.unmapped_1.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+ "test.unmapped_2.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ]
+ ],
+ "junction": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Chimeric.out.junction:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "log_final": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Log.final.out:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "log_out": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Log.out:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "log_progress": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Log.progress.out:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "read_per_gene_tab": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.ReadsPerGene.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "sam": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.out.sam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "spl_junc_tab": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.SJ.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "tab": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test.ReadsPerGene.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.SJ.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.tab:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ ],
+ "versions": [
+ "versions.yml:md5,2e6b6d8809f5a17f38f4d27c45dcb22f"
+ ],
+ "wig": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Signal.UniqueMultiple.str1.out.wig:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ }
],
- "timestamp": "2023-11-23T13:29:01.857804"
+ "meta": {
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
+ },
+ "timestamp": "2024-07-22T15:16:28.874293"
},
- "homo_sapiens - paired_end - arriba - tab": {
+ "homo_sapiens - single_end": {
"content": [
+ "test.Log.final.out",
+ "test.Log.out",
+ "test.Log.progress.out",
[
[
{
"id": "test",
- "single_end": false
+ "single_end": true
},
- "test.SJ.out.tab:md5,5155c9fd1f787ad6d7d80987fb06219c"
+ "test.Aligned.sortedByCoord.out.bam:md5,c6cfaccaf91bc7fdabed3cfe236d4535"
]
- ]
- ],
- "timestamp": "2023-12-04T17:56:12.347549723"
- },
- "homo_sapiens - single_end - wig": {
- "content": [
+ ],
[
-
- ]
- ],
- "timestamp": "2023-11-23T13:22:55.24701"
- },
- "homo_sapiens - paired_end - sam": {
- "content": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.Aligned.sortedByCoord.out.bam:md5,c6cfaccaf91bc7fdabed3cfe236d4535"
+ ]
+ ],
[
- ]
- ],
- "timestamp": "2023-11-23T13:23:33.383818"
- },
- "homo_sapiens - paired_end - arriba - versions": {
- "content": [
+ ],
[
- "versions.yml:md5,2e6b6d8809f5a17f38f4d27c45dcb22f"
- ]
- ],
- "timestamp": "2023-12-04T17:56:12.431212643"
- },
- "homo_sapiens - paired_end - multiple - bedgraph": {
- "content": [
+
+ ],
[
[
{
"id": "test",
- "single_end": false
+ "single_end": true
},
[
- "test.Signal.Unique.str1.out.bg:md5,d7bf8b70b436ca048a62513e1d0ece3a",
- "test.Signal.UniqueMultiple.str1.out.bg:md5,686d58493b9eb445b56ace4d67f76ef6"
+ "test.Signal.Unique.str1.out.bg:md5,c56fc1472776fb927eaf62d973da5f9a",
+ "test.Signal.UniqueMultiple.str1.out.bg:md5,e93373cf6f2a2a9506e2efdb260cdd4f"
]
]
- ]
- ],
- "timestamp": "2023-12-04T18:01:20.07119229"
- },
- "homo_sapiens - paired_end - read_per_gene_tab": {
- "content": [
+ ],
[
- ]
- ],
- "timestamp": "2023-11-23T13:23:33.368841"
- },
- "homo_sapiens - paired_end - arriba - bedgraph": {
- "content": [
+ ],
[
- ]
- ],
- "timestamp": "2023-11-23T13:25:07.102537"
- },
- "homo_sapiens - single_end - junction": {
- "content": [
+ ],
[
- ]
- ],
- "timestamp": "2023-11-23T13:22:55.185369"
- },
- "homo_sapiens - paired_end - arriba - spl_junc_tab": {
- "content": [
+ ],
+ [
+
+ ],
[
[
{
"id": "test",
- "single_end": false
+ "single_end": true
},
- "test.SJ.out.tab:md5,5155c9fd1f787ad6d7d80987fb06219c"
+ "test.SJ.out.tab:md5,75a516ab950fb958f40b29996474949c"
]
- ]
- ],
- "timestamp": "2023-12-04T17:56:12.268388251"
- },
- "homo_sapiens - single_end - sam": {
- "content": [
+ ],
[
-
- ]
- ],
- "timestamp": "2023-11-23T13:22:55.216183"
- },
- "homo_sapiens - paired_end - fastq": {
- "content": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.SJ.out.tab:md5,75a516ab950fb958f40b29996474949c"
+ ]
+ ],
[
- ]
- ],
- "timestamp": "2023-11-23T13:23:33.327236"
- },
- "homo_sapiens - single_end - versions": {
- "content": [
+ ],
[
"versions.yml:md5,2e6b6d8809f5a17f38f4d27c45dcb22f"
]
],
- "timestamp": "2023-12-04T17:53:26.664210196"
- },
- "homo_sapiens - paired_end - multiple - log_out": {
- "content": [
- "test.Log.out"
- ],
- "timestamp": "2023-11-23T13:29:01.022176"
- },
- "homo_sapiens - paired_end - arriba - fastq": {
- "content": [
- [
-
- ]
- ],
- "timestamp": "2023-11-23T13:25:07.15277"
- },
- "homo_sapiens - paired_end - multiple - junction": {
- "content": [
- [
-
- ]
- ],
- "timestamp": "2023-11-23T13:29:01.52923"
+ "meta": {
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
+ },
+ "timestamp": "2024-07-22T18:02:34.35338"
},
- "homo_sapiens - paired_end - multiple - spl_junc_tab": {
+ "homo_sapiens - paired_end": {
"content": [
+ "test.Log.final.out",
+ "test.Log.out",
+ "test.Log.progress.out",
[
[
{
"id": "test",
"single_end": false
},
- "test.SJ.out.tab:md5,069877e053714e23010fe4e1c003b4a2"
+ "test.Aligned.sortedByCoord.out.bam:md5,b9ee1c607e07323bc1652ef3babb543f"
]
- ]
- ],
- "timestamp": "2023-12-04T18:01:20.189486201"
- },
- "homo_sapiens - paired_end - starfusion - log_final": {
- "content": [
- "test.Log.final.out"
- ],
- "timestamp": "2023-11-23T13:27:55.905883"
- },
- "homo_sapiens - paired_end - starfusion - fastq": {
- "content": [
- [
-
- ]
- ],
- "timestamp": "2023-11-23T13:27:56.192302"
- },
- "homo_sapiens - paired_end - multiple - sam": {
- "content": [
- [
-
- ]
- ],
- "timestamp": "2023-11-23T13:29:01.661837"
- },
- "homo_sapiens - paired_end - multiple - log_final": {
- "content": [
- "test.Log.final.out"
- ],
- "timestamp": "2023-11-23T13:29:00.966417"
- },
- "homo_sapiens - paired_end - starfusion - bam": {
- "content": [
+ ],
[
[
{
"id": "test",
"single_end": false
},
- "test.Aligned.out.bam:md5,bcad07b838f6762fc01eea52b5cd3f84"
+ "test.Aligned.sortedByCoord.out.bam:md5,b9ee1c607e07323bc1652ef3babb543f"
]
- ]
- ],
- "timestamp": "2023-12-04T17:59:58.53235164"
- },
- "homo_sapiens - paired_end - arriba - junction": {
- "content": [
+ ],
[
- ]
- ],
- "timestamp": "2023-11-23T13:25:07.202776"
- },
- "homo_sapiens - single_end - bedgraph": {
- "content": [
+ ],
+ [
+
+ ],
[
[
{
"id": "test",
- "single_end": true
+ "single_end": false
},
[
- "test.Signal.Unique.str1.out.bg:md5,c56fc1472776fb927eaf62d973da5f9a",
- "test.Signal.UniqueMultiple.str1.out.bg:md5,e93373cf6f2a2a9506e2efdb260cdd4f"
+ "test.Signal.Unique.str1.out.bg:md5,d7bf8b70b436ca048a62513e1d0ece3a",
+ "test.Signal.UniqueMultiple.str1.out.bg:md5,686d58493b9eb445b56ace4d67f76ef6"
]
]
- ]
- ],
- "timestamp": "2023-12-04T17:53:26.394863748"
- },
- "homo_sapiens - paired_end - arriba - read_per_gene_tab": {
- "content": [
+ ],
[
- ]
- ],
- "timestamp": "2023-11-23T13:25:07.251962"
- },
- "homo_sapiens - paired_end - starfusion - bam_sorted": {
- "content": [
+ ],
[
- ]
- ],
- "timestamp": "2023-11-23T13:27:56.040843"
- },
- "homo_sapiens - single_end - bam_unsorted": {
- "content": [
+ ],
[
- ]
- ],
- "timestamp": "2023-11-23T13:22:55.154172"
- },
- "homo_sapiens - paired_end - bam": {
- "content": [
+ ],
+ [
+
+ ],
[
[
{
"id": "test",
"single_end": false
},
- "test.Aligned.sortedByCoord.out.bam:md5,b9ee1c607e07323bc1652ef3babb543f"
+ "test.SJ.out.tab:md5,844af19ab0fc8cd9a3f75228445aca0d"
]
- ]
- ],
- "timestamp": "2023-12-04T17:54:11.934832258"
- },
- "homo_sapiens - paired_end - arriba - bam_transcript": {
- "content": [
+ ],
+ [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.SJ.out.tab:md5,844af19ab0fc8cd9a3f75228445aca0d"
+ ]
+ ],
[
- ]
- ],
- "timestamp": "2023-11-23T13:25:06.998817"
- },
- "homo_sapiens - paired_end - log_out": {
- "content": [
- "test.Log.out"
- ],
- "timestamp": "2023-11-23T13:23:33.259699"
- },
- "homo_sapiens - paired_end - arriba - log_out": {
- "content": [
- "test.Log.out"
- ],
- "timestamp": "2023-11-23T13:25:06.849451"
- },
- "homo_sapiens - paired_end - multiple - versions": {
- "content": [
+ ],
[
"versions.yml:md5,2e6b6d8809f5a17f38f4d27c45dcb22f"
]
],
- "timestamp": "2023-12-04T18:01:20.393705142"
+ "meta": {
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
+ },
+ "timestamp": "2024-07-22T18:03:16.701923"
},
- "homo_sapiens - paired_end - starfusion - bam_transcript": {
+ "homo_sapiens - paired_end - multiple - stub": {
"content": [
- [
-
- ]
+ {
+ "0": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Log.final.out:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "1": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Log.out:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "10": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.SJ.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "11": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.ReadsPerGene.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "12": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Chimeric.out.junction:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "13": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.out.sam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "14": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Signal.UniqueMultiple.str1.out.wig:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "15": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Signal.UniqueMultiple.str1.out.bg:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "2": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Log.progress.out:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "3": [
+ "versions.yml:md5,2e6b6d8809f5a17f38f4d27c45dcb22f"
+ ],
+ "4": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "testXd.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ ],
+ "5": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ ],
+ "6": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.toTranscriptome.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "7": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Aligned.unsort.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "8": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test.unmapped_1.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+ "test.unmapped_2.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ]
+ ],
+ "9": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test.ReadsPerGene.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.SJ.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.tab:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ ],
+ "bam": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "testXd.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ ],
+ "bam_sorted": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ ],
+ "bam_transcript": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.toTranscriptome.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "bam_unsorted": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Aligned.unsort.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "bedgraph": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Signal.UniqueMultiple.str1.out.bg:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "fastq": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test.unmapped_1.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+ "test.unmapped_2.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ]
+ ],
+ "junction": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Chimeric.out.junction:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "log_final": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Log.final.out:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "log_out": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Log.out:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "log_progress": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Log.progress.out:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "read_per_gene_tab": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.ReadsPerGene.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "sam": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.out.sam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "spl_junc_tab": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.SJ.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "tab": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test.ReadsPerGene.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.SJ.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.tab:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ ],
+ "versions": [
+ "versions.yml:md5,2e6b6d8809f5a17f38f4d27c45dcb22f"
+ ],
+ "wig": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Signal.UniqueMultiple.str1.out.wig:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ }
],
- "timestamp": "2023-11-23T13:27:56.082408"
+ "meta": {
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
+ },
+ "timestamp": "2024-07-22T15:16:51.360287"
},
- "homo_sapiens - paired_end - starfusion - tab": {
+ "homo_sapiens - paired_end - multiple": {
"content": [
+ "test.Log.final.out",
+ "test.Log.out",
+ "test.Log.progress.out",
[
[
{
"id": "test",
"single_end": false
},
- "test.SJ.out.tab:md5,19c3faa1bfa9a0cc5e4c45f17065b53a"
+ "test.Aligned.sortedByCoord.out.bam:md5,ab07c21d63ab0a6c07d171d213c81d5a"
]
- ]
- ],
- "timestamp": "2023-12-04T17:59:58.818041322"
- },
- "homo_sapiens - single_end - fastq": {
- "content": [
+ ],
+ [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Aligned.sortedByCoord.out.bam:md5,ab07c21d63ab0a6c07d171d213c81d5a"
+ ]
+ ],
[
- ]
- ],
- "timestamp": "2023-11-23T13:22:55.175307"
- },
- "homo_sapiens - paired_end - tab": {
- "content": [
+ ],
+ [
+
+ ],
[
[
{
"id": "test",
"single_end": false
},
- "test.SJ.out.tab:md5,844af19ab0fc8cd9a3f75228445aca0d"
+ [
+ "test.Signal.Unique.str1.out.bg:md5,d7bf8b70b436ca048a62513e1d0ece3a",
+ "test.Signal.UniqueMultiple.str1.out.bg:md5,686d58493b9eb445b56ace4d67f76ef6"
+ ]
]
- ]
- ],
- "timestamp": "2023-12-04T17:54:12.255481058"
- },
- "homo_sapiens - paired_end - starfusion - bedgraph": {
- "content": [
+ ],
[
- ]
- ],
- "timestamp": "2023-11-23T13:27:56.155413"
- },
- "homo_sapiens - single_end - bam_transcript": {
- "content": [
+ ],
[
- ]
- ],
- "timestamp": "2023-11-23T13:22:55.144852"
- },
- "homo_sapiens - paired_end - versions": {
- "content": [
+ ],
[
- "versions.yml:md5,2e6b6d8809f5a17f38f4d27c45dcb22f"
- ]
- ],
- "timestamp": "2023-12-04T17:54:12.343840482"
- },
- "homo_sapiens - paired_end - multiple - tab": {
- "content": [
+
+ ],
+ [
+
+ ],
[
[
{
@@ -385,385 +1173,801 @@
},
"test.SJ.out.tab:md5,069877e053714e23010fe4e1c003b4a2"
]
- ]
- ],
- "timestamp": "2023-12-04T18:01:20.291692062"
- },
- "homo_sapiens - single_end - bam": {
- "content": [
+ ],
[
[
{
"id": "test",
- "single_end": true
+ "single_end": false
},
- "test.Aligned.sortedByCoord.out.bam:md5,c6cfaccaf91bc7fdabed3cfe236d4535"
+ "test.SJ.out.tab:md5,069877e053714e23010fe4e1c003b4a2"
]
- ]
- ],
- "timestamp": "2023-12-04T17:53:26.265642675"
- },
- "homo_sapiens - paired_end - arriba - wig": {
- "content": [
+ ],
[
+ ],
+ [
+ "versions.yml:md5,2e6b6d8809f5a17f38f4d27c45dcb22f"
]
],
- "timestamp": "2023-11-23T13:25:07.444214"
+ "meta": {
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
+ },
+ "timestamp": "2024-07-22T13:13:28.987438"
},
- "homo_sapiens - paired_end - log_progress": {
+ "homo_sapiens - paired_end - stub": {
"content": [
- [
- [
- {
- "id": "test",
- "single_end": false
- },
- "test.Log.progress.out:md5,b2bd061d6cbaaf3d6d3b1fed547f69b8"
+ {
+ "0": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Log.final.out:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "1": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Log.out:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "10": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.SJ.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "11": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.ReadsPerGene.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "12": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Chimeric.out.junction:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "13": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.out.sam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "14": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Signal.UniqueMultiple.str1.out.wig:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "15": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Signal.UniqueMultiple.str1.out.bg:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "2": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Log.progress.out:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "3": [
+ "versions.yml:md5,2e6b6d8809f5a17f38f4d27c45dcb22f"
+ ],
+ "4": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "testXd.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ ],
+ "5": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ ],
+ "6": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.toTranscriptome.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "7": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Aligned.unsort.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "8": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test.unmapped_1.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+ "test.unmapped_2.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ]
+ ],
+ "9": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test.ReadsPerGene.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.SJ.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.tab:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ ],
+ "bam": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "testXd.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ ],
+ "bam_sorted": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ ],
+ "bam_transcript": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.toTranscriptome.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "bam_unsorted": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Aligned.unsort.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "bedgraph": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Signal.UniqueMultiple.str1.out.bg:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "fastq": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test.unmapped_1.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+ "test.unmapped_2.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ]
+ ],
+ "junction": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Chimeric.out.junction:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "log_final": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Log.final.out:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "log_out": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Log.out:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "log_progress": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Log.progress.out:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "read_per_gene_tab": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.ReadsPerGene.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "sam": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.out.sam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "spl_junc_tab": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.SJ.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "tab": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test.ReadsPerGene.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.SJ.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.tab:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ ],
+ "versions": [
+ "versions.yml:md5,2e6b6d8809f5a17f38f4d27c45dcb22f"
+ ],
+ "wig": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Signal.UniqueMultiple.str1.out.wig:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
]
- ]
- ],
- "timestamp": "2023-12-04T17:54:12.126063825"
- },
- "homo_sapiens - paired_end - arriba - log_final": {
- "content": [
- "test.Log.final.out"
- ],
- "timestamp": "2023-11-23T13:25:06.829799"
- },
- "homo_sapiens - paired_end - bam_unsorted": {
- "content": [
- [
-
- ]
- ],
- "timestamp": "2023-11-23T13:23:33.300509"
- },
- "homo_sapiens - paired_end - arriba - sam": {
- "content": [
- [
-
- ]
+ }
],
- "timestamp": "2023-11-23T13:25:07.300383"
+ "meta": {
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
+ },
+ "timestamp": "2024-07-22T15:16:16.798018"
},
- "homo_sapiens - paired_end - multiple - bam": {
+ "homo_sapiens - paired_end - starfusion": {
"content": [
+ "test.Log.final.out",
+ "test.Log.out",
+ "test.Log.progress.out",
[
[
{
"id": "test",
"single_end": false
},
- "test.Aligned.sortedByCoord.out.bam:md5,ab07c21d63ab0a6c07d171d213c81d5a"
+ "test.Aligned.out.bam:md5,bcad07b838f6762fc01eea52b5cd3f84"
]
- ]
- ],
- "timestamp": "2023-12-04T18:01:19.851247126"
- },
- "homo_sapiens - paired_end - multiple - fastq": {
- "content": [
+ ],
[
- ]
- ],
- "timestamp": "2023-11-23T13:29:01.462257"
- },
- "homo_sapiens - single_end - bam_sorted": {
- "content": [
- [
- [
- {
- "id": "test",
- "single_end": true
- },
- "test.Aligned.sortedByCoord.out.bam:md5,c6cfaccaf91bc7fdabed3cfe236d4535"
- ]
- ]
- ],
- "timestamp": "2023-12-04T17:53:26.335457371"
- },
- "homo_sapiens - paired_end - arriba - bam_sorted": {
- "content": [
+ ],
[
- ]
- ],
- "timestamp": "2023-11-23T13:25:06.94699"
- },
- "homo_sapiens - paired_end - starfusion - junction": {
- "content": [
- [
- [
- {
- "id": "test",
- "single_end": false
- },
- "test.Chimeric.out.junction:md5,c10ef219f4a30e83711b995bc5e40dba"
- ]
- ]
- ],
- "timestamp": "2023-12-04T17:59:58.641115828"
- },
- "homo_sapiens - single_end - tab": {
- "content": [
+ ],
[
- [
- {
- "id": "test",
- "single_end": true
- },
- "test.SJ.out.tab:md5,75a516ab950fb958f40b29996474949c"
- ]
- ]
- ],
- "timestamp": "2023-12-04T17:53:26.580593434"
- },
- "homo_sapiens - paired_end - starfusion - versions": {
- "content": [
+
+ ],
[
- "versions.yml:md5,2e6b6d8809f5a17f38f4d27c45dcb22f"
- ]
- ],
- "timestamp": "2023-12-04T17:59:58.907317103"
- },
- "homo_sapiens - paired_end - multiple - bam_unsorted": {
- "content": [
+
+ ],
[
- ]
- ],
- "timestamp": "2023-11-23T13:29:01.330463"
- },
- "homo_sapiens - paired_end - arriba - log_progress": {
- "content": [
- "test.Log.progress.out"
- ],
- "timestamp": "2023-11-23T13:25:06.86866"
- },
- "homo_sapiens - paired_end - bedgraph": {
- "content": [
+ ],
[
[
{
"id": "test",
"single_end": false
},
- [
- "test.Signal.Unique.str1.out.bg:md5,d7bf8b70b436ca048a62513e1d0ece3a",
- "test.Signal.UniqueMultiple.str1.out.bg:md5,686d58493b9eb445b56ace4d67f76ef6"
- ]
+ "test.Chimeric.out.junction:md5,c10ef219f4a30e83711b995bc5e40dba"
]
- ]
- ],
- "timestamp": "2023-12-04T17:54:12.064121304"
- },
- "homo_sapiens - paired_end - starfusion - bam_unsorted": {
- "content": [
- [
-
- ]
- ],
- "timestamp": "2023-11-23T13:27:56.118974"
- },
- "homo_sapiens - paired_end - starfusion - read_per_gene_tab": {
- "content": [
+ ],
[
- ]
- ],
- "timestamp": "2023-11-23T13:27:56.264699"
- },
- "homo_sapiens - paired_end - multiple - log_progress": {
- "content": [
- "test.Log.progress.out"
- ],
- "timestamp": "2023-11-23T13:29:01.076947"
- },
- "homo_sapiens - paired_end - arriba - bam_unsorted": {
- "content": [
+ ],
[
- ]
- ],
- "timestamp": "2023-11-23T13:25:07.050409"
- },
- "homo_sapiens - paired_end - bam_sorted": {
- "content": [
+ ],
[
[
{
"id": "test",
"single_end": false
},
- "test.Aligned.sortedByCoord.out.bam:md5,b9ee1c607e07323bc1652ef3babb543f"
+ "test.SJ.out.tab:md5,19c3faa1bfa9a0cc5e4c45f17065b53a"
]
- ]
- ],
- "timestamp": "2023-12-04T17:54:12.002180537"
- },
- "homo_sapiens - single_end - spl_junc_tab": {
- "content": [
+ ],
[
[
{
"id": "test",
- "single_end": true
+ "single_end": false
},
- "test.SJ.out.tab:md5,75a516ab950fb958f40b29996474949c"
+ "test.SJ.out.tab:md5,19c3faa1bfa9a0cc5e4c45f17065b53a"
]
+ ],
+ [
+
+ ],
+ [
+ "versions.yml:md5,2e6b6d8809f5a17f38f4d27c45dcb22f"
]
],
- "timestamp": "2023-12-04T17:53:26.50932751"
+ "meta": {
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
+ },
+ "timestamp": "2024-07-22T13:10:55.371956"
},
- "homo_sapiens - paired_end - starfusion - spl_junc_tab": {
+ "homo_sapiens - paired_end - arriba": {
"content": [
+ "test.Log.final.out",
+ "test.Log.out",
+ "test.Log.progress.out",
[
[
{
"id": "test",
"single_end": false
},
- "test.SJ.out.tab:md5,19c3faa1bfa9a0cc5e4c45f17065b53a"
+ "test.Aligned.out.bam:md5,c1b1747f5873f2d17762725636e891d5"
]
- ]
- ],
- "timestamp": "2023-12-04T17:59:58.731699486"
- },
- "homo_sapiens - single_end - log_out": {
- "content": [
- "test.Log.out"
- ],
- "timestamp": "2023-11-23T13:22:55.126286"
- },
- "homo_sapiens - paired_end - log_final": {
- "content": [
- "test.Log.final.out"
- ],
- "timestamp": "2023-11-23T13:23:33.253884"
- },
- "homo_sapiens - single_end - log_final": {
- "content": [
- "test.Log.final.out"
- ],
- "timestamp": "2023-11-23T13:22:55.11799"
- },
- "homo_sapiens - paired_end - bam_transcript": {
- "content": [
+ ],
[
- ]
- ],
- "timestamp": "2023-11-23T13:23:33.287684"
- },
- "homo_sapiens - paired_end - starfusion - log_progress": {
- "content": [
- "test.Log.progress.out"
- ],
- "timestamp": "2023-11-23T13:27:55.971484"
- },
- "homo_sapiens - paired_end - multiple - bam_transcript": {
- "content": [
+ ],
[
- ]
- ],
- "timestamp": "2023-11-23T13:29:01.264176"
- },
- "homo_sapiens - paired_end - multiple - read_per_gene_tab": {
- "content": [
+ ],
[
- ]
- ],
- "timestamp": "2023-11-23T13:29:01.596406"
- },
- "homo_sapiens - single_end - read_per_gene_tab": {
- "content": [
+ ],
[
- ]
- ],
- "timestamp": "2023-11-23T13:22:55.205936"
- },
- "homo_sapiens - paired_end - junction": {
- "content": [
+ ],
[
- ]
- ],
- "timestamp": "2023-11-23T13:23:33.340653"
- },
- "homo_sapiens - paired_end - spl_junc_tab": {
- "content": [
+ ],
[
- [
- {
- "id": "test",
- "single_end": false
- },
- "test.SJ.out.tab:md5,844af19ab0fc8cd9a3f75228445aca0d"
- ]
- ]
- ],
- "timestamp": "2023-12-04T17:54:12.185730856"
- },
- "homo_sapiens - paired_end - starfusion - sam": {
- "content": [
+
+ ],
[
- ]
- ],
- "timestamp": "2023-11-23T13:27:56.300637"
- },
- "homo_sapiens - paired_end - arriba - bam": {
- "content": [
+ ],
+ [
+
+ ],
[
[
{
"id": "test",
"single_end": false
},
- "test.Aligned.out.bam:md5,c1b1747f5873f2d17762725636e891d5"
+ "test.SJ.out.tab:md5,5155c9fd1f787ad6d7d80987fb06219c"
]
- ]
- ],
- "timestamp": "2023-12-04T17:56:12.190560178"
- },
- "homo_sapiens - single_end - log_progress": {
- "content": [
+ ],
[
[
{
"id": "test",
- "single_end": true
+ "single_end": false
},
- "test.Log.progress.out:md5,b2bd061d6cbaaf3d6d3b1fed547f69b8"
+ "test.SJ.out.tab:md5,5155c9fd1f787ad6d7d80987fb06219c"
]
- ]
- ],
- "timestamp": "2023-12-04T17:53:26.450352138"
- },
- "homo_sapiens - paired_end - starfusion - wig": {
- "content": [
+ ],
[
- ]
- ],
- "timestamp": "2023-11-23T13:27:56.422018"
- },
- "homo_sapiens - paired_end - wig": {
- "content": [
+ ],
[
-
+ "versions.yml:md5,2e6b6d8809f5a17f38f4d27c45dcb22f"
]
],
- "timestamp": "2023-11-23T13:23:33.429457"
+ "meta": {
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
+ },
+ "timestamp": "2024-07-22T13:05:10.7534"
},
- "homo_sapiens - paired_end - starfusion - log_out": {
+ "homo_sapiens - paired_end - starfusion - stub": {
"content": [
- "test.Log.out"
+ {
+ "0": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Log.final.out:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "1": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Log.out:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "10": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.SJ.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "11": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.ReadsPerGene.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "12": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Chimeric.out.junction:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "13": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.out.sam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "14": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Signal.UniqueMultiple.str1.out.wig:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "15": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Signal.UniqueMultiple.str1.out.bg:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "2": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Log.progress.out:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "3": [
+ "versions.yml:md5,2e6b6d8809f5a17f38f4d27c45dcb22f"
+ ],
+ "4": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "testXd.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ ],
+ "5": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ ],
+ "6": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.toTranscriptome.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "7": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Aligned.unsort.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "8": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test.unmapped_1.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+ "test.unmapped_2.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ]
+ ],
+ "9": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test.ReadsPerGene.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.SJ.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.tab:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ ],
+ "bam": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "testXd.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ ],
+ "bam_sorted": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ ],
+ "bam_transcript": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.toTranscriptome.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "bam_unsorted": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Aligned.unsort.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "bedgraph": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Signal.UniqueMultiple.str1.out.bg:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "fastq": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test.unmapped_1.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+ "test.unmapped_2.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ]
+ ],
+ "junction": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Chimeric.out.junction:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "log_final": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Log.final.out:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "log_out": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Log.out:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "log_progress": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Log.progress.out:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "read_per_gene_tab": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.ReadsPerGene.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "sam": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.out.sam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "spl_junc_tab": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.SJ.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "tab": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test.ReadsPerGene.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.SJ.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.tab:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ ],
+ "versions": [
+ "versions.yml:md5,2e6b6d8809f5a17f38f4d27c45dcb22f"
+ ],
+ "wig": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Signal.UniqueMultiple.str1.out.wig:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ }
],
- "timestamp": "2023-11-23T13:27:55.93945"
+ "meta": {
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
+ },
+ "timestamp": "2024-07-22T15:16:40.64399"
}
}
\ No newline at end of file
diff --git a/modules/nf-core/star/genomegenerate/tests/main.nf.test b/modules/nf-core/star/genomegenerate/tests/main.nf.test
index 3467a3567..fed98212d 100644
--- a/modules/nf-core/star/genomegenerate/tests/main.nf.test
+++ b/modules/nf-core/star/genomegenerate/tests/main.nf.test
@@ -24,15 +24,15 @@ nextflow_process {
then {
assertAll(
{ assert process.success },
- { assert snapshot(file(process.out.index[0][1]).listFiles().collect { it.getName() }.sort().toString()).match("fasta_gtf_index") },
- { assert snapshot(process.out.versions).match("fasta_gtf_versions") }
+ { assert snapshot(
+ file(process.out.index[0][1]).listFiles().collect { it.getName() }.sort().toString(),
+ process.out.versions)
+ .match() }
)
}
}
- test("fasta_gtf_stub") {
-
- options '-stub'
+ test("fasta") {
when {
process {
@@ -41,10 +41,7 @@ nextflow_process {
[ id:'test_fasta' ],
[ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) ]
])
- input[1] = Channel.of([
- [ id:'test_gtf' ],
- [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true) ]
- ])
+ input[1] = Channel.of([ [], [] ])
"""
}
}
@@ -52,13 +49,17 @@ nextflow_process {
then {
assertAll(
{ assert process.success },
- { assert snapshot(file(process.out.index[0][1]).listFiles().collect { it.getName() }.sort().toString()).match("fasta_gtf_stub_index") },
- { assert snapshot(process.out.versions).match("fasta_gtf_stub_versions") }
+ { assert snapshot(
+ file(process.out.index[0][1]).listFiles().collect { it.getName() }.sort().toString(),
+ process.out.versions
+ ).match() }
)
}
}
- test("fasta") {
+ test("fasta_gtf_stub") {
+
+ options '-stub'
when {
process {
@@ -67,7 +68,10 @@ nextflow_process {
[ id:'test_fasta' ],
[ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) ]
])
- input[1] = Channel.of([ [], [] ])
+ input[1] = Channel.of([
+ [ id:'test_gtf' ],
+ [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true) ]
+ ])
"""
}
}
@@ -75,11 +79,9 @@ nextflow_process {
then {
assertAll(
{ assert process.success },
- { assert snapshot(file(process.out.index[0][1]).listFiles().collect { it.getName() }.sort().toString()).match("fasta_index") },
- { assert snapshot(process.out.versions).match("fasta_versions") }
+ { assert snapshot(process.out).match() }
)
}
-
}
test("fasta_stub") {
@@ -101,11 +103,8 @@ nextflow_process {
then {
assertAll(
{ assert process.success },
- { assert snapshot(file(process.out.index[0][1]).listFiles().collect { it.getName() }.sort().toString()).match("fasta_stub_index") },
- { assert snapshot(process.out.versions).match("fasta_stub_versions") }
+ { assert snapshot(process.out).match() }
)
}
-
}
-
}
diff --git a/modules/nf-core/star/genomegenerate/tests/main.nf.test.snap b/modules/nf-core/star/genomegenerate/tests/main.nf.test.snap
index 5653d6e6c..207f4b4f5 100644
--- a/modules/nf-core/star/genomegenerate/tests/main.nf.test.snap
+++ b/modules/nf-core/star/genomegenerate/tests/main.nf.test.snap
@@ -1,90 +1,148 @@
{
- "fasta_gtf_versions": {
+ "fasta_gtf": {
"content": [
+ "[Genome, Log.out, SA, SAindex, chrLength.txt, chrName.txt, chrNameLength.txt, chrStart.txt, exonGeTrInfo.tab, exonInfo.tab, geneInfo.tab, genomeParameters.txt, sjdbInfo.txt, sjdbList.fromGTF.out.tab, sjdbList.out.tab, transcriptInfo.tab]",
[
"versions.yml:md5,46b8f1f34bb7f23892cd1eb249ed4d7f"
]
],
"meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.04.3"
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
},
- "timestamp": "2024-02-01T15:54:31.798555"
+ "timestamp": "2024-07-22T14:55:35.478401"
},
- "fasta_stub_versions": {
+ "fasta_gtf_stub": {
"content": [
- [
- "versions.yml:md5,46b8f1f34bb7f23892cd1eb249ed4d7f"
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.04.3"
- },
- "timestamp": "2024-02-01T15:55:07.521209"
- },
- "fasta_gtf_stub_index": {
- "content": [
- "[Genome, Log.out, SA, SAindex, chrLength.txt, chrName.txt, chrNameLength.txt, chrStart.txt, exonGeTrInfo.tab, exonInfo.tab, geneInfo.tab, genomeParameters.txt, sjdbInfo.txt, sjdbList.fromGTF.out.tab, sjdbList.out.tab, transcriptInfo.tab]"
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.04.3"
- },
- "timestamp": "2024-02-01T15:54:46.478098"
- },
- "fasta_gtf_stub_versions": {
- "content": [
- [
- "versions.yml:md5,46b8f1f34bb7f23892cd1eb249ed4d7f"
- ]
+ {
+ "0": [
+ [
+ {
+ "id": "test_fasta"
+ },
+ [
+ "Genome:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "Log.out:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "SA:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "SAindex:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "chrLength.txt:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "chrName.txt:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "chrNameLength.txt:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "chrStart.txt:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "exonGeTrInfo.tab:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "exonInfo.tab:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "geneInfo.tab:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "genomeParameters.txt:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "sjdbInfo.txt:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "sjdbList.fromGTF.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "sjdbList.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "transcriptInfo.tab:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ ],
+ "1": [
+ "versions.yml:md5,46b8f1f34bb7f23892cd1eb249ed4d7f"
+ ],
+ "index": [
+ [
+ {
+ "id": "test_fasta"
+ },
+ [
+ "Genome:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "Log.out:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "SA:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "SAindex:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "chrLength.txt:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "chrName.txt:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "chrNameLength.txt:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "chrStart.txt:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "exonGeTrInfo.tab:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "exonInfo.tab:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "geneInfo.tab:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "genomeParameters.txt:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "sjdbInfo.txt:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "sjdbList.fromGTF.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "sjdbList.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "transcriptInfo.tab:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ ],
+ "versions": [
+ "versions.yml:md5,46b8f1f34bb7f23892cd1eb249ed4d7f"
+ ]
+ }
],
"meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.04.3"
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
},
- "timestamp": "2024-02-01T15:54:46.491657"
+ "timestamp": "2024-07-22T14:55:57.247585"
},
- "fasta_index": {
+ "fasta_stub": {
"content": [
- "[Genome, Log.out, SA, SAindex, chrLength.txt, chrName.txt, chrNameLength.txt, chrStart.txt, genomeParameters.txt]"
+ {
+ "0": [
+ [
+ {
+ "id": "test_fasta"
+ },
+ [
+ "Genome:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "Log.out:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "SA:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "SAindex:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "chrLength.txt:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "chrName.txt:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "chrNameLength.txt:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "chrStart.txt:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "genomeParameters.txt:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ ],
+ "1": [
+ "versions.yml:md5,46b8f1f34bb7f23892cd1eb249ed4d7f"
+ ],
+ "index": [
+ [
+ {
+ "id": "test_fasta"
+ },
+ [
+ "Genome:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "Log.out:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "SA:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "SAindex:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "chrLength.txt:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "chrName.txt:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "chrNameLength.txt:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "chrStart.txt:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "genomeParameters.txt:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ ],
+ "versions": [
+ "versions.yml:md5,46b8f1f34bb7f23892cd1eb249ed4d7f"
+ ]
+ }
],
"meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.04.3"
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
},
- "timestamp": "2024-02-01T15:54:57.552329"
+ "timestamp": "2024-07-22T14:56:07.01742"
},
- "fasta_versions": {
+ "fasta": {
"content": [
+ "[Genome, Log.out, SA, SAindex, chrLength.txt, chrName.txt, chrNameLength.txt, chrStart.txt, genomeParameters.txt]",
[
"versions.yml:md5,46b8f1f34bb7f23892cd1eb249ed4d7f"
]
],
"meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.04.3"
- },
- "timestamp": "2024-02-01T15:54:57.560541"
- },
- "fasta_gtf_index": {
- "content": [
- "[Genome, Log.out, SA, SAindex, chrLength.txt, chrName.txt, chrNameLength.txt, chrStart.txt, exonGeTrInfo.tab, exonInfo.tab, geneInfo.tab, genomeParameters.txt, sjdbInfo.txt, sjdbList.fromGTF.out.tab, sjdbList.out.tab, transcriptInfo.tab]"
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.04.3"
- },
- "timestamp": "2024-02-01T15:54:31.786814"
- },
- "fasta_stub_index": {
- "content": [
- "[Genome, Log.out, SA, SAindex, chrLength.txt, chrName.txt, chrNameLength.txt, chrStart.txt, genomeParameters.txt]"
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.04.3"
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
},
- "timestamp": "2024-02-01T15:55:07.517472"
+ "timestamp": "2024-07-22T14:55:45.48784"
}
}
\ No newline at end of file
diff --git a/modules/nf-core/stringtie/stringtie/tests/main.nf.test b/modules/nf-core/stringtie/stringtie/tests/main.nf.test
index 68baaf289..dc315a314 100644
--- a/modules/nf-core/stringtie/stringtie/tests/main.nf.test
+++ b/modules/nf-core/stringtie/stringtie/tests/main.nf.test
@@ -3,11 +3,10 @@ nextflow_process {
name "Test Process STRINGTIE_STRINGTIE"
script "../main.nf"
process "STRINGTIE_STRINGTIE"
+ config "./nextflow.config"
test("sarscov2 [bam] - forward strandedness") {
- config "./nextflow.config"
-
when {
process {
"""
@@ -23,17 +22,17 @@ nextflow_process {
then {
assertAll(
{ assert process.success },
- { assert snapshot(process.out.transcript_gtf).match("fs_transcript_gtf") },
- { assert snapshot(process.out.abundance).match("fs_abundance") },
- { assert snapshot(process.out.versions).match("fs_versions") }
+ { assert snapshot(
+ process.out.abundance,
+ process.out.transcript_gtf,
+ process.out.versions
+ ).match() }
)
}
}
test("sarscov2 [bam] - forward strandedness + reference annotation") {
- config "./nextflow.config"
-
when {
process {
"""
@@ -49,18 +48,18 @@ nextflow_process {
then {
assertAll(
{ assert process.success },
- { assert snapshot(process.out.transcript_gtf).match("fs_gtf_transcript_gtf") },
- { assert snapshot(process.out.abundance).match("fs_gtf_abundance") },
- { assert snapshot(process.out.ballgown).match("fs_gtf_ballgown") },
- { assert snapshot(process.out.versions).match("fs_gtf_versions") }
+ { assert snapshot(
+ process.out.abundance,
+ process.out.ballgown,
+ process.out.transcript_gtf,
+ process.out.versions
+ ).match() }
)
}
}
test("sarscov2 [bam] - reverse strandedness") {
- config "./nextflow.config"
-
when {
process {
"""
@@ -76,16 +75,117 @@ nextflow_process {
then {
assertAll(
{ assert process.success },
- { assert snapshot(process.out.transcript_gtf).match("rs_transcript_gtf") },
- { assert snapshot(process.out.abundance).match("rs_abundance") },
- { assert snapshot(process.out.versions).match("rs_versions") }
+ { assert snapshot(
+ process.out.abundance,
+ process.out.transcript_gtf,
+ process.out.versions
+ ).match() }
)
}
}
test("sarscov2 [bam] - reverse strandedness + reference annotation") {
- config "./nextflow.config"
+ when {
+ process {
+ """
+ input[0] = [
+ [ id:'test', strandedness:'reverse' ], // meta map
+ [ file(params.modules_testdata_base_path + "genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam", checkIfExists: true) ]
+ ]
+ input[1] = file(params.modules_testdata_base_path + "genomics/sarscov2/genome/genome.gtf", checkIfExists: true)
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert process.success },
+ { assert snapshot(
+ process.out.abundance,
+ process.out.ballgown,
+ process.out.transcript_gtf,
+ process.out.versions
+ ).match() }
+ )
+ }
+ }
+
+ test("sarscov2 [bam] - forward strandedness - stub") {
+
+ options "-stub"
+
+ when {
+ process {
+ """
+ input[0] = [
+ [ id:'test', strandedness:'forward' ], // meta map
+ [ file(params.modules_testdata_base_path + "genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam", checkIfExists: true) ]
+ ]
+ input[1] = []
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert process.success },
+ { assert snapshot(process.out).match() }
+ )
+ }
+ }
+
+ test("sarscov2 [bam] - forward strandedness + reference annotation - stub") {
+
+ options "-stub"
+
+ when {
+ process {
+ """
+ input[0] = [
+ [ id:'test', strandedness:'forward' ], // meta map
+ [ file(params.modules_testdata_base_path + "genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam", checkIfExists: true) ]
+ ]
+ input[1] = file(params.modules_testdata_base_path + "genomics/sarscov2/genome/genome.gtf", checkIfExists: true)
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert process.success },
+ { assert snapshot(process.out).match() }
+ )
+ }
+ }
+
+ test("sarscov2 [bam] - reverse strandedness - stub") {
+
+ options "-stub"
+
+ when {
+ process {
+ """
+ input[0] = [
+ [ id:'test', strandedness:'reverse' ], // meta map
+ [ file(params.modules_testdata_base_path + "genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam", checkIfExists: true) ]
+ ]
+ input[1] = []
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert process.success },
+ { assert snapshot(process.out).match() }
+ )
+ }
+ }
+
+ test("sarscov2 [bam] - reverse strandedness + reference annotation - stub") {
+
+ options "-stub"
when {
process {
@@ -102,10 +202,7 @@ nextflow_process {
then {
assertAll(
{ assert process.success },
- { assert snapshot(process.out.transcript_gtf).match("rs_gtf_transcript_gtf") },
- { assert snapshot(process.out.abundance).match("rs_gtf_abundance") },
- { assert snapshot(process.out.ballgown).match("rs_gtf_ballgown") },
- { assert snapshot(process.out.versions).match("rs_gtf_versions") }
+ { assert snapshot(process.out).match() }
)
}
}
diff --git a/modules/nf-core/stringtie/stringtie/tests/main.nf.test.snap b/modules/nf-core/stringtie/stringtie/tests/main.nf.test.snap
index bf7516364..124dd4cbe 100644
--- a/modules/nf-core/stringtie/stringtie/tests/main.nf.test.snap
+++ b/modules/nf-core/stringtie/stringtie/tests/main.nf.test.snap
@@ -1,5 +1,5 @@
{
- "fs_abundance": {
+ "sarscov2 [bam] - forward strandedness + reference annotation": {
"content": [
[
[
@@ -7,49 +7,44 @@
"id": "test",
"strandedness": "forward"
},
- "test.gene.abundance.txt:md5,d6f5c8cadb8458f1df0427cf790246e3"
+ "test.gene.abundance.txt:md5,7d8bce7f2a922e367cedccae7267c22e"
]
- ]
- ],
- "timestamp": "2023-11-23T13:55:41.032044613"
- },
- "fs_transcript_gtf": {
- "content": [
+ ],
[
[
{
"id": "test",
"strandedness": "forward"
},
- "test.transcripts.gtf:md5,569137af5be452413086b50653a97203"
+ [
+ "e2t.ctab:md5,e981c0038295ae54b63cedb1083f1540",
+ "e_data.ctab:md5,6b4cf69bc03f3f69890f972a0e8b7471",
+ "i2t.ctab:md5,8a117c8aa4334b4c2d4711932b006fb4",
+ "i_data.ctab:md5,be3abe09740603213f83d50dcf81427f",
+ "t_data.ctab:md5,3b66c065da73ae0dd41cc332eff6a818"
+ ]
]
- ]
- ],
- "timestamp": "2023-11-23T13:55:41.017978904"
- },
- "rs_abundance": {
- "content": [
+ ],
[
[
{
"id": "test",
- "strandedness": "reverse"
+ "strandedness": "forward"
},
- "test.gene.abundance.txt:md5,d6f5c8cadb8458f1df0427cf790246e3"
+ "test.transcripts.gtf:md5,f56cf8aba2c4a5673bc7963ba5f12d04"
]
- ]
- ],
- "timestamp": "2023-11-23T13:56:13.601112933"
- },
- "fs_gtf_versions": {
- "content": [
+ ],
[
"versions.yml:md5,3410e8ac349d18c85ddee89337851d38"
]
],
- "timestamp": "2023-11-23T13:56:00.523797974"
+ "meta": {
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
+ },
+ "timestamp": "2024-07-22T12:33:44.299962"
},
- "fs_gtf_transcript_gtf": {
+ "sarscov2 [bam] - forward strandedness": {
"content": [
[
[
@@ -57,50 +52,395 @@
"id": "test",
"strandedness": "forward"
},
- "test.transcripts.gtf:md5,f56cf8aba2c4a5673bc7963ba5f12d04"
+ "test.gene.abundance.txt:md5,d6f5c8cadb8458f1df0427cf790246e3"
+ ]
+ ],
+ [
+ [
+ {
+ "id": "test",
+ "strandedness": "forward"
+ },
+ "test.transcripts.gtf:md5,569137af5be452413086b50653a97203"
]
+ ],
+ [
+ "versions.yml:md5,3410e8ac349d18c85ddee89337851d38"
]
],
- "timestamp": "2023-11-23T13:56:00.475164879"
+ "meta": {
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
+ },
+ "timestamp": "2024-07-22T12:33:35.177738"
},
- "rs_versions": {
+ "sarscov2 [bam] - forward strandedness - stub": {
"content": [
- [
- "versions.yml:md5,3410e8ac349d18c85ddee89337851d38"
- ]
+ {
+ "0": [
+ [
+ {
+ "id": "test",
+ "strandedness": "forward"
+ },
+ "test.transcripts.gtf:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "1": [
+ [
+ {
+ "id": "test",
+ "strandedness": "forward"
+ },
+ "test.gene.abundance.txt:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "2": [
+ [
+ {
+ "id": "test",
+ "strandedness": "forward"
+ },
+ "test.coverage.gtf:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "3": [
+ [
+ {
+ "id": "test",
+ "strandedness": "forward"
+ },
+ "test.ballgown:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "4": [
+ "versions.yml:md5,3410e8ac349d18c85ddee89337851d38"
+ ],
+ "abundance": [
+ [
+ {
+ "id": "test",
+ "strandedness": "forward"
+ },
+ "test.gene.abundance.txt:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "ballgown": [
+ [
+ {
+ "id": "test",
+ "strandedness": "forward"
+ },
+ "test.ballgown:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "coverage_gtf": [
+ [
+ {
+ "id": "test",
+ "strandedness": "forward"
+ },
+ "test.coverage.gtf:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "transcript_gtf": [
+ [
+ {
+ "id": "test",
+ "strandedness": "forward"
+ },
+ "test.transcripts.gtf:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "versions": [
+ "versions.yml:md5,3410e8ac349d18c85ddee89337851d38"
+ ]
+ }
],
- "timestamp": "2023-11-23T13:56:13.623892691"
+ "meta": {
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
+ },
+ "timestamp": "2024-07-22T12:36:32.885078"
},
- "rs_gtf_transcript_gtf": {
+ "sarscov2 [bam] - forward strandedness + reference annotation - stub": {
"content": [
- [
- [
- {
- "id": "test",
- "strandedness": "reverse"
- },
- "test.transcripts.gtf:md5,bb346053a8c156b803b055133376c7fa"
+ {
+ "0": [
+ [
+ {
+ "id": "test",
+ "strandedness": "forward"
+ },
+ "test.transcripts.gtf:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "1": [
+ [
+ {
+ "id": "test",
+ "strandedness": "forward"
+ },
+ "test.gene.abundance.txt:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "2": [
+ [
+ {
+ "id": "test",
+ "strandedness": "forward"
+ },
+ "test.coverage.gtf:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "3": [
+ [
+ {
+ "id": "test",
+ "strandedness": "forward"
+ },
+ "test.ballgown:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "4": [
+ "versions.yml:md5,3410e8ac349d18c85ddee89337851d38"
+ ],
+ "abundance": [
+ [
+ {
+ "id": "test",
+ "strandedness": "forward"
+ },
+ "test.gene.abundance.txt:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "ballgown": [
+ [
+ {
+ "id": "test",
+ "strandedness": "forward"
+ },
+ "test.ballgown:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "coverage_gtf": [
+ [
+ {
+ "id": "test",
+ "strandedness": "forward"
+ },
+ "test.coverage.gtf:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "transcript_gtf": [
+ [
+ {
+ "id": "test",
+ "strandedness": "forward"
+ },
+ "test.transcripts.gtf:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "versions": [
+ "versions.yml:md5,3410e8ac349d18c85ddee89337851d38"
]
- ]
+ }
],
- "timestamp": "2023-11-23T13:56:22.693599559"
+ "meta": {
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
+ },
+ "timestamp": "2024-07-22T12:36:43.325777"
},
- "fs_gtf_abundance": {
+ "sarscov2 [bam] - reverse strandedness + reference annotation - stub": {
+ "content": [
+ {
+ "0": [
+ [
+ {
+ "id": "test",
+ "strandedness": "reverse"
+ },
+ "test.transcripts.gtf:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "1": [
+ [
+ {
+ "id": "test",
+ "strandedness": "reverse"
+ },
+ "test.gene.abundance.txt:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "2": [
+ [
+ {
+ "id": "test",
+ "strandedness": "reverse"
+ },
+ "test.coverage.gtf:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "3": [
+ [
+ {
+ "id": "test",
+ "strandedness": "reverse"
+ },
+ "test.ballgown:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "4": [
+ "versions.yml:md5,3410e8ac349d18c85ddee89337851d38"
+ ],
+ "abundance": [
+ [
+ {
+ "id": "test",
+ "strandedness": "reverse"
+ },
+ "test.gene.abundance.txt:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "ballgown": [
+ [
+ {
+ "id": "test",
+ "strandedness": "reverse"
+ },
+ "test.ballgown:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "coverage_gtf": [
+ [
+ {
+ "id": "test",
+ "strandedness": "reverse"
+ },
+ "test.coverage.gtf:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "transcript_gtf": [
+ [
+ {
+ "id": "test",
+ "strandedness": "reverse"
+ },
+ "test.transcripts.gtf:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "versions": [
+ "versions.yml:md5,3410e8ac349d18c85ddee89337851d38"
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
+ },
+ "timestamp": "2024-07-22T12:37:06.085936"
+ },
+ "sarscov2 [bam] - reverse strandedness - stub": {
+ "content": [
+ {
+ "0": [
+ [
+ {
+ "id": "test",
+ "strandedness": "reverse"
+ },
+ "test.transcripts.gtf:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "1": [
+ [
+ {
+ "id": "test",
+ "strandedness": "reverse"
+ },
+ "test.gene.abundance.txt:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "2": [
+ [
+ {
+ "id": "test",
+ "strandedness": "reverse"
+ },
+ "test.coverage.gtf:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "3": [
+ [
+ {
+ "id": "test",
+ "strandedness": "reverse"
+ },
+ "test.ballgown:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "4": [
+ "versions.yml:md5,3410e8ac349d18c85ddee89337851d38"
+ ],
+ "abundance": [
+ [
+ {
+ "id": "test",
+ "strandedness": "reverse"
+ },
+ "test.gene.abundance.txt:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "ballgown": [
+ [
+ {
+ "id": "test",
+ "strandedness": "reverse"
+ },
+ "test.ballgown:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "coverage_gtf": [
+ [
+ {
+ "id": "test",
+ "strandedness": "reverse"
+ },
+ "test.coverage.gtf:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "transcript_gtf": [
+ [
+ {
+ "id": "test",
+ "strandedness": "reverse"
+ },
+ "test.transcripts.gtf:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "versions": [
+ "versions.yml:md5,3410e8ac349d18c85ddee89337851d38"
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
+ },
+ "timestamp": "2024-07-22T12:36:53.837578"
+ },
+ "sarscov2 [bam] - reverse strandedness + reference annotation": {
"content": [
[
[
{
"id": "test",
- "strandedness": "forward"
+ "strandedness": "reverse"
},
- "test.gene.abundance.txt:md5,7d8bce7f2a922e367cedccae7267c22e"
+ "test.gene.abundance.txt:md5,7385b870b955dae2c2ab78a70cf05cce"
]
- ]
- ],
- "timestamp": "2023-11-23T13:56:00.482135418"
- },
- "rs_gtf_ballgown": {
- "content": [
+ ],
[
[
{
@@ -115,72 +455,54 @@
"t_data.ctab:md5,3b66c065da73ae0dd41cc332eff6a818"
]
]
- ]
- ],
- "timestamp": "2023-11-23T13:56:22.715698347"
- },
- "rs_transcript_gtf": {
- "content": [
+ ],
[
[
{
"id": "test",
"strandedness": "reverse"
},
- "test.transcripts.gtf:md5,31c34aec2bf36bb0ea3c16c2afeeeb1f"
+ "test.transcripts.gtf:md5,bb346053a8c156b803b055133376c7fa"
]
- ]
- ],
- "timestamp": "2023-11-23T13:56:13.590054035"
- },
- "rs_gtf_versions": {
- "content": [
+ ],
[
"versions.yml:md5,3410e8ac349d18c85ddee89337851d38"
]
],
- "timestamp": "2023-11-23T13:56:22.725513476"
+ "meta": {
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
+ },
+ "timestamp": "2024-07-22T12:34:03.114695"
},
- "fs_gtf_ballgown": {
+ "sarscov2 [bam] - reverse strandedness": {
"content": [
[
[
{
"id": "test",
- "strandedness": "forward"
+ "strandedness": "reverse"
},
- [
- "e2t.ctab:md5,e981c0038295ae54b63cedb1083f1540",
- "e_data.ctab:md5,6b4cf69bc03f3f69890f972a0e8b7471",
- "i2t.ctab:md5,8a117c8aa4334b4c2d4711932b006fb4",
- "i_data.ctab:md5,be3abe09740603213f83d50dcf81427f",
- "t_data.ctab:md5,3b66c065da73ae0dd41cc332eff6a818"
- ]
+ "test.gene.abundance.txt:md5,d6f5c8cadb8458f1df0427cf790246e3"
]
- ]
- ],
- "timestamp": "2023-11-23T13:56:00.494299817"
- },
- "fs_versions": {
- "content": [
- [
- "versions.yml:md5,3410e8ac349d18c85ddee89337851d38"
- ]
- ],
- "timestamp": "2023-11-23T13:55:41.049417582"
- },
- "rs_gtf_abundance": {
- "content": [
+ ],
[
[
{
"id": "test",
"strandedness": "reverse"
},
- "test.gene.abundance.txt:md5,7385b870b955dae2c2ab78a70cf05cce"
+ "test.transcripts.gtf:md5,31c34aec2bf36bb0ea3c16c2afeeeb1f"
]
+ ],
+ [
+ "versions.yml:md5,3410e8ac349d18c85ddee89337851d38"
]
],
- "timestamp": "2023-11-23T13:56:22.701059059"
+ "meta": {
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
+ },
+ "timestamp": "2024-07-22T12:33:52.874479"
}
-}
+}
\ No newline at end of file
diff --git a/modules/nf-core/summarizedexperiment/summarizedexperiment/tests/main.nf.test.snap b/modules/nf-core/summarizedexperiment/summarizedexperiment/tests/main.nf.test.snap
index 6989f937e..1460532c7 100644
--- a/modules/nf-core/summarizedexperiment/summarizedexperiment/tests/main.nf.test.snap
+++ b/modules/nf-core/summarizedexperiment/summarizedexperiment/tests/main.nf.test.snap
@@ -12,9 +12,9 @@
],
"meta": {
"nf-test": "0.8.4",
- "nextflow": "23.10.1"
+ "nextflow": "24.04.3"
},
- "timestamp": "2024-02-09T13:57:39.545403663"
+ "timestamp": "2024-07-11T16:41:31.796715"
},
"gene_log_single_matrix_stub": {
"content": [
@@ -29,9 +29,9 @@
],
"meta": {
"nf-test": "0.8.4",
- "nextflow": "23.10.1"
+ "nextflow": "24.04.3"
},
- "timestamp": "2024-02-09T13:58:23.258210775"
+ "timestamp": "2024-07-11T16:42:47.12955"
},
"versions_single_matrix": {
"content": [
@@ -58,9 +58,9 @@
],
"meta": {
"nf-test": "0.8.4",
- "nextflow": "23.10.1"
+ "nextflow": "24.04.3"
},
- "timestamp": "2024-02-09T13:57:52.234643863"
+ "timestamp": "2024-07-11T16:41:54.028064"
},
"gene_log_multi_matrix_rowdata": {
"content": "7c35131fdd46dcdba6c71f7f11d5b2c7",
@@ -78,9 +78,9 @@
],
"meta": {
"nf-test": "0.8.4",
- "nextflow": "23.10.1"
+ "nextflow": "24.04.3"
},
- "timestamp": "2024-03-08T14:46:04.546156"
+ "timestamp": "2024-07-11T16:41:54.080728"
},
"versions_multi_matrix_stub": {
"content": [
@@ -90,9 +90,9 @@
],
"meta": {
"nf-test": "0.8.4",
- "nextflow": "23.10.1"
+ "nextflow": "24.04.3"
},
- "timestamp": "2024-03-08T14:46:21.128541"
+ "timestamp": "2024-07-11T16:42:21.425746"
},
"versions_multi_matrix_rowdata_coldata_stub": {
"content": [
@@ -102,9 +102,9 @@
],
"meta": {
"nf-test": "0.8.4",
- "nextflow": "23.10.1"
+ "nextflow": "24.04.3"
},
- "timestamp": "2024-03-08T14:45:43.440258"
+ "timestamp": "2024-07-11T16:41:31.837174"
},
"gene_log_multi_matrix": {
"content": "7c35131fdd46dcdba6c71f7f11d5b2c7",
@@ -127,9 +127,9 @@
],
"meta": {
"nf-test": "0.8.4",
- "nextflow": "23.10.1"
+ "nextflow": "24.04.3"
},
- "timestamp": "2024-02-09T13:58:07.904228634"
+ "timestamp": "2024-07-11T16:42:21.370562"
},
"gene_log_single_matrix": {
"content": "7c35131fdd46dcdba6c71f7f11d5b2c7",
@@ -147,9 +147,9 @@
],
"meta": {
"nf-test": "0.8.4",
- "nextflow": "23.10.1"
+ "nextflow": "24.04.3"
},
- "timestamp": "2024-03-08T14:46:37.670798"
+ "timestamp": "2024-07-11T16:42:47.173221"
},
"versions_multi_matrix_rowdata": {
"content": [
diff --git a/modules/nf-core/ucsc/bedgraphtobigwig/tests/main.nf.test b/modules/nf-core/ucsc/bedgraphtobigwig/tests/main.nf.test
index 61beea6b5..d5dbe4a37 100644
--- a/modules/nf-core/ucsc/bedgraphtobigwig/tests/main.nf.test
+++ b/modules/nf-core/ucsc/bedgraphtobigwig/tests/main.nf.test
@@ -5,11 +5,7 @@ nextflow_process {
process "UCSC_BEDGRAPHTOBIGWIG"
test("Should run without failures") {
-
when {
- params {
- outdir = "$outputDir"
- }
process {
"""
input[0] = Channel.of([
@@ -27,7 +23,27 @@ nextflow_process {
{ assert snapshot(process.out).match() }
)
}
-
}
+ test("stub") {
+ options "-stub"
+ when {
+ process {
+ """
+ input[0] = Channel.of([
+ [ id:'test' ], // meta map
+ file(params.modules_testdata_base_path + "genomics/sarscov2/illumina/bedgraph/test.bedgraph", checkIfExists: true)
+ ])
+ input[1] = Channel.of(file(params.modules_testdata_base_path + "genomics/sarscov2/genome/genome.sizes", checkIfExists: true))
+ """
+ }
+ }
+
+ then {
+ assertAll (
+ { assert process.success },
+ { assert snapshot(process.out).match() }
+ )
+ }
+ }
}
diff --git a/modules/nf-core/ucsc/bedgraphtobigwig/tests/main.nf.test.snap b/modules/nf-core/ucsc/bedgraphtobigwig/tests/main.nf.test.snap
index 526f0e261..7b0181583 100644
--- a/modules/nf-core/ucsc/bedgraphtobigwig/tests/main.nf.test.snap
+++ b/modules/nf-core/ucsc/bedgraphtobigwig/tests/main.nf.test.snap
@@ -1,4 +1,37 @@
{
+ "stub": {
+ "content": [
+ {
+ "0": [
+ [
+ {
+ "id": "test"
+ },
+ "test.bigWig:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "1": [
+ "versions.yml:md5,93b027527145a243903a3c687c3453b8"
+ ],
+ "bigwig": [
+ [
+ {
+ "id": "test"
+ },
+ "test.bigWig:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "versions": [
+ "versions.yml:md5,93b027527145a243903a3c687c3453b8"
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
+ },
+ "timestamp": "2024-07-22T12:06:05.176746"
+ },
"Should run without failures": {
"content": [
{
@@ -27,9 +60,9 @@
}
],
"meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.10.1"
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
},
- "timestamp": "2023-10-18T04:06:47.826602"
+ "timestamp": "2024-07-22T12:05:56.658148"
}
}
\ No newline at end of file
diff --git a/modules/nf-core/umitools/dedup/main.nf b/modules/nf-core/umitools/dedup/main.nf
index b2d11ebf5..1e2a2aae0 100644
--- a/modules/nf-core/umitools/dedup/main.nf
+++ b/modules/nf-core/umitools/dedup/main.nf
@@ -47,6 +47,7 @@ process UMITOOLS_DEDUP {
"""
stub:
+ prefix = task.ext.prefix ?: "${meta.id}"
"""
touch ${prefix}.bam
touch ${prefix}.log
diff --git a/modules/nf-core/umitools/dedup/tests/main.nf.test b/modules/nf-core/umitools/dedup/tests/main.nf.test
index 018bd293d..883e2d9d7 100644
--- a/modules/nf-core/umitools/dedup/tests/main.nf.test
+++ b/modules/nf-core/umitools/dedup/tests/main.nf.test
@@ -26,8 +26,9 @@ nextflow_process {
assertAll(
{ assert process.success },
{ assert path("${process.out.log[0][1]}").exists() },
- { assert snapshot(process.out.bam).match("se no stats - bam") },
- { assert snapshot(process.out.versions).match("se no stats - versions") }
+ { assert snapshot(
+ bam(process.out.bam[0][1]).getSamLinesMD5(),
+ process.out.versions).match() }
)
}
}
@@ -54,8 +55,9 @@ nextflow_process {
assertAll(
{ assert process.success },
{ assert path("${process.out.log[0][1]}").exists() },
- { assert snapshot(process.out.bam).match("pe no stats - bam") },
- { assert snapshot(process.out.versions).match("pe no stats - versions") }
+ { assert snapshot(
+ process.out.bam,
+ process.out.versions).match() }
)
}
}
@@ -82,11 +84,99 @@ nextflow_process {
assertAll(
{ assert process.success },
{ assert path("${process.out.log[0][1]}").exists() },
- { assert snapshot(process.out.bam).match("pe - bam") },
- { assert snapshot(process.out.tsv_edit_distance).match("pe - tsv_edit_distance") },
- { assert snapshot(process.out.tsv_per_umi).match("pe - tsv_per_umi") },
- { assert snapshot(process.out.tsv_umi_per_position).match("pe - tsv_umi_per_position") },
- { assert snapshot(process.out.versions).match("pe - versions") }
+ { assert snapshot(
+ process.out.bam,
+ process.out.tsv_edit_distance,
+ process.out.tsv_per_umi,
+ process.out.tsv_umi_per_position,
+ process.out.versions).match() }
+ )
+ }
+ }
+
+ test("se - no stats - stub") {
+
+ options "-stub"
+
+ config "./nextflow.config"
+
+ when {
+ process {
+ """
+ get_output_stats = false
+
+ input[0] = [
+ [ id:'test', single_end:true ], // meta map
+ file(params.modules_testdata_base_path + "genomics/sarscov2/illumina/bam/test.single_end.sorted.bam", checkIfExists: true),
+ file(params.modules_testdata_base_path + "genomics/sarscov2/illumina/bam/test.single_end.sorted.bam.bai", checkIfExists: true)
+ ]
+ input[1] = get_output_stats
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert process.success },
+ { assert snapshot(process.out.bam).match() }
+ )
+ }
+ }
+
+ test("pe - no stats - stub") {
+
+ options "-stub"
+
+ config "./nextflow.config"
+
+ when {
+ process {
+ """
+ get_output_stats = false
+
+ input[0] = [
+ [ id:'test', single_end:false ], // meta map
+ file(params.modules_testdata_base_path + "genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam", checkIfExists: true),
+ file(params.modules_testdata_base_path + "genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam.bai", checkIfExists: true)
+ ]
+ input[1] = get_output_stats
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert process.success },
+ { assert snapshot(process.out.bam).match() }
+ )
+ }
+ }
+
+ test("pe - with stats - stub") {
+
+ options "-stub"
+
+ config "./nextflow.config"
+
+ when {
+ process {
+ """
+ get_output_stats = true
+
+ input[0] = [
+ [ id:'test', single_end:false ], // meta map
+ file(params.modules_testdata_base_path + "genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam", checkIfExists: true),
+ file(params.modules_testdata_base_path + "genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam.bai", checkIfExists: true)
+ ]
+ input[1] = get_output_stats
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert process.success },
+ { assert snapshot(process.out.bam).match() }
)
}
}
diff --git a/modules/nf-core/umitools/dedup/tests/main.nf.test.snap b/modules/nf-core/umitools/dedup/tests/main.nf.test.snap
index bc3c8693c..f7f4e94f1 100644
--- a/modules/nf-core/umitools/dedup/tests/main.nf.test.snap
+++ b/modules/nf-core/umitools/dedup/tests/main.nf.test.snap
@@ -1,5 +1,5 @@
{
- "pe no stats - bam": {
+ "pe - no stats - stub": {
"content": [
[
[
@@ -7,17 +7,17 @@
"id": "test",
"single_end": false
},
- "test.dedup.bam:md5,350e942a0d45e8356fa24bc8c47dc1ed"
+ "test.dedup.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
]
]
],
"meta": {
"nf-test": "0.8.4",
- "nextflow": "24.01.0"
+ "nextflow": "24.04.2"
},
- "timestamp": "2024-03-04T17:41:38.139428"
+ "timestamp": "2024-07-03T11:40:46.802233"
},
- "pe - tsv_per_umi": {
+ "pe - with stats - stub": {
"content": [
[
[
@@ -25,18 +25,27 @@
"id": "test",
"single_end": false
},
- "test.dedup_per_umi.tsv:md5,8e6783a4a79437b095f095f2aefe7c01"
+ "test.dedup.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
]
]
],
"meta": {
"nf-test": "0.8.4",
- "nextflow": "24.01.0"
+ "nextflow": "24.04.2"
},
- "timestamp": "2024-03-04T17:41:56.21078"
+ "timestamp": "2024-07-03T11:40:59.501624"
},
- "pe - tsv_edit_distance": {
+ "pe - with stats": {
"content": [
+ [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.dedup.bam:md5,350e942a0d45e8356fa24bc8c47dc1ed"
+ ]
+ ],
[
[
{
@@ -45,16 +54,16 @@
},
"test.dedup_edit_distance.tsv:md5,65186b0964e2f8d970cc04d736d8b119"
]
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-04T17:41:56.203654"
- },
- "pe - tsv_umi_per_position": {
- "content": [
+ ],
+ [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.dedup_per_umi.tsv:md5,8e6783a4a79437b095f095f2aefe7c01"
+ ]
+ ],
[
[
{
@@ -63,15 +72,18 @@
},
"test.dedup_per_umi_per_position.tsv:md5,9386db4a104b8e4e32f3ca4a84efa4ac"
]
+ ],
+ [
+ "versions.yml:md5,e2f5146464c09bf7ae98c85ea5410e50"
]
],
"meta": {
"nf-test": "0.8.4",
- "nextflow": "24.01.0"
+ "nextflow": "24.04.2"
},
- "timestamp": "2024-03-04T17:41:56.217525"
+ "timestamp": "2024-07-03T11:27:24.231325"
},
- "se no stats - bam": {
+ "se - no stats - stub": {
"content": [
[
[
@@ -79,41 +91,30 @@
"id": "test",
"single_end": true
},
- "test.dedup.bam:md5,c9da2ee4f07f5c6922251bd01d6bcb01"
+ "test.dedup.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
]
]
],
"meta": {
"nf-test": "0.8.4",
- "nextflow": "24.01.0"
+ "nextflow": "24.04.2"
},
- "timestamp": "2024-03-04T17:41:16.383148"
+ "timestamp": "2024-07-03T11:40:34.598176"
},
- "se no stats - versions": {
+ "se - no stats": {
"content": [
+ "a114abd9fccce6fe2869852b5cd18964",
[
"versions.yml:md5,e2f5146464c09bf7ae98c85ea5410e50"
]
],
"meta": {
"nf-test": "0.8.4",
- "nextflow": "24.01.0"
+ "nextflow": "24.04.2"
},
- "timestamp": "2024-03-04T17:41:16.391241"
+ "timestamp": "2024-07-03T13:45:48.553561"
},
- "pe - versions": {
- "content": [
- [
- "versions.yml:md5,e2f5146464c09bf7ae98c85ea5410e50"
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-04T17:41:56.226748"
- },
- "pe - bam": {
+ "pe - no stats": {
"content": [
[
[
@@ -123,24 +124,15 @@
},
"test.dedup.bam:md5,350e942a0d45e8356fa24bc8c47dc1ed"
]
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-04T17:41:56.19652"
- },
- "pe no stats - versions": {
- "content": [
+ ],
[
"versions.yml:md5,e2f5146464c09bf7ae98c85ea5410e50"
]
],
"meta": {
"nf-test": "0.8.4",
- "nextflow": "24.01.0"
+ "nextflow": "24.04.2"
},
- "timestamp": "2024-03-04T17:41:38.157629"
+ "timestamp": "2024-07-03T11:27:06.957467"
}
}
\ No newline at end of file
diff --git a/modules/nf-core/untar/environment.yml b/modules/nf-core/untar/environment.yml
index 0c9cbb101..4f498244a 100644
--- a/modules/nf-core/untar/environment.yml
+++ b/modules/nf-core/untar/environment.yml
@@ -1,11 +1,9 @@
name: untar
-
channels:
- conda-forge
- bioconda
- defaults
-
dependencies:
- conda-forge::grep=3.11
- - conda-forge::sed=4.7
+ - conda-forge::sed=4.8
- conda-forge::tar=1.34
diff --git a/modules/nf-core/untar/main.nf b/modules/nf-core/untar/main.nf
index 8a75bb957..9bd8f5546 100644
--- a/modules/nf-core/untar/main.nf
+++ b/modules/nf-core/untar/main.nf
@@ -4,8 +4,8 @@ process UNTAR {
conda "${moduleDir}/environment.yml"
container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
- 'https://depot.galaxyproject.org/singularity/ubuntu:20.04' :
- 'nf-core/ubuntu:20.04' }"
+ 'https://depot.galaxyproject.org/singularity/ubuntu:22.04' :
+ 'nf-core/ubuntu:22.04' }"
input:
tuple val(meta), path(archive)
@@ -52,8 +52,29 @@ process UNTAR {
stub:
prefix = task.ext.prefix ?: ( meta.id ? "${meta.id}" : archive.toString().replaceFirst(/\.[^\.]+(.gz)?$/, ""))
"""
- mkdir $prefix
- touch ${prefix}/file.txt
+ mkdir ${prefix}
+ ## Dry-run untaring the archive to get the files and place all in prefix
+ if [[ \$(tar -taf ${archive} | grep -o -P "^.*?\\/" | uniq | wc -l) -eq 1 ]]; then
+ for i in `tar -tf ${archive}`;
+ do
+ if [[ \$(echo "\${i}" | grep -E "/\$") == "" ]];
+ then
+ touch \${i}
+ else
+ mkdir -p \${i}
+ fi
+ done
+ else
+ for i in `tar -tf ${archive}`;
+ do
+ if [[ \$(echo "\${i}" | grep -E "/\$") == "" ]];
+ then
+ touch ${prefix}/\${i}
+ else
+ mkdir -p ${prefix}/\${i}
+ fi
+ done
+ fi
cat <<-END_VERSIONS > versions.yml
"${task.process}":
diff --git a/modules/nf-core/untar/tests/main.nf.test b/modules/nf-core/untar/tests/main.nf.test
index 2740dfbcf..f556118ff 100644
--- a/modules/nf-core/untar/tests/main.nf.test
+++ b/modules/nf-core/untar/tests/main.nf.test
@@ -17,10 +17,9 @@ nextflow_process {
then {
assertAll (
{ assert process.success },
- { assert snapshot(process.out.untar).match("test_untar") },
+ { assert snapshot(process.out).match() },
)
}
-
}
test("test_untar_onlyfiles") {
@@ -36,10 +35,48 @@ nextflow_process {
then {
assertAll (
{ assert process.success },
- { assert snapshot(process.out.untar).match("test_untar_onlyfiles") },
+ { assert snapshot(process.out).match() },
)
}
+ }
+
+ test("test_untar - stub") {
+ options "-stub"
+
+ when {
+ process {
+ """
+ input[0] = [ [], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/db/kraken2.tar.gz', checkIfExists: true) ]
+ """
+ }
+ }
+
+ then {
+ assertAll (
+ { assert process.success },
+ { assert snapshot(process.out).match() },
+ )
+ }
}
+ test("test_untar_onlyfiles - stub") {
+
+ options "-stub"
+
+ when {
+ process {
+ """
+ input[0] = [ [], file(params.modules_testdata_base_path + 'generic/tar/hello.tar.gz', checkIfExists: true) ]
+ """
+ }
+ }
+
+ then {
+ assertAll (
+ { assert process.success },
+ { assert snapshot(process.out).match() },
+ )
+ }
+ }
}
diff --git a/modules/nf-core/untar/tests/main.nf.test.snap b/modules/nf-core/untar/tests/main.nf.test.snap
index 64550292f..ceb91b792 100644
--- a/modules/nf-core/untar/tests/main.nf.test.snap
+++ b/modules/nf-core/untar/tests/main.nf.test.snap
@@ -1,42 +1,158 @@
{
"test_untar_onlyfiles": {
"content": [
- [
- [
+ {
+ "0": [
[
-
- ],
+ [
+
+ ],
+ [
+ "hello.txt:md5,e59ff97941044f85df5297e1c302d260"
+ ]
+ ]
+ ],
+ "1": [
+ "versions.yml:md5,6063247258c56fd271d076bb04dd7536"
+ ],
+ "untar": [
+ [
+ [
+
+ ],
+ [
+ "hello.txt:md5,e59ff97941044f85df5297e1c302d260"
+ ]
+ ]
+ ],
+ "versions": [
+ "versions.yml:md5,6063247258c56fd271d076bb04dd7536"
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.8.4",
+ "nextflow": "24.04.3"
+ },
+ "timestamp": "2024-07-10T12:04:28.231047"
+ },
+ "test_untar_onlyfiles - stub": {
+ "content": [
+ {
+ "0": [
+ [
+ [
+
+ ],
+ [
+ "hello.txt:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ ],
+ "1": [
+ "versions.yml:md5,6063247258c56fd271d076bb04dd7536"
+ ],
+ "untar": [
[
- "hello.txt:md5,e59ff97941044f85df5297e1c302d260"
+ [
+
+ ],
+ [
+ "hello.txt:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
]
+ ],
+ "versions": [
+ "versions.yml:md5,6063247258c56fd271d076bb04dd7536"
]
- ]
+ }
],
"meta": {
"nf-test": "0.8.4",
- "nextflow": "23.10.1"
+ "nextflow": "24.04.3"
},
- "timestamp": "2024-02-28T11:49:41.320643"
+ "timestamp": "2024-07-10T12:04:45.773103"
+ },
+ "test_untar - stub": {
+ "content": [
+ {
+ "0": [
+ [
+ [
+
+ ],
+ [
+ "hash.k2d:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "opts.k2d:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "taxo.k2d:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ ],
+ "1": [
+ "versions.yml:md5,6063247258c56fd271d076bb04dd7536"
+ ],
+ "untar": [
+ [
+ [
+
+ ],
+ [
+ "hash.k2d:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "opts.k2d:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "taxo.k2d:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ ],
+ "versions": [
+ "versions.yml:md5,6063247258c56fd271d076bb04dd7536"
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.8.4",
+ "nextflow": "24.04.3"
+ },
+ "timestamp": "2024-07-10T12:04:36.777441"
},
"test_untar": {
"content": [
- [
- [
+ {
+ "0": [
[
-
- ],
+ [
+
+ ],
+ [
+ "hash.k2d:md5,8b8598468f54a7087c203ad0190555d9",
+ "opts.k2d:md5,a033d00cf6759407010b21700938f543",
+ "taxo.k2d:md5,094d5891cdccf2f1468088855c214b2c"
+ ]
+ ]
+ ],
+ "1": [
+ "versions.yml:md5,6063247258c56fd271d076bb04dd7536"
+ ],
+ "untar": [
[
- "hash.k2d:md5,8b8598468f54a7087c203ad0190555d9",
- "opts.k2d:md5,a033d00cf6759407010b21700938f543",
- "taxo.k2d:md5,094d5891cdccf2f1468088855c214b2c"
+ [
+
+ ],
+ [
+ "hash.k2d:md5,8b8598468f54a7087c203ad0190555d9",
+ "opts.k2d:md5,a033d00cf6759407010b21700938f543",
+ "taxo.k2d:md5,094d5891cdccf2f1468088855c214b2c"
+ ]
]
+ ],
+ "versions": [
+ "versions.yml:md5,6063247258c56fd271d076bb04dd7536"
]
- ]
+ }
],
"meta": {
"nf-test": "0.8.4",
- "nextflow": "23.10.1"
+ "nextflow": "24.04.3"
},
- "timestamp": "2024-02-28T11:49:33.795172"
+ "timestamp": "2024-07-10T12:04:19.377674"
}
}
\ No newline at end of file
diff --git a/nf-test.config b/nf-test.config
index f126b460a..0f4cac519 100644
--- a/nf-test.config
+++ b/nf-test.config
@@ -9,4 +9,9 @@ config {
configFile "tests/nextflow.config"
profile "test"
+
+ // load the necessary plugins
+ plugins {
+ load "nft-bam@0.3.0"
+ }
}
diff --git a/subworkflows/local/align_star/tests/main.nf.test b/subworkflows/local/align_star/tests/main.nf.test
index 2b98dffbf..35b3236e8 100644
--- a/subworkflows/local/align_star/tests/main.nf.test
+++ b/subworkflows/local/align_star/tests/main.nf.test
@@ -60,24 +60,26 @@ nextflow_workflow {
then {
assertAll(
{ assert workflow.success},
- { assert snapshot(file(workflow.out.log_final[0][1]).name).match("without igenomes - log_final") },
- { assert snapshot(file(workflow.out.log_out[0][1]).name).match("without igenomes - log_out") },
- { assert snapshot(workflow.out.bai).match("without igenomes - bai")},
- { assert snapshot(workflow.out.bam).match("without igenomes - bam")},
- { assert snapshot(workflow.out.bam_sorted).match("without igenomes - bam_sorted")},
- { assert snapshot(workflow.out.bam_transcript).match("without igenomes - bam_transcript")},
- { assert snapshot(workflow.out.csi).match("without igenomes - csi")},
- { assert snapshot(workflow.out.log_progress).match("without igenomes - log_progress")},
- { assert snapshot(workflow.out.fastq).match("without igenomes - fastq")},
- { assert snapshot(workflow.out.flagstat).match("without igenomes - flagstat")},
- { assert snapshot(workflow.out.idxstats).match("without igenomes - idxstats")},
- { assert snapshot(workflow.out.orig_bam).match("without igenomes - orig_bam")},
- { assert snapshot(workflow.out.stats).match("without igenomes - stats")},
- { assert snapshot(workflow.out.tab).match("without igenomes - tab")},
- { assert snapshot(workflow.out.versions).match("without igenomes - versions")}
+ { assert snapshot(
+ file(workflow.out.log_final[0][1]).name,
+ file(workflow.out.log_out[0][1]).name,
+ workflow.out.bai,
+ workflow.out.bam,
+ workflow.out.bam_sorted,
+ workflow.out.bam_transcript,
+ workflow.out.csi,
+ workflow.out.log_progress,
+ workflow.out.fastq,
+ workflow.out.flagstat,
+ workflow.out.idxstats,
+ workflow.out.orig_bam,
+ workflow.out.stats,
+ workflow.out.tab,
+ workflow.out.versions).match()}
)
}
}
+
test("star - with igenomes") {
setup {
@@ -127,23 +129,169 @@ nextflow_workflow {
then {
assertAll(
{ assert workflow.success},
- { assert snapshot(file(workflow.out.log_final[0][1]).name).match("with igenomes - log_final") },
- { assert snapshot(file(workflow.out.log_out[0][1]).name).match("with igenomes - log_out") },
- { assert snapshot(workflow.out.bai).match("with igenomes - bai")},
- { assert snapshot(workflow.out.bam).match("with igenomes - bam")},
- { assert snapshot(workflow.out.bam_sorted).match("with igenomes - bam_sorted")},
- { assert snapshot(workflow.out.bam_transcript).match("with igenomes - bam_transcript")},
- { assert snapshot(workflow.out.csi).match("with igenomes - csi")},
- { assert snapshot(workflow.out.log_progress).match("with igenomes - log_progress")},
- { assert snapshot(workflow.out.fastq).match("with igenomes - fastq")},
- { assert snapshot(workflow.out.flagstat).match("with igenomes - flagstat")},
- { assert snapshot(workflow.out.idxstats).match("with igenomes - idxstats")},
- { assert snapshot(workflow.out.orig_bam).match("with igenomes - orig_bam")},
- { assert snapshot(workflow.out.stats).match("with igenomes - stats")},
- { assert snapshot(workflow.out.tab).match("with igenomes - tab")},
- { assert snapshot(workflow.out.versions).match("with igenomes - versions")}
+ { assert snapshot(
+ file(workflow.out.log_final[0][1]).name,
+ file(workflow.out.log_out[0][1]).name,
+ workflow.out.bai,
+ workflow.out.bam,
+ workflow.out.bam_sorted,
+ workflow.out.bam_transcript,
+ workflow.out.csi,
+ workflow.out.log_progress,
+ workflow.out.fastq,
+ workflow.out.flagstat,
+ workflow.out.idxstats,
+ workflow.out.orig_bam,
+ workflow.out.stats,
+ workflow.out.tab,
+ workflow.out.versions).match()}
+ )
+ }
+ }
+
+ test("star - no igenomes - stub") {
+
+ options "-stub"
+
+ setup {
+ run("STAR_GENOMEGENERATE") {
+ script "../../../../modules/nf-core/star/genomegenerate/main.nf"
+ process {
+ """
+ input[0] = Channel.of([
+ [ id:'test_fasta' ],
+ [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) ]
+ ])
+ input[1] = Channel.of([
+ [ id:'test_gtf' ],
+ [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true) ]
+ ])
+ """
+ }
+ }
+ }
+
+ when {
+ workflow {
+ """
+ star_ignore_sjdbgtf = false
+ seq_platform = 'illumina'
+ seq_center = false
+ is_aws_igenome = false
+
+ input[0] = Channel.of([
+ [ id:'test', single_end:false ], // meta map
+ [
+ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_rnaseq_1.fastq.gz', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_rnaseq_2.fastq.gz', checkIfExists: true)
+ ]
+ ])
+ input[1] = STAR_GENOMEGENERATE.out.index
+ input[2] = Channel.of([
+ [ id:'test_gtf' ],
+ [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true) ]
+ ])
+ input[3] = star_ignore_sjdbgtf
+ input[4] = seq_platform
+ input[5] = seq_center
+ input[6] = is_aws_igenome
+ input[7] = Channel.of([
+ [ id:'test_fasta' ],
+ [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) ]
+ ])
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert workflow.success},
+ { assert snapshot(
+ workflow.out.bai,
+ workflow.out.bam,
+ workflow.out.bam_sorted,
+ workflow.out.bam_transcript,
+ workflow.out.csi,
+ workflow.out.flagstat,
+ workflow.out.idxstats,
+ workflow.out.log_final,
+ workflow.out.log_out,
+ workflow.out.log_progress,
+ workflow.out.orig_bam,
+ workflow.out.stats,
+ workflow.out.tab,
+ workflow.out.versions).match()}
)
}
}
+ test("star - with igenomes - stub") {
+
+ options "-stub"
+
+ setup {
+ run("STAR_GENOMEGENERATE_IGENOMES") {
+ script "../../../../modules/local/star_genomegenerate_igenomes/main.nf"
+ process {
+ """
+ input[0] = Channel.of([file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)])
+ input[1] = Channel.of([file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true)])
+ """
+ }
+ }
+ }
+
+ when {
+ workflow {
+ """
+ star_ignore_sjdbgtf = false
+ seq_platform = 'illumina'
+ seq_center = false
+ is_aws_igenome = true
+
+ input[0] = Channel.of([
+ [ id:'test', single_end:false ], // meta map
+ [
+ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_rnaseq_1.fastq.gz', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_rnaseq_2.fastq.gz', checkIfExists: true)
+ ]
+ ])
+ input[1] = STAR_GENOMEGENERATE_IGENOMES.out.index.map{ [ [id:'star'], it ] }
+ input[2] = Channel.of([
+ [ id:'test_gtf' ],
+ [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true) ]
+ ])
+ input[3] = star_ignore_sjdbgtf
+ input[4] = seq_platform
+ input[5] = seq_center
+ input[6] = is_aws_igenome
+ input[7] = Channel.of([
+ [ id:'test_fasta' ],
+ [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) ]
+ ])
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert workflow.success},
+ { assert snapshot(
+ workflow.out.bai,
+ workflow.out.bam,
+ workflow.out.bam_sorted,
+ workflow.out.bam_transcript,
+ workflow.out.csi,
+ workflow.out.flagstat,
+ workflow.out.idxstats,
+ workflow.out.log_final,
+ workflow.out.log_out,
+ workflow.out.log_progress,
+ workflow.out.orig_bam,
+ workflow.out.stats,
+ workflow.out.tab,
+ workflow.out.versions).match()}
+ )
+ }
+ }
}
diff --git a/subworkflows/local/align_star/tests/main.nf.test.snap b/subworkflows/local/align_star/tests/main.nf.test.snap
index 33f4d772a..e3a4b2e03 100644
--- a/subworkflows/local/align_star/tests/main.nf.test.snap
+++ b/subworkflows/local/align_star/tests/main.nf.test.snap
@@ -1,6 +1,41 @@
{
- "without igenomes - log_progress": {
+ "star - with igenomes": {
"content": [
+ "test.Log.final.out",
+ "test.Log.out",
+ [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.bam.bai:md5,8bfbd4094a92ac0de8492d98a471d1b0"
+ ]
+ ],
+ [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.bam:md5,fc154c31eb4d034ebdb6b1d17c6b45eb"
+ ]
+ ],
+ [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Aligned.sortedByCoord.out.bam:md5,b6cec9bba6b04b9b92eddbef128bdfbb"
+ ]
+ ],
+ [
+
+ ],
+ [
+
+ ],
[
[
{
@@ -9,16 +44,37 @@
},
"test.Log.progress.out:md5,b2bd061d6cbaaf3d6d3b1fed547f69b8"
]
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-07T11:59:42.476234"
- },
- "with igenomes - stats": {
- "content": [
+ ],
+ [
+
+ ],
+ [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.flagstat:md5,db0e25cd0b37d3030e807846c022199e"
+ ]
+ ],
+ [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.idxstats:md5,107ca94dd426cc44db316f0d402307c5"
+ ]
+ ],
+ [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Aligned.sortedByCoord.out.bam:md5,b6cec9bba6b04b9b92eddbef128bdfbb"
+ ]
+ ],
[
[
{
@@ -27,15 +83,32 @@
},
"test.stats:md5,202e2f234f93b347b6a72d0163773054"
]
+ ],
+ [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.SJ.out.tab:md5,844af19ab0fc8cd9a3f75228445aca0d"
+ ]
+ ],
+ [
+ "versions.yml:md5,06693106908e6f8f38a2c30accf7067d",
+ "versions.yml:md5,369619588c8c294b74dca9058a151b11",
+ "versions.yml:md5,78069d4515b04251f758ac52a49d9971",
+ "versions.yml:md5,b6a22ef369a375445a8f9313721b8092",
+ "versions.yml:md5,e3b043ba840d5bddde92f0bf1c91a5fc",
+ "versions.yml:md5,feaf798d368c662a7a1cea87a24a7434"
]
],
"meta": {
"nf-test": "0.8.4",
"nextflow": "24.04.2"
},
- "timestamp": "2024-07-02T16:51:25.527796"
+ "timestamp": "2024-07-03T19:13:41.194686"
},
- "with igenomes - flagstat": {
+ "star - no igenomes - stub": {
"content": [
[
[
@@ -43,84 +116,122 @@
"id": "test",
"single_end": false
},
- "test.flagstat:md5,db0e25cd0b37d3030e807846c022199e"
+ "test.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e"
]
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-07T12:00:35.063991"
- },
- "without igenomes - flagstat": {
- "content": [
+ ],
[
[
{
"id": "test",
"single_end": false
},
- "test.flagstat:md5,db0e25cd0b37d3030e807846c022199e"
+ "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
]
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-07T11:59:42.500434"
- },
- "with igenomes - csi": {
- "content": [
+ ],
+ [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ ],
+ [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.toTranscriptome.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
[
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-07T12:00:35.008879"
- },
- "without igenomes - stats": {
- "content": [
+ ],
[
[
{
"id": "test",
"single_end": false
},
- "test.stats:md5,202e2f234f93b347b6a72d0163773054"
+ "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e"
]
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.04.2"
- },
- "timestamp": "2024-07-02T16:50:30.406405"
- },
- "with igenomes - bam_sorted": {
- "content": [
+ ],
[
[
{
"id": "test",
"single_end": false
},
- "test.Aligned.sortedByCoord.out.bam:md5,b6cec9bba6b04b9b92eddbef128bdfbb"
+ "test.idxstats:md5,d41d8cd98f00b204e9800998ecf8427e"
]
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-07T12:00:34.968826"
- },
- "without igenomes - versions": {
- "content": [
+ ],
+ [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Log.final.out:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Log.out:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Log.progress.out:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "testXd.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ ],
+ [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.stats:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test.ReadsPerGene.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.SJ.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.tab:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ ],
[
"versions.yml:md5,06693106908e6f8f38a2c30accf7067d",
"versions.yml:md5,35c1cc21d26d9d8f00e6ec87e97fb634",
@@ -131,95 +242,111 @@
]
],
"meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.04.2"
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
},
- "timestamp": "2024-07-02T16:50:30.464346"
+ "timestamp": "2024-07-22T19:43:30.675108"
},
- "without igenomes - bam_transcript": {
+ "star - no igenomes": {
"content": [
+ "test.Log.final.out",
+ "test.Log.out",
[
-
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-07T11:59:42.453855"
- },
- "without igenomes - idxstats": {
- "content": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.bam.bai:md5,8bfbd4094a92ac0de8492d98a471d1b0"
+ ]
+ ],
[
[
{
"id": "test",
"single_end": false
},
- "test.idxstats:md5,107ca94dd426cc44db316f0d402307c5"
+ "test.bam:md5,e6573d093da6ec95f99c1669eb86bbd6"
]
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-07T11:59:42.511992"
- },
- "with igenomes - fastq": {
- "content": [
+ ],
+ [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Aligned.sortedByCoord.out.bam:md5,b9ee1c607e07323bc1652ef3babb543f"
+ ]
+ ],
[
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-07T12:00:35.046516"
- },
- "without igenomes - log_out": {
- "content": [
- "test.Log.out"
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-07T12:07:26.212398"
- },
- "without igenomes - fastq": {
- "content": [
+ ],
[
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-07T11:59:42.488954"
- },
- "without igenomes - csi": {
- "content": [
+ ],
+ [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Log.progress.out:md5,b2bd061d6cbaaf3d6d3b1fed547f69b8"
+ ]
+ ],
[
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-07T11:59:42.464985"
- },
- "with igenomes - versions": {
- "content": [
+ ],
+ [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.flagstat:md5,db0e25cd0b37d3030e807846c022199e"
+ ]
+ ],
+ [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.idxstats:md5,107ca94dd426cc44db316f0d402307c5"
+ ]
+ ],
+ [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.Aligned.sortedByCoord.out.bam:md5,b9ee1c607e07323bc1652ef3babb543f"
+ ]
+ ],
+ [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.stats:md5,202e2f234f93b347b6a72d0163773054"
+ ]
+ ],
+ [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.SJ.out.tab:md5,844af19ab0fc8cd9a3f75228445aca0d"
+ ]
+ ],
[
"versions.yml:md5,06693106908e6f8f38a2c30accf7067d",
+ "versions.yml:md5,35c1cc21d26d9d8f00e6ec87e97fb634",
"versions.yml:md5,369619588c8c294b74dca9058a151b11",
"versions.yml:md5,78069d4515b04251f758ac52a49d9971",
"versions.yml:md5,b6a22ef369a375445a8f9313721b8092",
- "versions.yml:md5,e3b043ba840d5bddde92f0bf1c91a5fc",
"versions.yml:md5,feaf798d368c662a7a1cea87a24a7434"
]
],
@@ -227,9 +354,9 @@
"nf-test": "0.8.4",
"nextflow": "24.04.2"
},
- "timestamp": "2024-07-02T16:51:25.579874"
+ "timestamp": "2024-07-03T19:12:49.496188"
},
- "with igenomes - log_progress": {
+ "star - with igenomes - stub": {
"content": [
[
[
@@ -237,236 +364,135 @@
"id": "test",
"single_end": false
},
- "test.Log.progress.out:md5,b2bd061d6cbaaf3d6d3b1fed547f69b8"
+ "test.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e"
]
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-07T12:00:35.028932"
- },
- "with igenomes - bam_transcript": {
- "content": [
+ ],
[
-
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-07T12:00:34.989058"
- },
- "with igenomes - log_out": {
- "content": [
- "test.Log.out"
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-07T12:04:22.59113"
- },
- "without igenomes - tab": {
- "content": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
[
[
{
"id": "test",
"single_end": false
},
- "test.SJ.out.tab:md5,844af19ab0fc8cd9a3f75228445aca0d"
+ [
+ "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
]
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-07T11:59:42.557135"
- },
- "without igenomes - bai": {
- "content": [
+ ],
[
[
{
"id": "test",
"single_end": false
},
- "test.bam.bai:md5,8bfbd4094a92ac0de8492d98a471d1b0"
+ "test.toTranscriptome.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
]
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.04.2"
- },
- "timestamp": "2024-07-02T16:50:30.294108"
- },
- "without igenomes - orig_bam": {
- "content": [
+ ],
+ [
+
+ ],
[
[
{
"id": "test",
"single_end": false
},
- "test.Aligned.sortedByCoord.out.bam:md5,b9ee1c607e07323bc1652ef3babb543f"
+ "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e"
]
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-07T11:59:42.523368"
- },
- "without igenomes - log_final": {
- "content": [
- "test.Log.final.out"
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-07T12:07:26.199"
- },
- "without igenomes - bam": {
- "content": [
+ ],
[
[
{
"id": "test",
"single_end": false
},
- "test.bam:md5,e6573d093da6ec95f99c1669eb86bbd6"
+ "test.idxstats:md5,d41d8cd98f00b204e9800998ecf8427e"
]
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.04.2"
- },
- "timestamp": "2024-07-02T16:50:30.348908"
- },
- "with igenomes - orig_bam": {
- "content": [
+ ],
[
[
{
"id": "test",
"single_end": false
},
- "test.Aligned.sortedByCoord.out.bam:md5,b6cec9bba6b04b9b92eddbef128bdfbb"
+ "test.Log.final.out:md5,d41d8cd98f00b204e9800998ecf8427e"
]
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-07T12:00:35.100886"
- },
- "with igenomes - idxstats": {
- "content": [
+ ],
[
[
{
"id": "test",
"single_end": false
},
- "test.idxstats:md5,107ca94dd426cc44db316f0d402307c5"
+ "test.Log.out:md5,d41d8cd98f00b204e9800998ecf8427e"
]
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-07T12:00:35.080603"
- },
- "with igenomes - tab": {
- "content": [
+ ],
[
[
{
"id": "test",
"single_end": false
},
- "test.SJ.out.tab:md5,844af19ab0fc8cd9a3f75228445aca0d"
+ "test.Log.progress.out:md5,d41d8cd98f00b204e9800998ecf8427e"
]
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-07T12:00:35.148353"
- },
- "with igenomes - bam": {
- "content": [
+ ],
[
[
{
"id": "test",
"single_end": false
},
- "test.bam:md5,fc154c31eb4d034ebdb6b1d17c6b45eb"
+ [
+ "test.Aligned.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.sortedByCoord.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "testXd.out.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
]
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.04.2"
- },
- "timestamp": "2024-07-02T16:51:25.474137"
- },
- "without igenomes - bam_sorted": {
- "content": [
+ ],
[
[
{
"id": "test",
"single_end": false
},
- "test.Aligned.sortedByCoord.out.bam:md5,b9ee1c607e07323bc1652ef3babb543f"
+ "test.stats:md5,d41d8cd98f00b204e9800998ecf8427e"
]
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-07T11:59:42.442171"
- },
- "with igenomes - bai": {
- "content": [
+ ],
[
[
{
"id": "test",
"single_end": false
},
- "test.bam.bai:md5,8bfbd4094a92ac0de8492d98a471d1b0"
+ [
+ "test.ReadsPerGene.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.SJ.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test.tab:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
]
+ ],
+ [
+ "versions.yml:md5,06693106908e6f8f38a2c30accf7067d",
+ "versions.yml:md5,369619588c8c294b74dca9058a151b11",
+ "versions.yml:md5,78069d4515b04251f758ac52a49d9971",
+ "versions.yml:md5,b6a22ef369a375445a8f9313721b8092",
+ "versions.yml:md5,e3b043ba840d5bddde92f0bf1c91a5fc",
+ "versions.yml:md5,feaf798d368c662a7a1cea87a24a7434"
]
],
"meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.04.2"
- },
- "timestamp": "2024-07-02T16:51:25.407812"
- },
- "with igenomes - log_final": {
- "content": [
- "test.Log.final.out"
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
},
- "timestamp": "2024-03-07T12:04:22.57863"
+ "timestamp": "2024-07-22T19:43:56.680384"
}
}
\ No newline at end of file
diff --git a/subworkflows/local/prepare_genome/tests/main.nf.test b/subworkflows/local/prepare_genome/tests/main.nf.test
index 8c5cc5b6b..fd8dc5154 100644
--- a/subworkflows/local/prepare_genome/tests/main.nf.test
+++ b/subworkflows/local/prepare_genome/tests/main.nf.test
@@ -20,16 +20,16 @@ nextflow_workflow {
skip_alignment = false
skip_pseudo_alignment = false
- input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true)
- input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true)
- input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true)
- input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true)
- input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true)
- input[5] = null
- input[6] = null
- input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true)
- input[8] = null
- input[9] = null
+ input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true)
+ input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true)
+ input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true)
+ input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true)
+ input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true)
+ input[5] = null
+ input[6] = null
+ input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true)
+ input[8] = null
+ input[9] = null
input[10] = file(params.pipelines_testdata_base_path + 'reference/rsem.tar.gz', checkIfExists: true)
input[11] = file(params.pipelines_testdata_base_path + 'reference/salmon.tar.gz', checkIfExists: true)
input[12] = null
@@ -154,16 +154,16 @@ nextflow_workflow {
skip_alignment = false
skip_pseudo_alignment = false
- input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true)
- input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true)
- input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true)
- input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true)
- input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true)
- input[5] = null
- input[6] = null
- input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true)
- input[8] = null
- input[9] = null
+ input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true)
+ input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true)
+ input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true)
+ input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true)
+ input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true)
+ input[5] = null
+ input[6] = null
+ input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true)
+ input[8] = null
+ input[9] = null
input[10] = file(params.pipelines_testdata_base_path + 'reference/rsem.tar.gz', checkIfExists: true)
input[11] = file(params.pipelines_testdata_base_path + 'reference/salmon.tar.gz', checkIfExists: true)
input[12] = null
@@ -221,16 +221,16 @@ nextflow_workflow {
skip_alignment = false
skip_pseudo_alignment = false
- input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true)
- input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true)
- input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true)
- input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true)
- input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true)
- input[5] = null
- input[6] = null
- input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true)
- input[8] = null
- input[9] = null
+ input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true)
+ input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true)
+ input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true)
+ input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true)
+ input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true)
+ input[5] = null
+ input[6] = null
+ input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true)
+ input[8] = null
+ input[9] = null
input[10] = file(params.pipelines_testdata_base_path + 'reference/rsem.tar.gz', checkIfExists: true)
input[11] = file(params.pipelines_testdata_base_path + 'reference/salmon.tar.gz', checkIfExists: true)
input[12] = null
@@ -288,16 +288,16 @@ nextflow_workflow {
skip_alignment = true
skip_pseudo_alignment = false
- input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true)
- input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true)
- input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true)
- input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true)
- input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true)
- input[5] = null
- input[6] = null
- input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true)
- input[8] = null
- input[9] = null
+ input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true)
+ input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true)
+ input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true)
+ input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true)
+ input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true)
+ input[5] = null
+ input[6] = null
+ input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true)
+ input[8] = null
+ input[9] = null
input[10] = file(params.pipelines_testdata_base_path + 'reference/rsem.tar.gz', checkIfExists: true)
input[11] = file(params.pipelines_testdata_base_path + 'reference/salmon.tar.gz', checkIfExists: true)
input[12] = null
@@ -340,7 +340,7 @@ nextflow_workflow {
}
}
- test("skip_psuedo_alignment") {
+ test("skip_pseudo_alignment") {
when {
workflow {
@@ -355,16 +355,16 @@ nextflow_workflow {
skip_alignment = false
skip_pseudo_alignment = true
- input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true)
- input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true)
- input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true)
- input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true)
- input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true)
- input[5] = null
- input[6] = null
- input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true)
- input[8] = null
- input[9] = null
+ input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true)
+ input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true)
+ input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true)
+ input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true)
+ input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true)
+ input[5] = null
+ input[6] = null
+ input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true)
+ input[8] = null
+ input[9] = null
input[10] = file(params.pipelines_testdata_base_path + 'reference/rsem.tar.gz', checkIfExists: true)
input[11] = file(params.pipelines_testdata_base_path + 'reference/salmon.tar.gz', checkIfExists: true)
input[12] = null
@@ -556,11 +556,11 @@ nextflow_workflow {
skip_alignment = false
skip_pseudo_alignment = false
- input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true)
- input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true)
- input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true)
- input[3] = false
- input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true)
+ input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true)
+ input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true)
+ input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true)
+ input[3] = false
+ input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true)
input[5] = null
input[6] = null
input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true)
@@ -623,11 +623,11 @@ nextflow_workflow {
skip_alignment = false
skip_pseudo_alignment = false
- input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true)
- input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true)
- input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true)
- input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true)
- input[4] = false
+ input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true)
+ input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true)
+ input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true)
+ input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true)
+ input[4] = false
input[5] = null
input[6] = null
input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true)
@@ -690,16 +690,16 @@ nextflow_workflow {
skip_alignment = false
skip_pseudo_alignment = false
- input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true)
- input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true)
- input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true)
- input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true)
- input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true)
- input[5] = file(params.pipelines_testdata_base_path + 'reference/ngscheckmate.bed', checkIfExists: true)
- input[6] = null
- input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true)
- input[8] = null
- input[9] = null
+ input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true)
+ input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true)
+ input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true)
+ input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true)
+ input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true)
+ input[5] = file(params.pipelines_testdata_base_path + 'reference/ngscheckmate.bed', checkIfExists: true)
+ input[6] = null
+ input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true)
+ input[8] = null
+ input[9] = null
input[10] = file(params.pipelines_testdata_base_path + 'reference/rsem.tar.gz', checkIfExists: true)
input[11] = file(params.pipelines_testdata_base_path + 'reference/salmon.tar.gz', checkIfExists: true)
input[12] = null
@@ -877,6 +877,7 @@ nextflow_workflow {
}
test("hisat2_index = false") {
+
when {
workflow {
"""
@@ -957,16 +958,16 @@ nextflow_workflow {
skip_alignment = false
skip_pseudo_alignment = false
- input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true)
- input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true)
- input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true)
- input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true)
- input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true)
- input[5] = null
- input[6] = null
- input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true)
- input[8] = null
- input[9] = null
+ input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true)
+ input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true)
+ input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true)
+ input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true)
+ input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true)
+ input[5] = null
+ input[6] = null
+ input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true)
+ input[8] = null
+ input[9] = null
input[10] = file(params.pipelines_testdata_base_path + 'reference/rsem.tar.gz', checkIfExists: true)
input[11] = file(params.pipelines_testdata_base_path + 'reference/salmon.tar.gz', checkIfExists: true)
input[12] = null
@@ -1024,16 +1025,16 @@ nextflow_workflow {
skip_alignment = false
skip_pseudo_alignment = false
- input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true)
- input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true)
- input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true)
- input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true)
- input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true)
- input[5] = null
- input[6] = null
- input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true)
- input[8] = null
- input[9] = null
+ input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true)
+ input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true)
+ input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true)
+ input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true)
+ input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true)
+ input[5] = null
+ input[6] = null
+ input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true)
+ input[8] = null
+ input[9] = null
input[10] = file(params.pipelines_testdata_base_path + 'reference/rsem.tar.gz', checkIfExists: true)
input[11] = file(params.pipelines_testdata_base_path + 'reference/salmon.tar.gz', checkIfExists: true)
input[12] = null
@@ -1091,16 +1092,16 @@ nextflow_workflow {
skip_alignment = false
skip_pseudo_alignment = false
- input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true)
- input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true)
- input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true)
- input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true)
- input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true)
- input[5] = null
- input[6] = null
- input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true)
- input[8] = null
- input[9] = null
+ input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true)
+ input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true)
+ input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true)
+ input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true)
+ input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true)
+ input[5] = null
+ input[6] = null
+ input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true)
+ input[8] = null
+ input[9] = null
input[10] = file(params.pipelines_testdata_base_path + 'reference/rsem.tar.gz', checkIfExists: true)
input[11] = file(params.pipelines_testdata_base_path + 'reference/salmon.tar.gz', checkIfExists: true)
input[12] = null
@@ -1158,16 +1159,16 @@ nextflow_workflow {
skip_alignment = false
skip_pseudo_alignment = false
- input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true)
- input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true)
- input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true)
- input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true)
- input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true)
- input[5] = null
- input[6] = null
- input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true)
- input[8] = null
- input[9] = null
+ input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true)
+ input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true)
+ input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true)
+ input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true)
+ input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true)
+ input[5] = null
+ input[6] = null
+ input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true)
+ input[8] = null
+ input[9] = null
input[10] = file(params.pipelines_testdata_base_path + 'reference/rsem.tar.gz', checkIfExists: true)
input[11] = file(params.pipelines_testdata_base_path + 'reference/salmon.tar.gz', checkIfExists: true)
input[12] = null
@@ -1225,16 +1226,16 @@ nextflow_workflow {
skip_alignment = true
skip_pseudo_alignment = false
- input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true)
- input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true)
- input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true)
- input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true)
- input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true)
- input[5] = null
- input[6] = null
- input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true)
- input[8] = null
- input[9] = null
+ input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true)
+ input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true)
+ input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true)
+ input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true)
+ input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true)
+ input[5] = null
+ input[6] = null
+ input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true)
+ input[8] = null
+ input[9] = null
input[10] = file(params.pipelines_testdata_base_path + 'reference/rsem.tar.gz', checkIfExists: true)
input[11] = file(params.pipelines_testdata_base_path + 'reference/salmon.tar.gz', checkIfExists: true)
input[12] = null
@@ -1292,16 +1293,16 @@ nextflow_workflow {
skip_alignment = false
skip_pseudo_alignment = true
- input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true)
- input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true)
- input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true)
- input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true)
- input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true)
- input[5] = null
- input[6] = null
- input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true)
- input[8] = null
- input[9] = null
+ input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true)
+ input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true)
+ input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true)
+ input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true)
+ input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true)
+ input[5] = null
+ input[6] = null
+ input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true)
+ input[8] = null
+ input[9] = null
input[10] = file(params.pipelines_testdata_base_path + 'reference/rsem.tar.gz', checkIfExists: true)
input[11] = file(params.pipelines_testdata_base_path + 'reference/salmon.tar.gz', checkIfExists: true)
input[12] = null
@@ -1344,4 +1345,1353 @@ nextflow_workflow {
}
}
+ test("default options - stub") {
+
+ options "-stub"
+
+ when {
+ workflow {
+ """
+ gencode = false
+ featurecounts_group_type = 'gene_biotype'
+ aligner = 'star_salmon,star_rsem,hisat2'
+ pseudo_aligner = 'salmon,kallisto'
+ skip_gtf_filter = false
+ skip_bbsplit = false
+ skip_sortmerna = true
+ skip_alignment = false
+ skip_pseudo_alignment = false
+
+ input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true)
+ input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true)
+ input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true)
+ input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true)
+ input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true)
+ input[5] = null
+ input[6] = null
+ input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true)
+ input[8] = null
+ input[9] = null
+ input[10] = file(params.pipelines_testdata_base_path + 'reference/rsem.tar.gz', checkIfExists: true)
+ input[11] = file(params.pipelines_testdata_base_path + 'reference/salmon.tar.gz', checkIfExists: true)
+ input[12] = null
+ input[13] = file(params.pipelines_testdata_base_path + 'reference/hisat2.tar.gz', checkIfExists: true)
+ input[14] = null
+ input[15] = null
+ input[16] = gencode
+ input[17] = featurecounts_group_type
+ input[18] = aligner
+ input[19] = pseudo_aligner
+ input[20] = skip_gtf_filter
+ input[21] = skip_bbsplit
+ input[22] = skip_sortmerna
+ input[23] = skip_alignment
+ input[24] = skip_pseudo_alignment
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert workflow.success},
+ { assert snapshot(
+ workflow.out.chrom_sizes,
+ workflow.out.fai,
+ workflow.out.fasta,
+ workflow.out.gene_bed,
+ workflow.out.gtf,
+ workflow.out.hisat2_index,
+ workflow.out.kallisto_index,
+ workflow.out.rsem_index,
+ workflow.out.salmon_index,
+ workflow.out.sortmerna_index,
+ workflow.out.splicesites,
+ workflow.out.star_index,
+ workflow.out.transcript_fasta,
+ workflow.out.versions
+ ).match() }
+ )
+ }
+ }
+
+ test("gencode = false - stub") {
+
+ options "-stub"
+
+ when {
+ workflow {
+ """
+ gencode = false
+ featurecounts_group_type = 'gene_biotype'
+ aligner = 'star_salmon,star_rsem,hisat2'
+ pseudo_aligner = 'salmon,kallisto'
+ skip_gtf_filter = false
+ skip_bbsplit = false
+ skip_sortmerna = true
+ skip_alignment = false
+ skip_pseudo_alignment = false
+
+ input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true)
+ input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true)
+ input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true)
+ input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true)
+ input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true)
+ input[5] = null
+ input[6] = null
+ input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true)
+ input[8] = null
+ input[9] = null
+ input[10] = file(params.pipelines_testdata_base_path + 'reference/rsem.tar.gz', checkIfExists: true)
+ input[11] = file(params.pipelines_testdata_base_path + 'reference/salmon.tar.gz', checkIfExists: true)
+ input[12] = null
+ input[13] = file(params.pipelines_testdata_base_path + 'reference/hisat2.tar.gz', checkIfExists: true)
+ input[14] = null
+ input[15] = null
+ input[16] = gencode
+ input[17] = featurecounts_group_type
+ input[18] = aligner
+ input[19] = pseudo_aligner
+ input[20] = skip_gtf_filter
+ input[21] = skip_bbsplit
+ input[22] = skip_sortmerna
+ input[23] = skip_alignment
+ input[24] = skip_pseudo_alignment
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert workflow.success},
+ { assert snapshot(
+ workflow.out.chrom_sizes,
+ workflow.out.fai,
+ workflow.out.fasta,
+ workflow.out.gene_bed,
+ workflow.out.gtf,
+ workflow.out.hisat2_index,
+ workflow.out.kallisto_index,
+ workflow.out.rsem_index,
+ workflow.out.salmon_index,
+ workflow.out.sortmerna_index,
+ workflow.out.splicesites,
+ workflow.out.star_index,
+ workflow.out.transcript_fasta,
+ workflow.out.versions
+ ).match() }
+ )
+ }
+ }
+
+ test("skip_gtf_filter - stub") {
+
+ options "-stub"
+
+ when {
+ workflow {
+ """
+ gencode = false
+ featurecounts_group_type = 'gene_biotype'
+ aligner = 'star_salmon,star_rsem,hisat2'
+ pseudo_aligner = 'salmon,kallisto'
+ skip_gtf_filter = true
+ skip_bbsplit = false
+ skip_sortmerna = true
+ skip_alignment = false
+ skip_pseudo_alignment = false
+
+ input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true)
+ input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true)
+ input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true)
+ input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true)
+ input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true)
+ input[5] = null
+ input[6] = null
+ input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true)
+ input[8] = null
+ input[9] = null
+ input[10] = file(params.pipelines_testdata_base_path + 'reference/rsem.tar.gz', checkIfExists: true)
+ input[11] = file(params.pipelines_testdata_base_path + 'reference/salmon.tar.gz', checkIfExists: true)
+ input[12] = null
+ input[13] = file(params.pipelines_testdata_base_path + 'reference/hisat2.tar.gz', checkIfExists: true)
+ input[14] = null
+ input[15] = null
+ input[16] = gencode
+ input[17] = featurecounts_group_type
+ input[18] = aligner
+ input[19] = pseudo_aligner
+ input[20] = skip_gtf_filter
+ input[21] = skip_bbsplit
+ input[22] = skip_sortmerna
+ input[23] = skip_alignment
+ input[24] = skip_pseudo_alignment
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert workflow.success},
+ { assert snapshot(
+ workflow.out.chrom_sizes,
+ workflow.out.fai,
+ workflow.out.fasta,
+ workflow.out.gene_bed,
+ workflow.out.gtf,
+ workflow.out.hisat2_index,
+ workflow.out.kallisto_index,
+ workflow.out.rsem_index,
+ workflow.out.salmon_index,
+ workflow.out.sortmerna_index,
+ workflow.out.splicesites,
+ workflow.out.star_index,
+ workflow.out.transcript_fasta,
+ workflow.out.versions
+ ).match() }
+ )
+ }
+ }
+
+ test("skip_bbsplit - stub") {
+
+ options "-stub"
+
+ when {
+ workflow {
+ """
+ gencode = false
+ featurecounts_group_type = 'gene_biotype'
+ aligner = 'star_salmon,star_rsem,hisat2'
+ pseudo_aligner = 'salmon,kallisto'
+ skip_gtf_filter = false
+ skip_bbsplit = true
+ skip_sortmerna = true
+ skip_alignment = false
+ skip_pseudo_alignment = false
+
+ input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true)
+ input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true)
+ input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true)
+ input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true)
+ input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true)
+ input[5] = null
+ input[6] = null
+ input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true)
+ input[8] = null
+ input[9] = null
+ input[10] = file(params.pipelines_testdata_base_path + 'reference/rsem.tar.gz', checkIfExists: true)
+ input[11] = file(params.pipelines_testdata_base_path + 'reference/salmon.tar.gz', checkIfExists: true)
+ input[12] = null
+ input[13] = file(params.pipelines_testdata_base_path + 'reference/hisat2.tar.gz', checkIfExists: true)
+ input[14] = null
+ input[15] = null
+ input[16] = gencode
+ input[17] = featurecounts_group_type
+ input[18] = aligner
+ input[19] = pseudo_aligner
+ input[20] = skip_gtf_filter
+ input[21] = skip_bbsplit
+ input[22] = skip_sortmerna
+ input[23] = skip_alignment
+ input[24] = skip_pseudo_alignment
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert workflow.success},
+ { assert snapshot(workflow.out).match() }
+ )
+ }
+ }
+
+ test("skip_alignment - stub") {
+
+ options "-stub"
+
+ when {
+ workflow {
+ """
+ gencode = false
+ featurecounts_group_type = 'gene_biotype'
+ aligner = 'star_salmon,star_rsem,hisat2'
+ pseudo_aligner = 'salmon,kallisto'
+ skip_gtf_filter = false
+ skip_bbsplit = false
+ skip_sortmerna = true
+ skip_alignment = true
+ skip_pseudo_alignment = false
+
+ input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true)
+ input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true)
+ input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true)
+ input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true)
+ input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true)
+ input[5] = null
+ input[6] = null
+ input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true)
+ input[8] = null
+ input[9] = null
+ input[10] = file(params.pipelines_testdata_base_path + 'reference/rsem.tar.gz', checkIfExists: true)
+ input[11] = file(params.pipelines_testdata_base_path + 'reference/salmon.tar.gz', checkIfExists: true)
+ input[12] = null
+ input[13] = file(params.pipelines_testdata_base_path + 'reference/hisat2.tar.gz', checkIfExists: true)
+ input[14] = null
+ input[15] = null
+ input[16] = gencode
+ input[17] = featurecounts_group_type
+ input[18] = aligner
+ input[19] = pseudo_aligner
+ input[20] = skip_gtf_filter
+ input[21] = skip_bbsplit
+ input[22] = skip_sortmerna
+ input[23] = skip_alignment
+ input[24] = skip_pseudo_alignment
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert workflow.success},
+ { assert snapshot(
+ workflow.out.chrom_sizes,
+ workflow.out.fai,
+ workflow.out.fasta,
+ workflow.out.gene_bed,
+ workflow.out.gtf,
+ workflow.out.hisat2_index,
+ workflow.out.kallisto_index,
+ workflow.out.rsem_index,
+ workflow.out.salmon_index,
+ workflow.out.sortmerna_index,
+ workflow.out.splicesites,
+ workflow.out.star_index,
+ workflow.out.transcript_fasta,
+ workflow.out.versions
+ ).match() }
+ )
+ }
+ }
+
+ test("skip_pseudo_alignment - stub") {
+
+ options "-stub"
+
+ when {
+ workflow {
+ """
+ gencode = false
+ featurecounts_group_type = 'gene_biotype'
+ aligner = 'star_salmon,star_rsem,hisat2'
+ pseudo_aligner = 'salmon,kallisto'
+ skip_gtf_filter = false
+ skip_bbsplit = false
+ skip_sortmerna = true
+ skip_alignment = false
+ skip_pseudo_alignment = true
+
+ input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true)
+ input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true)
+ input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true)
+ input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true)
+ input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true)
+ input[5] = null
+ input[6] = null
+ input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true)
+ input[8] = null
+ input[9] = null
+ input[10] = file(params.pipelines_testdata_base_path + 'reference/rsem.tar.gz', checkIfExists: true)
+ input[11] = file(params.pipelines_testdata_base_path + 'reference/salmon.tar.gz', checkIfExists: true)
+ input[12] = null
+ input[13] = file(params.pipelines_testdata_base_path + 'reference/hisat2.tar.gz', checkIfExists: true)
+ input[14] = null
+ input[15] = null
+ input[16] = gencode
+ input[17] = featurecounts_group_type
+ input[18] = aligner
+ input[19] = pseudo_aligner
+ input[20] = skip_gtf_filter
+ input[21] = skip_bbsplit
+ input[22] = skip_sortmerna
+ input[23] = skip_alignment
+ input[24] = skip_pseudo_alignment
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert workflow.success},
+ { assert snapshot(
+ workflow.out.chrom_sizes,
+ workflow.out.fai,
+ workflow.out.fasta,
+ workflow.out.gene_bed,
+ workflow.out.gtf,
+ workflow.out.hisat2_index,
+ workflow.out.kallisto_index,
+ workflow.out.rsem_index,
+ workflow.out.salmon_index,
+ workflow.out.sortmerna_index,
+ workflow.out.splicesites,
+ workflow.out.star_index,
+ workflow.out.transcript_fasta,
+ workflow.out.versions
+ ).match() }
+ )
+ }
+ }
+
+ test("gtf = false - stub") {
+
+ options "-stub"
+
+ when {
+ workflow {
+ """
+ gencode = true
+ featurecounts_group_type = 'gene_biotype'
+ aligner = 'star_salmon,star_rsem,hisat2'
+ pseudo_aligner = 'salmon,kallisto'
+ skip_gtf_filter = false
+ skip_bbsplit = false
+ skip_sortmerna = true
+ skip_alignment = false
+ skip_pseudo_alignment = false
+
+ input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true)
+ input[1] = false
+ input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true)
+ input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true)
+ input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true)
+ input[5] = null
+ input[6] = null
+ input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true)
+ input[8] = null
+ input[9] = null
+ input[10] = file(params.pipelines_testdata_base_path + 'reference/rsem.tar.gz', checkIfExists: true)
+ input[11] = file(params.pipelines_testdata_base_path + 'reference/salmon.tar.gz', checkIfExists: true)
+ input[12] = null
+ input[13] = file(params.pipelines_testdata_base_path + 'reference/hisat2.tar.gz', checkIfExists: true)
+ input[14] = null
+ input[15] = null
+ input[16] = gencode
+ input[17] = featurecounts_group_type
+ input[18] = aligner
+ input[19] = pseudo_aligner
+ input[20] = skip_gtf_filter
+ input[21] = skip_bbsplit
+ input[22] = skip_sortmerna
+ input[23] = skip_alignment
+ input[24] = skip_pseudo_alignment
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert workflow.success},
+ { assert snapshot(
+ workflow.out.chrom_sizes,
+ workflow.out.fai,
+ workflow.out.fasta,
+ workflow.out.gene_bed,
+ workflow.out.gtf,
+ workflow.out.hisat2_index,
+ workflow.out.kallisto_index,
+ workflow.out.rsem_index,
+ workflow.out.salmon_index,
+ workflow.out.sortmerna_index,
+ workflow.out.splicesites,
+ workflow.out.star_index,
+ workflow.out.transcript_fasta,
+ workflow.out.versions
+ ).match() }
+ )
+ }
+ }
+
+ test("gff = false - stub") {
+
+ options "-stub"
+
+ when {
+ workflow {
+ """
+ gencode = false
+ featurecounts_group_type = 'gene_biotype'
+ aligner = 'star_salmon,star_rsem,hisat2'
+ pseudo_aligner = 'salmon,kallisto'
+ skip_gtf_filter = false
+ skip_bbsplit = false
+ skip_sortmerna = true
+ skip_alignment = false
+ skip_pseudo_alignment = false
+
+ input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true)
+ input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true)
+ input[2] = false
+ input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true)
+ input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true)
+ input[5] = null
+ input[6] = null
+ input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true)
+ input[8] = null
+ input[9] = null
+ input[10] = file(params.pipelines_testdata_base_path + 'reference/rsem.tar.gz', checkIfExists: true)
+ input[11] = file(params.pipelines_testdata_base_path + 'reference/salmon.tar.gz', checkIfExists: true)
+ input[12] = null
+ input[13] = file(params.pipelines_testdata_base_path + 'reference/hisat2.tar.gz', checkIfExists: true)
+ input[14] = null
+ input[15] = null
+ input[16] = gencode
+ input[17] = featurecounts_group_type
+ input[18] = aligner
+ input[19] = pseudo_aligner
+ input[20] = skip_gtf_filter
+ input[21] = skip_bbsplit
+ input[22] = skip_sortmerna
+ input[23] = skip_alignment
+ input[24] = skip_pseudo_alignment
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert workflow.success},
+ { assert snapshot(
+ workflow.out.chrom_sizes,
+ workflow.out.fai,
+ workflow.out.fasta,
+ workflow.out.gene_bed,
+ workflow.out.gtf,
+ workflow.out.hisat2_index,
+ workflow.out.kallisto_index,
+ workflow.out.rsem_index,
+ workflow.out.salmon_index,
+ workflow.out.sortmerna_index,
+ workflow.out.splicesites,
+ workflow.out.star_index,
+ workflow.out.transcript_fasta,
+ workflow.out.versions
+ ).match() }
+ )
+ }
+ }
+
+ test("gfp = false - stub") {
+
+ options "-stub"
+
+ when {
+ workflow {
+ """
+ gencode = false
+ featurecounts_group_type = 'gene_biotype'
+ aligner = 'star_salmon,star_rsem,hisat2'
+ pseudo_aligner = 'salmon,kallisto'
+ skip_gtf_filter = false
+ skip_bbsplit = false
+ skip_sortmerna = true
+ skip_alignment = false
+ skip_pseudo_alignment = false
+
+ input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true)
+ input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true)
+ input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true)
+ input[3] = false
+ input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true)
+ input[5] = null
+ input[6] = null
+ input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true)
+ input[8] = null
+ input[9] = null
+ input[10] = file(params.pipelines_testdata_base_path + 'reference/rsem.tar.gz', checkIfExists: true)
+ input[11] = file(params.pipelines_testdata_base_path + 'reference/salmon.tar.gz', checkIfExists: true)
+ input[12] = null
+ input[13] = file(params.pipelines_testdata_base_path + 'reference/hisat2.tar.gz', checkIfExists: true)
+ input[14] = null
+ input[15] = null
+ input[16] = gencode
+ input[17] = featurecounts_group_type
+ input[18] = aligner
+ input[19] = pseudo_aligner
+ input[20] = skip_gtf_filter
+ input[21] = skip_bbsplit
+ input[22] = skip_sortmerna
+ input[23] = skip_alignment
+ input[24] = skip_pseudo_alignment
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert workflow.success},
+ { assert snapshot(
+ workflow.out.chrom_sizes,
+ workflow.out.fai,
+ workflow.out.fasta,
+ workflow.out.gene_bed,
+ workflow.out.gtf,
+ workflow.out.hisat2_index,
+ workflow.out.kallisto_index,
+ workflow.out.rsem_index,
+ workflow.out.salmon_index,
+ workflow.out.sortmerna_index,
+ workflow.out.splicesites,
+ workflow.out.star_index,
+ workflow.out.transcript_fasta,
+ workflow.out.versions
+ ).match() }
+ )
+ }
+ }
+
+ test("transcriptome = false - stub") {
+
+ options "-stub"
+
+ when {
+ workflow {
+ """
+ gencode = false
+ featurecounts_group_type = 'gene_biotype'
+ aligner = 'star_salmon,star_rsem,hisat2'
+ pseudo_aligner = 'salmon,kallisto'
+ skip_gtf_filter = false
+ skip_bbsplit = false
+ skip_sortmerna = true
+ skip_alignment = false
+ skip_pseudo_alignment = false
+
+ input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true)
+ input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true)
+ input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true)
+ input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true)
+ input[4] = false
+ input[5] = null
+ input[6] = null
+ input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true)
+ input[8] = null
+ input[9] = null
+ input[10] = file(params.pipelines_testdata_base_path + 'reference/rsem.tar.gz', checkIfExists: true)
+ input[11] = file(params.pipelines_testdata_base_path + 'reference/salmon.tar.gz', checkIfExists: true)
+ input[12] = null
+ input[13] = file(params.pipelines_testdata_base_path + 'reference/hisat2.tar.gz', checkIfExists: true)
+ input[14] = null
+ input[15] = null
+ input[16] = gencode
+ input[17] = featurecounts_group_type
+ input[18] = aligner
+ input[19] = pseudo_aligner
+ input[20] = skip_gtf_filter
+ input[21] = skip_bbsplit
+ input[22] = skip_sortmerna
+ input[23] = skip_alignment
+ input[24] = skip_pseudo_alignment
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert workflow.success},
+ { assert snapshot(
+ workflow.out.chrom_sizes,
+ workflow.out.fai,
+ workflow.out.fasta,
+ workflow.out.gene_bed,
+ workflow.out.gtf,
+ workflow.out.hisat2_index,
+ workflow.out.kallisto_index,
+ workflow.out.rsem_index,
+ workflow.out.salmon_index,
+ workflow.out.sortmerna_index,
+ workflow.out.splicesites,
+ workflow.out.star_index,
+ workflow.out.transcript_fasta,
+ workflow.out.versions
+ ).match() }
+ )
+ }
+ }
+
+ test("with bed - stub") {
+
+ options "-stub"
+
+ when {
+ workflow {
+ """
+ gencode = false
+ featurecounts_group_type = 'gene_biotype'
+ aligner = 'star_salmon,star_rsem,hisat2'
+ pseudo_aligner = 'salmon,kallisto'
+ skip_gtf_filter = false
+ skip_bbsplit = false
+ skip_sortmerna = true
+ skip_alignment = false
+ skip_pseudo_alignment = false
+
+ input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true)
+ input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true)
+ input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true)
+ input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true)
+ input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true)
+ input[5] = file(params.pipelines_testdata_base_path + 'reference/ngscheckmate.bed', checkIfExists: true)
+ input[6] = null
+ input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true)
+ input[8] = null
+ input[9] = null
+ input[10] = file(params.pipelines_testdata_base_path + 'reference/rsem.tar.gz', checkIfExists: true)
+ input[11] = file(params.pipelines_testdata_base_path + 'reference/salmon.tar.gz', checkIfExists: true)
+ input[12] = null
+ input[13] = file(params.pipelines_testdata_base_path + 'reference/hisat2.tar.gz', checkIfExists: true)
+ input[14] = null
+ input[15] = null
+ input[16] = gencode
+ input[17] = featurecounts_group_type
+ input[18] = aligner
+ input[19] = pseudo_aligner
+ input[20] = skip_gtf_filter
+ input[21] = skip_bbsplit
+ input[22] = skip_sortmerna
+ input[23] = skip_alignment
+ input[24] = skip_pseudo_alignment
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert workflow.success},
+ { assert snapshot(
+ workflow.out.chrom_sizes,
+ workflow.out.fai,
+ workflow.out.fasta,
+ workflow.out.gene_bed,
+ workflow.out.gtf,
+ workflow.out.hisat2_index,
+ workflow.out.kallisto_index,
+ workflow.out.rsem_index,
+ workflow.out.salmon_index,
+ workflow.out.sortmerna_index,
+ workflow.out.splicesites,
+ workflow.out.star_index,
+ workflow.out.transcript_fasta,
+ workflow.out.versions
+ ).match() }
+ )
+ }
+ }
+
+ test("rsem_index = false - stub") {
+
+ options "-stub"
+
+ when {
+ workflow {
+ """
+ gencode = false
+ featurecounts_group_type = 'gene_biotype'
+ aligner = 'star_salmon,star_rsem,hisat2'
+ pseudo_aligner = 'salmon,kallisto'
+ skip_gtf_filter = false
+ skip_bbsplit = false
+ skip_sortmerna = true
+ skip_alignment = false
+ skip_pseudo_alignment = false
+
+ input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true)
+ input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true)
+ input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true)
+ input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true)
+ input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true)
+ input[5] = null
+ input[6] = null
+ input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true)
+ input[8] = null
+ input[9] = null
+ input[10] = false
+ input[11] = file(params.pipelines_testdata_base_path + 'reference/salmon.tar.gz', checkIfExists: true)
+ input[12] = null
+ input[13] = file(params.pipelines_testdata_base_path + 'reference/hisat2.tar.gz', checkIfExists: true)
+ input[14] = null
+ input[15] = null
+ input[16] = gencode
+ input[17] = featurecounts_group_type
+ input[18] = aligner
+ input[19] = pseudo_aligner
+ input[20] = skip_gtf_filter
+ input[21] = skip_bbsplit
+ input[22] = skip_sortmerna
+ input[23] = skip_alignment
+ input[24] = skip_pseudo_alignment
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert workflow.success},
+ { assert snapshot(
+ workflow.out.chrom_sizes,
+ workflow.out.fai,
+ workflow.out.fasta,
+ workflow.out.gene_bed,
+ workflow.out.gtf,
+ workflow.out.hisat2_index,
+ workflow.out.kallisto_index,
+ workflow.out.rsem_index,
+ workflow.out.salmon_index,
+ workflow.out.sortmerna_index,
+ workflow.out.splicesites,
+ workflow.out.star_index,
+ workflow.out.transcript_fasta,
+ workflow.out.versions
+ ).match() }
+ )
+ }
+ }
+
+ test("salmon_index = false - stub") {
+
+ options "-stub"
+
+ when {
+ workflow {
+ """
+ gencode = false
+ featurecounts_group_type = 'gene_biotype'
+ aligner = 'star_salmon,star_rsem,hisat2'
+ pseudo_aligner = 'salmon,kallisto'
+ skip_gtf_filter = false
+ skip_bbsplit = false
+ skip_sortmerna = true
+ skip_alignment = false
+ skip_pseudo_alignment = false
+
+ input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true)
+ input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true)
+ input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true)
+ input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true)
+ input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true)
+ input[5] = null
+ input[6] = null
+ input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true)
+ input[8] = null
+ input[9] = null
+ input[10] = file(params.pipelines_testdata_base_path + 'reference/rsem.tar.gz', checkIfExists: true)
+ input[11] = false
+ input[12] = null
+ input[13] = file(params.pipelines_testdata_base_path + 'reference/hisat2.tar.gz', checkIfExists: true)
+ input[14] = null
+ input[15] = null
+ input[16] = gencode
+ input[17] = featurecounts_group_type
+ input[18] = aligner
+ input[19] = pseudo_aligner
+ input[20] = skip_gtf_filter
+ input[21] = skip_bbsplit
+ input[22] = skip_sortmerna
+ input[23] = skip_alignment
+ input[24] = skip_pseudo_alignment
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert workflow.success},
+ { assert snapshot(
+ workflow.out.chrom_sizes,
+ workflow.out.fai,
+ workflow.out.fasta,
+ workflow.out.gene_bed,
+ workflow.out.gtf,
+ workflow.out.hisat2_index,
+ workflow.out.kallisto_index,
+ workflow.out.rsem_index,
+ workflow.out.salmon_index,
+ workflow.out.sortmerna_index,
+ workflow.out.splicesites,
+ workflow.out.star_index,
+ workflow.out.transcript_fasta,
+ workflow.out.versions
+ ).match() }
+ )
+ }
+ }
+
+ test("hisat2_index = false - stub") {
+
+ options "-stub"
+
+ when {
+ workflow {
+ """
+ gencode = false
+ featurecounts_group_type = 'gene_biotype'
+ aligner = 'star_salmon,star_rsem,hisat2'
+ pseudo_aligner = 'salmon,kallisto'
+ skip_gtf_filter = false
+ skip_bbsplit = false
+ skip_sortmerna = true
+ skip_alignment = false
+ skip_pseudo_alignment = false
+
+ input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true)
+ input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true)
+ input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true)
+ input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true)
+ input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true)
+ input[5] = null
+ input[6] = null
+ input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true)
+ input[8] = null
+ input[9] = null
+ input[10] = file(params.pipelines_testdata_base_path + 'reference/rsem.tar.gz', checkIfExists: true)
+ input[11] = false
+ input[12] = null
+ input[13] = false
+ input[14] = null
+ input[15] = null
+ input[16] = gencode
+ input[17] = featurecounts_group_type
+ input[18] = aligner
+ input[19] = pseudo_aligner
+ input[20] = skip_gtf_filter
+ input[21] = skip_bbsplit
+ input[22] = skip_sortmerna
+ input[23] = skip_alignment
+ input[24] = skip_pseudo_alignment
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert workflow.success},
+ { assert snapshot(
+ workflow.out.chrom_sizes,
+ workflow.out.fai,
+ workflow.out.fasta,
+ workflow.out.gene_bed,
+ workflow.out.gtf,
+ workflow.out.hisat2_index,
+ workflow.out.kallisto_index,
+ workflow.out.rsem_index,
+ workflow.out.salmon_index,
+ workflow.out.sortmerna_index,
+ workflow.out.splicesites,
+ workflow.out.star_index,
+ workflow.out.transcript_fasta,
+ workflow.out.versions
+ ).match() }
+ )
+ }
+ }
+
+ test("gencode = true - stub") {
+
+ options "-stub"
+
+ when {
+ workflow {
+ """
+ gencode = true
+ featurecounts_group_type = 'gene_biotype'
+ aligner = 'star_salmon,star_rsem,hisat2'
+ pseudo_aligner = 'salmon,kallisto'
+ skip_gtf_filter = false
+ skip_bbsplit = false
+ skip_sortmerna = true
+ skip_alignment = false
+ skip_pseudo_alignment = false
+
+ input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true)
+ input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true)
+ input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true)
+ input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true)
+ input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true)
+ input[5] = null
+ input[6] = null
+ input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true)
+ input[8] = null
+ input[9] = null
+ input[10] = file(params.pipelines_testdata_base_path + 'reference/rsem.tar.gz', checkIfExists: true)
+ input[11] = file(params.pipelines_testdata_base_path + 'reference/salmon.tar.gz', checkIfExists: true)
+ input[12] = null
+ input[13] = file(params.pipelines_testdata_base_path + 'reference/hisat2.tar.gz', checkIfExists: true)
+ input[14] = null
+ input[15] = null
+ input[16] = gencode
+ input[17] = featurecounts_group_type
+ input[18] = aligner
+ input[19] = pseudo_aligner
+ input[20] = skip_gtf_filter
+ input[21] = skip_bbsplit
+ input[22] = skip_sortmerna
+ input[23] = skip_alignment
+ input[24] = skip_pseudo_alignment
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert workflow.success},
+ { assert snapshot(
+ workflow.out.chrom_sizes,
+ workflow.out.fai,
+ workflow.out.fasta,
+ workflow.out.gene_bed,
+ workflow.out.gtf,
+ workflow.out.hisat2_index,
+ workflow.out.kallisto_index,
+ workflow.out.rsem_index,
+ workflow.out.salmon_index,
+ workflow.out.sortmerna_index,
+ workflow.out.splicesites,
+ workflow.out.star_index,
+ workflow.out.transcript_fasta,
+ workflow.out.versions
+ ).match() }
+ )
+ }
+ }
+
+ test("featurecounts_group_type = 'gene_type' - stub") {
+
+ options "-stub"
+
+ when {
+ workflow {
+ """
+ gencode = false
+ featurecounts_group_type = 'gene_type'
+ aligner = 'star_salmon,star_rsem,hisat2'
+ pseudo_aligner = 'salmon,kallisto'
+ skip_gtf_filter = false
+ skip_bbsplit = false
+ skip_sortmerna = true
+ skip_alignment = false
+ skip_pseudo_alignment = false
+
+ input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true)
+ input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true)
+ input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true)
+ input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true)
+ input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true)
+ input[5] = null
+ input[6] = null
+ input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true)
+ input[8] = null
+ input[9] = null
+ input[10] = file(params.pipelines_testdata_base_path + 'reference/rsem.tar.gz', checkIfExists: true)
+ input[11] = file(params.pipelines_testdata_base_path + 'reference/salmon.tar.gz', checkIfExists: true)
+ input[12] = null
+ input[13] = file(params.pipelines_testdata_base_path + 'reference/hisat2.tar.gz', checkIfExists: true)
+ input[14] = null
+ input[15] = null
+ input[16] = gencode
+ input[17] = featurecounts_group_type
+ input[18] = aligner
+ input[19] = pseudo_aligner
+ input[20] = skip_gtf_filter
+ input[21] = skip_bbsplit
+ input[22] = skip_sortmerna
+ input[23] = skip_alignment
+ input[24] = skip_pseudo_alignment
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert workflow.success},
+ { assert snapshot(
+ workflow.out.chrom_sizes,
+ workflow.out.fai,
+ workflow.out.fasta,
+ workflow.out.gene_bed,
+ workflow.out.gtf,
+ workflow.out.hisat2_index,
+ workflow.out.kallisto_index,
+ workflow.out.rsem_index,
+ workflow.out.salmon_index,
+ workflow.out.sortmerna_index,
+ workflow.out.splicesites,
+ workflow.out.star_index,
+ workflow.out.transcript_fasta,
+ workflow.out.versions
+ ).match() }
+ )
+ }
+ }
+
+ test("skip_gtf_filter = true - stub") {
+
+ options "-stub"
+
+ when {
+ workflow {
+ """
+ gencode = false
+ featurecounts_group_type = 'gene_biotype'
+ aligner = 'star_salmon,star_rsem,hisat2'
+ pseudo_aligner = 'salmon,kallisto'
+ skip_gtf_filter = true
+ skip_bbsplit = false
+ skip_sortmerna = true
+ skip_alignment = false
+ skip_pseudo_alignment = false
+
+ input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true)
+ input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true)
+ input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true)
+ input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true)
+ input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true)
+ input[5] = null
+ input[6] = null
+ input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true)
+ input[8] = null
+ input[9] = null
+ input[10] = file(params.pipelines_testdata_base_path + 'reference/rsem.tar.gz', checkIfExists: true)
+ input[11] = file(params.pipelines_testdata_base_path + 'reference/salmon.tar.gz', checkIfExists: true)
+ input[12] = null
+ input[13] = file(params.pipelines_testdata_base_path + 'reference/hisat2.tar.gz', checkIfExists: true)
+ input[14] = null
+ input[15] = null
+ input[16] = gencode
+ input[17] = featurecounts_group_type
+ input[18] = aligner
+ input[19] = pseudo_aligner
+ input[20] = skip_gtf_filter
+ input[21] = skip_bbsplit
+ input[22] = skip_sortmerna
+ input[23] = skip_alignment
+ input[24] = skip_pseudo_alignment
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert workflow.success},
+ { assert snapshot(
+ workflow.out.chrom_sizes,
+ workflow.out.fai,
+ workflow.out.fasta,
+ workflow.out.gene_bed,
+ workflow.out.gtf,
+ workflow.out.hisat2_index,
+ workflow.out.kallisto_index,
+ workflow.out.rsem_index,
+ workflow.out.salmon_index,
+ workflow.out.sortmerna_index,
+ workflow.out.splicesites,
+ workflow.out.star_index,
+ workflow.out.transcript_fasta,
+ workflow.out.versions
+ ).match() }
+ )
+ }
+ }
+
+ test("skip_bbsplit = true - stub") {
+
+ options "-stub"
+
+ when {
+ workflow {
+ """
+ gencode = false
+ featurecounts_group_type = 'gene_biotype'
+ aligner = 'star_salmon,star_rsem,hisat2'
+ pseudo_aligner = 'salmon,kallisto'
+ skip_gtf_filter = false
+ skip_bbsplit = true
+ skip_sortmerna = true
+ skip_alignment = false
+ skip_pseudo_alignment = false
+
+ input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true)
+ input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true)
+ input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true)
+ input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true)
+ input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true)
+ input[5] = null
+ input[6] = null
+ input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true)
+ input[8] = null
+ input[9] = null
+ input[10] = file(params.pipelines_testdata_base_path + 'reference/rsem.tar.gz', checkIfExists: true)
+ input[11] = file(params.pipelines_testdata_base_path + 'reference/salmon.tar.gz', checkIfExists: true)
+ input[12] = null
+ input[13] = file(params.pipelines_testdata_base_path + 'reference/hisat2.tar.gz', checkIfExists: true)
+ input[14] = null
+ input[15] = null
+ input[16] = gencode
+ input[17] = featurecounts_group_type
+ input[18] = aligner
+ input[19] = pseudo_aligner
+ input[20] = skip_gtf_filter
+ input[21] = skip_bbsplit
+ input[22] = skip_sortmerna
+ input[23] = skip_alignment
+ input[24] = skip_pseudo_alignment
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert workflow.success},
+ { assert snapshot(workflow.out).match() }
+ )
+ }
+ }
+
+ test("skip_alignment = true - stub") {
+
+ options "-stub"
+
+ when {
+ workflow {
+ """
+ gencode = false
+ featurecounts_group_type = 'gene_biotype'
+ aligner = 'star_salmon,star_rsem,hisat2'
+ pseudo_aligner = 'salmon,kallisto'
+ skip_gtf_filter = false
+ skip_bbsplit = false
+ skip_sortmerna = true
+ skip_alignment = true
+ skip_pseudo_alignment = false
+
+ input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true)
+ input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true)
+ input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true)
+ input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true)
+ input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true)
+ input[5] = null
+ input[6] = null
+ input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true)
+ input[8] = null
+ input[9] = null
+ input[10] = file(params.pipelines_testdata_base_path + 'reference/rsem.tar.gz', checkIfExists: true)
+ input[11] = file(params.pipelines_testdata_base_path + 'reference/salmon.tar.gz', checkIfExists: true)
+ input[12] = null
+ input[13] = file(params.pipelines_testdata_base_path + 'reference/hisat2.tar.gz', checkIfExists: true)
+ input[14] = null
+ input[15] = null
+ input[16] = gencode
+ input[17] = featurecounts_group_type
+ input[18] = aligner
+ input[19] = pseudo_aligner
+ input[20] = skip_gtf_filter
+ input[21] = skip_bbsplit
+ input[22] = skip_sortmerna
+ input[23] = skip_alignment
+ input[24] = skip_pseudo_alignment
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert workflow.success},
+ { assert snapshot(
+ workflow.out.chrom_sizes,
+ workflow.out.fai,
+ workflow.out.fasta,
+ workflow.out.gene_bed,
+ workflow.out.gtf,
+ workflow.out.hisat2_index,
+ workflow.out.kallisto_index,
+ workflow.out.rsem_index,
+ workflow.out.salmon_index,
+ workflow.out.sortmerna_index,
+ workflow.out.splicesites,
+ workflow.out.star_index,
+ workflow.out.transcript_fasta,
+ workflow.out.versions
+ ).match() }
+ )
+ }
+ }
+
+ test("skip_pseudoalignment = true - stub") {
+
+ options "-stub"
+
+ when {
+ workflow {
+ """
+ gencode = false
+ featurecounts_group_type = 'gene_biotype'
+ aligner = 'star_salmon,star_rsem,hisat2'
+ pseudo_aligner = 'salmon,kallisto'
+ skip_gtf_filter = false
+ skip_bbsplit = false
+ skip_sortmerna = true
+ skip_alignment = false
+ skip_pseudo_alignment = true
+
+ input[0] = file(params.pipelines_testdata_base_path + 'reference/genome.fasta', checkIfExists: true)
+ input[1] = file(params.pipelines_testdata_base_path + 'reference/genes_with_empty_tid.gtf', checkIfExists: true)
+ input[2] = file(params.pipelines_testdata_base_path + 'reference/genes.gff', checkIfExists: true)
+ input[3] = file(params.pipelines_testdata_base_path + 'reference/gfp.fa', checkIfExists: true)
+ input[4] = file(params.pipelines_testdata_base_path + 'reference/transcriptome.fasta', checkIfExists: true)
+ input[5] = null
+ input[6] = null
+ input[7] = file(params.pipelines_testdata_base_path + 'reference/bbsplit_fasta_list.txt', checkIfExists: true)
+ input[8] = null
+ input[9] = null
+ input[10] = file(params.pipelines_testdata_base_path + 'reference/rsem.tar.gz', checkIfExists: true)
+ input[11] = file(params.pipelines_testdata_base_path + 'reference/salmon.tar.gz', checkIfExists: true)
+ input[12] = null
+ input[13] = file(params.pipelines_testdata_base_path + 'reference/hisat2.tar.gz', checkIfExists: true)
+ input[14] = null
+ input[15] = null
+ input[16] = gencode
+ input[17] = featurecounts_group_type
+ input[18] = aligner
+ input[19] = pseudo_aligner
+ input[20] = skip_gtf_filter
+ input[21] = skip_bbsplit
+ input[22] = skip_sortmerna
+ input[23] = skip_alignment
+ input[24] = skip_pseudo_alignment
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert workflow.success},
+ { assert snapshot(
+ workflow.out.chrom_sizes,
+ workflow.out.fai,
+ workflow.out.fasta,
+ workflow.out.gene_bed,
+ workflow.out.gtf,
+ workflow.out.hisat2_index,
+ workflow.out.kallisto_index,
+ workflow.out.rsem_index,
+ workflow.out.salmon_index,
+ workflow.out.sortmerna_index,
+ workflow.out.splicesites,
+ workflow.out.star_index,
+ workflow.out.transcript_fasta,
+ workflow.out.versions
+ ).match() }
+ )
+ }
+ }
}
diff --git a/subworkflows/local/prepare_genome/tests/main.nf.test.snap b/subworkflows/local/prepare_genome/tests/main.nf.test.snap
index 2741bb23d..88d78c211 100644
--- a/subworkflows/local/prepare_genome/tests/main.nf.test.snap
+++ b/subworkflows/local/prepare_genome/tests/main.nf.test.snap
@@ -1,8 +1,1054 @@
{
- "gencode = true": {
+ "skip_gtf_filter = true - stub": {
+ "content": [
+ [
+ "genome_transcriptome.fasta.sizes:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ [
+ "genome_transcriptome.fasta.fai:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ [
+ "genome_transcriptome.fasta:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ [
+ "genome_transcriptome.bed:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ [
+ "genome_transcriptome.gtf:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+ "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/salmon.tar.gz"
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+ "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/transcriptome.fasta"
+ ],
+ [
+ "versions.yml:md5,0bc25597acf1d50abf7070d19d311cd7",
+ "versions.yml:md5,71252f1a221be05593361acccb99506b",
+ "versions.yml:md5,bc99889446f02427c166b3219b793672",
+ "versions.yml:md5,cc8f32b7c37c35a075d38cb773004eaa"
+ ]
+ ],
+ "meta": {
+ "nf-test": "0.8.4",
+ "nextflow": "24.04.2"
+ },
+ "timestamp": "2024-07-04T17:03:34.032908"
+ },
+ "skip_pseudo_alignment - stub": {
+ "content": [
+ [
+ "genome_transcriptome.fasta.sizes:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ [
+ "genome_transcriptome.fasta.fai:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ [
+ "genome_transcriptome.fasta:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ [
+ "genome_transcriptome.bed:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ [
+ "genome_transcriptome.gtf:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+ "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/salmon.tar.gz"
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+ "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/transcriptome.fasta"
+ ],
+ [
+ "versions.yml:md5,0bc25597acf1d50abf7070d19d311cd7",
+ "versions.yml:md5,71252f1a221be05593361acccb99506b",
+ "versions.yml:md5,80e9dd350be8cd4c11909d75c914757a",
+ "versions.yml:md5,bc99889446f02427c166b3219b793672",
+ "versions.yml:md5,cc8f32b7c37c35a075d38cb773004eaa"
+ ]
+ ],
+ "meta": {
+ "nf-test": "0.8.4",
+ "nextflow": "24.04.2"
+ },
+ "timestamp": "2024-07-04T16:59:05.328944"
+ },
+ "skip_gtf_filter": {
+ "content": [
+ [
+ "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/transcriptome.fasta"
+ ],
+ [
+ "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/salmon.tar.gz"
+ ],
+ [
+ "genome_gfp.fasta:md5,e23e302af63736a199985a169fdac055"
+ ],
+ [
+ "genome_gfp.gtf:md5,5e63cda3dcafc0d6ad0a738133af9d54"
+ ],
+ [
+ "genome_gfp.fasta.fai:md5,8fa54c6bd2ea6a369efbb8ab4f30156a"
+ ],
+ [
+ "genome_gfp.bed:md5,991993ebef1def1d5823632c21177ec3"
+ ],
+ [
+ "genome_gfp.fasta.sizes:md5,9b755f8f349b14accefb4d859f84de26"
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+ "versions.yml:md5,0bc25597acf1d50abf7070d19d311cd7",
+ "versions.yml:md5,1cd265cb86a23a27f683ffb2459f37f5",
+ "versions.yml:md5,71252f1a221be05593361acccb99506b",
+ "versions.yml:md5,bc99889446f02427c166b3219b793672"
+ ]
+ ],
+ "meta": {
+ "nf-test": "0.8.4",
+ "nextflow": "24.04.2"
+ },
+ "timestamp": "2024-07-03T19:15:45.003106"
+ },
+ "gencode = false - stub": {
+ "content": [
+ [
+ "genome_transcriptome.fasta.sizes:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ [
+ "genome_transcriptome.fasta.fai:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ [
+ "genome_transcriptome.fasta:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ [
+ "genome_transcriptome.bed:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ [
+ "genome_transcriptome.gtf:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+ "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/salmon.tar.gz"
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+ "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/transcriptome.fasta"
+ ],
+ [
+ "versions.yml:md5,0bc25597acf1d50abf7070d19d311cd7",
+ "versions.yml:md5,71252f1a221be05593361acccb99506b",
+ "versions.yml:md5,80e9dd350be8cd4c11909d75c914757a",
+ "versions.yml:md5,bc99889446f02427c166b3219b793672",
+ "versions.yml:md5,cc8f32b7c37c35a075d38cb773004eaa"
+ ]
+ ],
+ "meta": {
+ "nf-test": "0.8.4",
+ "nextflow": "24.04.2"
+ },
+ "timestamp": "2024-07-04T16:57:20.218814"
+ },
+ "gff = false - stub": {
+ "content": [
+ [
+ "genome_transcriptome.fasta.sizes:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ [
+ "genome_transcriptome.fasta.fai:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ [
+ "genome_transcriptome.fasta:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ [
+ "genome_transcriptome.bed:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ [
+ "genome_transcriptome.gtf:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+ "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/salmon.tar.gz"
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+ "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/transcriptome.fasta"
+ ],
+ [
+ "versions.yml:md5,0bc25597acf1d50abf7070d19d311cd7",
+ "versions.yml:md5,71252f1a221be05593361acccb99506b",
+ "versions.yml:md5,80e9dd350be8cd4c11909d75c914757a",
+ "versions.yml:md5,bc99889446f02427c166b3219b793672",
+ "versions.yml:md5,cc8f32b7c37c35a075d38cb773004eaa"
+ ]
+ ],
+ "meta": {
+ "nf-test": "0.8.4",
+ "nextflow": "24.04.2"
+ },
+ "timestamp": "2024-07-04T16:59:55.589832"
+ },
+ "skip_pseudoalignment = true - stub": {
+ "content": [
+ [
+ "genome_transcriptome.fasta.sizes:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ [
+ "genome_transcriptome.fasta.fai:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ [
+ "genome_transcriptome.fasta:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ [
+ "genome_transcriptome.bed:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ [
+ "genome_transcriptome.gtf:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+ "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/salmon.tar.gz"
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+ "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/transcriptome.fasta"
+ ],
+ [
+ "versions.yml:md5,0bc25597acf1d50abf7070d19d311cd7",
+ "versions.yml:md5,71252f1a221be05593361acccb99506b",
+ "versions.yml:md5,80e9dd350be8cd4c11909d75c914757a",
+ "versions.yml:md5,bc99889446f02427c166b3219b793672",
+ "versions.yml:md5,cc8f32b7c37c35a075d38cb773004eaa"
+ ]
+ ],
+ "meta": {
+ "nf-test": "0.8.4",
+ "nextflow": "24.04.2"
+ },
+ "timestamp": "2024-07-04T17:04:46.509423"
+ },
+ "featurecounts_group_type = 'gene_type' - stub": {
+ "content": [
+ [
+ "genome_transcriptome.fasta.sizes:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ [
+ "genome_transcriptome.fasta.fai:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ [
+ "genome_transcriptome.fasta:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ [
+ "genome_transcriptome.bed:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ [
+ "genome_transcriptome.gtf:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+ "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/salmon.tar.gz"
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+ "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/transcriptome.fasta"
+ ],
+ [
+ "versions.yml:md5,0bc25597acf1d50abf7070d19d311cd7",
+ "versions.yml:md5,71252f1a221be05593361acccb99506b",
+ "versions.yml:md5,80e9dd350be8cd4c11909d75c914757a",
+ "versions.yml:md5,bc99889446f02427c166b3219b793672",
+ "versions.yml:md5,cc8f32b7c37c35a075d38cb773004eaa"
+ ]
+ ],
+ "meta": {
+ "nf-test": "0.8.4",
+ "nextflow": "24.04.2"
+ },
+ "timestamp": "2024-07-04T17:03:09.069637"
+ },
+ "gtf = false": {
+ "content": [
+ [
+ "transcriptome.fixed.fa:md5,faf3a64453ae73983bbf2743387fbdf2"
+ ],
+ [
+ "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/salmon.tar.gz"
+ ],
+ [
+ "genome_gfp.fasta:md5,e23e302af63736a199985a169fdac055"
+ ],
+ [
+ "genome_gfp.gtf:md5,68b68c059ba170af3f9d0a5dc1e0c8b8"
+ ],
+ [
+ "genome_gfp.fasta.fai:md5,8fa54c6bd2ea6a369efbb8ab4f30156a"
+ ],
+ [
+ "genome_gfp.bed:md5,991993ebef1def1d5823632c21177ec3"
+ ],
+ [
+ "genome_gfp.fasta.sizes:md5,9b755f8f349b14accefb4d859f84de26"
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+ "versions.yml:md5,0bc25597acf1d50abf7070d19d311cd7",
+ "versions.yml:md5,1cd265cb86a23a27f683ffb2459f37f5",
+ "versions.yml:md5,2a3ed31ad34b8864fb9278dcdef596ec",
+ "versions.yml:md5,71252f1a221be05593361acccb99506b",
+ "versions.yml:md5,80e9dd350be8cd4c11909d75c914757a",
+ "versions.yml:md5,961ab91198c4e6ec9d795b95e3f61fda",
+ "versions.yml:md5,bc99889446f02427c166b3219b793672"
+ ]
+ ],
+ "meta": {
+ "nf-test": "0.8.4",
+ "nextflow": "24.04.2"
+ },
+ "timestamp": "2024-07-03T19:17:19.742633"
+ },
+ "gfp = false": {
+ "content": [
+ [
+ "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/transcriptome.fasta"
+ ],
+ [
+ "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/salmon.tar.gz"
+ ],
+ [
+ "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/genome.fasta"
+ ],
+ [
+ "genome.filtered.gtf:md5,ef6fccd153a21c329670462d602ed2d0"
+ ],
+ [
+ "genome.fasta.fai:md5,2cd76d936cbfa386b14154506c2041b2"
+ ],
+ [
+ "genome.filtered.bed:md5,e507dc33673e76c32abe344f4dc07952"
+ ],
+ [
+ "genome.fasta.sizes:md5,29218009212157c49dbc6596621ec780"
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+ "versions.yml:md5,0bc25597acf1d50abf7070d19d311cd7",
+ "versions.yml:md5,71252f1a221be05593361acccb99506b",
+ "versions.yml:md5,80e9dd350be8cd4c11909d75c914757a",
+ "versions.yml:md5,bc99889446f02427c166b3219b793672"
+ ]
+ ],
+ "meta": {
+ "nf-test": "0.8.4",
+ "nextflow": "24.04.2"
+ },
+ "timestamp": "2024-07-03T19:18:06.890333"
+ },
+ "skip_bbsplit = true": {
+ "content": [
+ [
+ "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/transcriptome.fasta"
+ ],
+ [
+ "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/salmon.tar.gz"
+ ],
+ [
+ "genome_gfp.fasta:md5,e23e302af63736a199985a169fdac055"
+ ],
+ [
+ "genome_gfp.gtf:md5,c98b12c302f15731bfc36bcf297cfe28"
+ ],
+ [
+ "genome_gfp.fasta.fai:md5,8fa54c6bd2ea6a369efbb8ab4f30156a"
+ ],
+ [
+ "genome_gfp.bed:md5,991993ebef1def1d5823632c21177ec3"
+ ],
+ [
+ "genome_gfp.fasta.sizes:md5,9b755f8f349b14accefb4d859f84de26"
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+ "versions.yml:md5,1cd265cb86a23a27f683ffb2459f37f5",
+ "versions.yml:md5,71252f1a221be05593361acccb99506b",
+ "versions.yml:md5,80e9dd350be8cd4c11909d75c914757a",
+ "versions.yml:md5,bc99889446f02427c166b3219b793672"
+ ]
+ ],
+ "meta": {
+ "nf-test": "0.8.4",
+ "nextflow": "24.04.2"
+ },
+ "timestamp": "2024-07-03T19:21:45.41666"
+ },
+ "salmon_index = false - stub": {
+ "content": [
+ [
+ "genome_transcriptome.fasta.sizes:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ [
+ "genome_transcriptome.fasta.fai:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ [
+ "genome_transcriptome.fasta:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ [
+ "genome_transcriptome.bed:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ [
+ "genome_transcriptome.gtf:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+ "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/transcriptome.fasta"
+ ],
+ [
+ "versions.yml:md5,0bc25597acf1d50abf7070d19d311cd7",
+ "versions.yml:md5,71252f1a221be05593361acccb99506b",
+ "versions.yml:md5,80e9dd350be8cd4c11909d75c914757a",
+ "versions.yml:md5,bc99889446f02427c166b3219b793672",
+ "versions.yml:md5,cc8f32b7c37c35a075d38cb773004eaa"
+ ]
+ ],
+ "meta": {
+ "nf-test": "0.8.4",
+ "nextflow": "24.04.2"
+ },
+ "timestamp": "2024-07-04T17:01:54.475669"
+ },
+ "skip_alignment": {
+ "content": [
+ [
+ "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/transcriptome.fasta"
+ ],
+ [
+ "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/salmon.tar.gz"
+ ],
+ [
+ "genome_gfp.fasta:md5,e23e302af63736a199985a169fdac055"
+ ],
+ [
+ "genome_gfp.gtf:md5,c98b12c302f15731bfc36bcf297cfe28"
+ ],
+ [
+ "genome_gfp.fasta.fai:md5,8fa54c6bd2ea6a369efbb8ab4f30156a"
+ ],
+ [
+ "genome_gfp.bed:md5,991993ebef1def1d5823632c21177ec3"
+ ],
+ [
+ "genome_gfp.fasta.sizes:md5,9b755f8f349b14accefb4d859f84de26"
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+ "versions.yml:md5,0bc25597acf1d50abf7070d19d311cd7",
+ "versions.yml:md5,1cd265cb86a23a27f683ffb2459f37f5",
+ "versions.yml:md5,71252f1a221be05593361acccb99506b",
+ "versions.yml:md5,80e9dd350be8cd4c11909d75c914757a",
+ "versions.yml:md5,bc99889446f02427c166b3219b793672"
+ ]
+ ],
+ "meta": {
+ "nf-test": "0.8.4",
+ "nextflow": "24.04.2"
+ },
+ "timestamp": "2024-07-03T19:16:32.139593"
+ },
+ "gfp = false - stub": {
+ "content": [
+ [
+ "genome.fasta.sizes:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ [
+ "genome.fasta.fai:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ [
+ "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/genome.fasta"
+ ],
+ [
+ "genome.filtered.bed:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ [
+ "genome.filtered.gtf:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+ "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/salmon.tar.gz"
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+ "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/transcriptome.fasta"
+ ],
+ [
+ "versions.yml:md5,0bc25597acf1d50abf7070d19d311cd7",
+ "versions.yml:md5,71252f1a221be05593361acccb99506b",
+ "versions.yml:md5,80e9dd350be8cd4c11909d75c914757a",
+ "versions.yml:md5,bc99889446f02427c166b3219b793672"
+ ]
+ ],
+ "meta": {
+ "nf-test": "0.8.4",
+ "nextflow": "24.04.2"
+ },
+ "timestamp": "2024-07-04T17:00:21.318155"
+ },
+ "gencode = false": {
+ "content": [
+ [
+ "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/transcriptome.fasta"
+ ],
+ [
+ "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/salmon.tar.gz"
+ ],
+ [
+ "genome_gfp.fasta:md5,e23e302af63736a199985a169fdac055"
+ ],
+ [
+ "genome_gfp.gtf:md5,c98b12c302f15731bfc36bcf297cfe28"
+ ],
+ [
+ "genome_gfp.fasta.fai:md5,8fa54c6bd2ea6a369efbb8ab4f30156a"
+ ],
+ [
+ "genome_gfp.bed:md5,991993ebef1def1d5823632c21177ec3"
+ ],
+ [
+ "genome_gfp.fasta.sizes:md5,9b755f8f349b14accefb4d859f84de26"
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+ "versions.yml:md5,0bc25597acf1d50abf7070d19d311cd7",
+ "versions.yml:md5,1cd265cb86a23a27f683ffb2459f37f5",
+ "versions.yml:md5,71252f1a221be05593361acccb99506b",
+ "versions.yml:md5,80e9dd350be8cd4c11909d75c914757a",
+ "versions.yml:md5,bc99889446f02427c166b3219b793672"
+ ]
+ ],
+ "meta": {
+ "nf-test": "0.8.4",
+ "nextflow": "24.04.2"
+ },
+ "timestamp": "2024-07-03T19:15:21.650799"
+ },
+ "default options": {
+ "content": [
+ [
+ "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/transcriptome.fasta"
+ ],
+ [
+ "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/salmon.tar.gz"
+ ],
+ [
+ "genome_gfp.fasta:md5,e23e302af63736a199985a169fdac055"
+ ],
+ [
+ "genome_gfp.gtf:md5,c98b12c302f15731bfc36bcf297cfe28"
+ ],
+ [
+ "genome_gfp.fasta.fai:md5,8fa54c6bd2ea6a369efbb8ab4f30156a"
+ ],
+ [
+ "genome_gfp.bed:md5,991993ebef1def1d5823632c21177ec3"
+ ],
+ [
+ "genome_gfp.fasta.sizes:md5,9b755f8f349b14accefb4d859f84de26"
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+ "versions.yml:md5,0bc25597acf1d50abf7070d19d311cd7",
+ "versions.yml:md5,1cd265cb86a23a27f683ffb2459f37f5",
+ "versions.yml:md5,71252f1a221be05593361acccb99506b",
+ "versions.yml:md5,80e9dd350be8cd4c11909d75c914757a",
+ "versions.yml:md5,bc99889446f02427c166b3219b793672"
+ ]
+ ],
+ "meta": {
+ "nf-test": "0.8.4",
+ "nextflow": "24.04.2"
+ },
+ "timestamp": "2024-07-03T19:14:58.879047"
+ },
+ "gencode = true - stub": {
+ "content": [
+ [
+ "genome_transcriptome.fasta.sizes:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ [
+ "genome_transcriptome.fasta.fai:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ [
+ "genome_transcriptome.fasta:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ [
+ "genome_transcriptome.bed:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ [
+ "genome_transcriptome.gtf:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+ "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/salmon.tar.gz"
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+ "transcriptome.fixed.fa:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ [
+ "versions.yml:md5,0bc25597acf1d50abf7070d19d311cd7",
+ "versions.yml:md5,71252f1a221be05593361acccb99506b",
+ "versions.yml:md5,80e9dd350be8cd4c11909d75c914757a",
+ "versions.yml:md5,961ab91198c4e6ec9d795b95e3f61fda",
+ "versions.yml:md5,bc99889446f02427c166b3219b793672",
+ "versions.yml:md5,cc8f32b7c37c35a075d38cb773004eaa"
+ ]
+ ],
+ "meta": {
+ "nf-test": "0.8.4",
+ "nextflow": "24.04.2"
+ },
+ "timestamp": "2024-07-04T17:02:45.316528"
+ },
+ "skip_alignment - stub": {
+ "content": [
+ [
+ "genome_transcriptome.fasta.sizes:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ [
+ "genome_transcriptome.fasta.fai:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ [
+ "genome_transcriptome.fasta:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ [
+ "genome_transcriptome.bed:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ [
+ "genome_transcriptome.gtf:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+ "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/salmon.tar.gz"
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+ "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/transcriptome.fasta"
+ ],
+ [
+ "versions.yml:md5,0bc25597acf1d50abf7070d19d311cd7",
+ "versions.yml:md5,71252f1a221be05593361acccb99506b",
+ "versions.yml:md5,80e9dd350be8cd4c11909d75c914757a",
+ "versions.yml:md5,bc99889446f02427c166b3219b793672",
+ "versions.yml:md5,cc8f32b7c37c35a075d38cb773004eaa"
+ ]
+ ],
+ "meta": {
+ "nf-test": "0.8.4",
+ "nextflow": "24.04.2"
+ },
+ "timestamp": "2024-07-04T16:58:40.569654"
+ },
+ "skip_bbsplit = true - stub": {
+ "content": [
+ {
+ "0": [
+ "genome_transcriptome.fasta:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ "1": [
+ "genome_transcriptome.gtf:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ "10": [
+
+ ],
+ "11": [
+
+ ],
+ "12": [
+
+ ],
+ "13": [
+ "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/salmon.tar.gz"
+ ],
+ "14": [
+
+ ],
+ "15": [
+ "versions.yml:md5,71252f1a221be05593361acccb99506b",
+ "versions.yml:md5,80e9dd350be8cd4c11909d75c914757a",
+ "versions.yml:md5,bc99889446f02427c166b3219b793672",
+ "versions.yml:md5,cc8f32b7c37c35a075d38cb773004eaa"
+ ],
+ "2": [
+ "genome_transcriptome.fasta.fai:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ "3": [
+ "genome_transcriptome.bed:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ "4": [
+ "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/transcriptome.fasta"
+ ],
+ "5": [
+ "genome_transcriptome.fasta.sizes:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ "6": [
+
+ ],
+ "7": [
+
+ ],
+ "8": [
+
+ ],
+ "9": [
+
+ ],
+ "bbsplit_index": [
+
+ ],
+ "chrom_sizes": [
+ "genome_transcriptome.fasta.sizes:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ "fai": [
+ "genome_transcriptome.fasta.fai:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ "fasta": [
+ "genome_transcriptome.fasta:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ "gene_bed": [
+ "genome_transcriptome.bed:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ "gtf": [
+ "genome_transcriptome.gtf:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ "hisat2_index": [
+
+ ],
+ "kallisto_index": [
+
+ ],
+ "rrna_fastas": [
+
+ ],
+ "rsem_index": [
+
+ ],
+ "salmon_index": [
+ "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/salmon.tar.gz"
+ ],
+ "sortmerna_index": [
+
+ ],
+ "splicesites": [
+
+ ],
+ "star_index": [
+
+ ],
+ "transcript_fasta": [
+ "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/transcriptome.fasta"
+ ],
+ "versions": [
+ "versions.yml:md5,71252f1a221be05593361acccb99506b",
+ "versions.yml:md5,80e9dd350be8cd4c11909d75c914757a",
+ "versions.yml:md5,bc99889446f02427c166b3219b793672",
+ "versions.yml:md5,cc8f32b7c37c35a075d38cb773004eaa"
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
+ },
+ "timestamp": "2024-07-22T12:56:12.856413"
+ },
+ "transcriptome = false": {
"content": [
[
- "transcriptome.fixed.fa:md5,faf3a64453ae73983bbf2743387fbdf2"
+ "genome.transcripts.fa:md5,b89a3e02ad30ba3fd600f98c8e2f58d4"
],
[
"/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/salmon.tar.gz"
@@ -11,7 +1057,7 @@
"genome_gfp.fasta:md5,e23e302af63736a199985a169fdac055"
],
[
- "genome_gfp.gtf:md5,2593a0843dd97f0b7dfb62cdd2c21ab8"
+ "genome_gfp.gtf:md5,c98b12c302f15731bfc36bcf297cfe28"
],
[
"genome_gfp.fasta.fai:md5,8fa54c6bd2ea6a369efbb8ab4f30156a"
@@ -45,23 +1091,23 @@
"versions.yml:md5,1cd265cb86a23a27f683ffb2459f37f5",
"versions.yml:md5,71252f1a221be05593361acccb99506b",
"versions.yml:md5,80e9dd350be8cd4c11909d75c914757a",
- "versions.yml:md5,961ab91198c4e6ec9d795b95e3f61fda",
+ "versions.yml:md5,918fe0b59c0986eb602ace85841c5ab3",
"versions.yml:md5,bc99889446f02427c166b3219b793672"
]
],
"meta": {
"nf-test": "0.8.4",
- "nextflow": "24.04.1"
+ "nextflow": "24.04.2"
},
- "timestamp": "2024-06-20T18:17:05.661629"
+ "timestamp": "2024-07-03T19:18:30.8944"
},
- "hisat2_index = false": {
+ "skip_pseudoalignment = true": {
"content": [
[
"/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/transcriptome.fasta"
],
[
-
+ "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/salmon.tar.gz"
],
[
"genome_gfp.fasta:md5,e23e302af63736a199985a169fdac055"
@@ -106,38 +1152,38 @@
],
"meta": {
"nf-test": "0.8.4",
- "nextflow": "24.04.1"
+ "nextflow": "24.04.2"
},
- "timestamp": "2024-06-20T18:16:45.642259"
+ "timestamp": "2024-07-03T19:22:33.169752"
},
- "featurecounts_group_type = 'gene_type'": {
+ "skip_gtf_filter - stub": {
"content": [
[
- "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/transcriptome.fasta"
+ "genome_transcriptome.fasta.sizes:md5,d41d8cd98f00b204e9800998ecf8427e"
],
[
- "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/salmon.tar.gz"
+ "genome_transcriptome.fasta.fai:md5,d41d8cd98f00b204e9800998ecf8427e"
],
[
- "genome_gfp.fasta:md5,e23e302af63736a199985a169fdac055"
+ "genome_transcriptome.fasta:md5,d41d8cd98f00b204e9800998ecf8427e"
],
[
- "genome_gfp.gtf:md5,2593a0843dd97f0b7dfb62cdd2c21ab8"
+ "genome_transcriptome.bed:md5,d41d8cd98f00b204e9800998ecf8427e"
],
[
- "genome_gfp.fasta.fai:md5,8fa54c6bd2ea6a369efbb8ab4f30156a"
+ "genome_transcriptome.gtf:md5,d41d8cd98f00b204e9800998ecf8427e"
],
[
- "genome_gfp.bed:md5,991993ebef1def1d5823632c21177ec3"
+
],
[
- "genome_gfp.fasta.sizes:md5,9b755f8f349b14accefb4d859f84de26"
+
],
[
],
[
-
+ "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/salmon.tar.gz"
],
[
@@ -149,26 +1195,25 @@
],
[
-
+ "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/transcriptome.fasta"
],
[
"versions.yml:md5,0bc25597acf1d50abf7070d19d311cd7",
- "versions.yml:md5,1cd265cb86a23a27f683ffb2459f37f5",
"versions.yml:md5,71252f1a221be05593361acccb99506b",
- "versions.yml:md5,80e9dd350be8cd4c11909d75c914757a",
- "versions.yml:md5,bc99889446f02427c166b3219b793672"
+ "versions.yml:md5,bc99889446f02427c166b3219b793672",
+ "versions.yml:md5,cc8f32b7c37c35a075d38cb773004eaa"
]
],
"meta": {
"nf-test": "0.8.4",
- "nextflow": "24.04.1"
+ "nextflow": "24.04.2"
},
- "timestamp": "2024-06-20T18:17:22.714024"
+ "timestamp": "2024-07-04T16:57:47.201179"
},
- "skip_gtf_filter": {
+ "gencode = true": {
"content": [
[
- "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/transcriptome.fasta"
+ "transcriptome.fixed.fa:md5,faf3a64453ae73983bbf2743387fbdf2"
],
[
"/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/salmon.tar.gz"
@@ -177,7 +1222,7 @@
"genome_gfp.fasta:md5,e23e302af63736a199985a169fdac055"
],
[
- "genome_gfp.gtf:md5,5e63cda3dcafc0d6ad0a738133af9d54"
+ "genome_gfp.gtf:md5,2593a0843dd97f0b7dfb62cdd2c21ab8"
],
[
"genome_gfp.fasta.fai:md5,8fa54c6bd2ea6a369efbb8ab4f30156a"
@@ -210,28 +1255,30 @@
"versions.yml:md5,0bc25597acf1d50abf7070d19d311cd7",
"versions.yml:md5,1cd265cb86a23a27f683ffb2459f37f5",
"versions.yml:md5,71252f1a221be05593361acccb99506b",
+ "versions.yml:md5,80e9dd350be8cd4c11909d75c914757a",
+ "versions.yml:md5,961ab91198c4e6ec9d795b95e3f61fda",
"versions.yml:md5,bc99889446f02427c166b3219b793672"
]
],
"meta": {
"nf-test": "0.8.4",
- "nextflow": "24.04.1"
+ "nextflow": "24.04.2"
},
- "timestamp": "2024-06-20T18:13:30.196042"
+ "timestamp": "2024-07-03T19:20:32.664472"
},
- "gtf = false": {
+ "hisat2_index = false": {
"content": [
[
- "transcriptome.fixed.fa:md5,faf3a64453ae73983bbf2743387fbdf2"
+ "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/transcriptome.fasta"
],
[
- "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/salmon.tar.gz"
+
],
[
"genome_gfp.fasta:md5,e23e302af63736a199985a169fdac055"
],
[
- "genome_gfp.gtf:md5,68b68c059ba170af3f9d0a5dc1e0c8b8"
+ "genome_gfp.gtf:md5,c98b12c302f15731bfc36bcf297cfe28"
],
[
"genome_gfp.fasta.fai:md5,8fa54c6bd2ea6a369efbb8ab4f30156a"
@@ -263,47 +1310,45 @@
[
"versions.yml:md5,0bc25597acf1d50abf7070d19d311cd7",
"versions.yml:md5,1cd265cb86a23a27f683ffb2459f37f5",
- "versions.yml:md5,2a3ed31ad34b8864fb9278dcdef596ec",
"versions.yml:md5,71252f1a221be05593361acccb99506b",
"versions.yml:md5,80e9dd350be8cd4c11909d75c914757a",
- "versions.yml:md5,961ab91198c4e6ec9d795b95e3f61fda",
"versions.yml:md5,bc99889446f02427c166b3219b793672"
]
],
"meta": {
"nf-test": "0.8.4",
- "nextflow": "24.04.1"
+ "nextflow": "24.04.2"
},
- "timestamp": "2024-06-20T18:14:42.913968"
+ "timestamp": "2024-07-03T19:20:06.853577"
},
- "gfp = false": {
+ "rsem_index = false - stub": {
"content": [
[
- "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/transcriptome.fasta"
+ "genome_transcriptome.fasta.sizes:md5,d41d8cd98f00b204e9800998ecf8427e"
],
[
- "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/salmon.tar.gz"
+ "genome_transcriptome.fasta.fai:md5,d41d8cd98f00b204e9800998ecf8427e"
],
[
- "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/genome.fasta"
+ "genome_transcriptome.fasta:md5,d41d8cd98f00b204e9800998ecf8427e"
],
[
- "genome.filtered.gtf:md5,ef6fccd153a21c329670462d602ed2d0"
+ "genome_transcriptome.bed:md5,d41d8cd98f00b204e9800998ecf8427e"
],
[
- "genome.fasta.fai:md5,2cd76d936cbfa386b14154506c2041b2"
+ "genome_transcriptome.gtf:md5,d41d8cd98f00b204e9800998ecf8427e"
],
[
- "genome.filtered.bed:md5,e507dc33673e76c32abe344f4dc07952"
+
],
[
- "genome.fasta.sizes:md5,29218009212157c49dbc6596621ec780"
+
],
[
],
[
-
+ "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/salmon.tar.gz"
],
[
@@ -315,22 +1360,23 @@
],
[
-
+ "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/transcriptome.fasta"
],
[
"versions.yml:md5,0bc25597acf1d50abf7070d19d311cd7",
"versions.yml:md5,71252f1a221be05593361acccb99506b",
"versions.yml:md5,80e9dd350be8cd4c11909d75c914757a",
- "versions.yml:md5,bc99889446f02427c166b3219b793672"
+ "versions.yml:md5,bc99889446f02427c166b3219b793672",
+ "versions.yml:md5,cc8f32b7c37c35a075d38cb773004eaa"
]
],
"meta": {
"nf-test": "0.8.4",
- "nextflow": "24.04.1"
+ "nextflow": "24.04.2"
},
- "timestamp": "2024-06-20T18:15:16.551347"
+ "timestamp": "2024-07-04T17:01:29.423708"
},
- "skip_bbsplit": {
+ "featurecounts_group_type = 'gene_type'": {
"content": [
[
"/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/transcriptome.fasta"
@@ -342,7 +1388,7 @@
"genome_gfp.fasta:md5,e23e302af63736a199985a169fdac055"
],
[
- "genome_gfp.gtf:md5,c98b12c302f15731bfc36bcf297cfe28"
+ "genome_gfp.gtf:md5,2593a0843dd97f0b7dfb62cdd2c21ab8"
],
[
"genome_gfp.fasta.fai:md5,8fa54c6bd2ea6a369efbb8ab4f30156a"
@@ -372,6 +1418,7 @@
],
[
+ "versions.yml:md5,0bc25597acf1d50abf7070d19d311cd7",
"versions.yml:md5,1cd265cb86a23a27f683ffb2459f37f5",
"versions.yml:md5,71252f1a221be05593361acccb99506b",
"versions.yml:md5,80e9dd350be8cd4c11909d75c914757a",
@@ -380,11 +1427,65 @@
],
"meta": {
"nf-test": "0.8.4",
- "nextflow": "24.04.1"
+ "nextflow": "24.04.2"
},
- "timestamp": "2024-06-20T18:13:46.28042"
+ "timestamp": "2024-07-03T19:20:57.049579"
},
- "skip_bbsplit = true": {
+ "with bed - stub": {
+ "content": [
+ [
+ "genome_transcriptome.fasta.sizes:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ [
+ "genome_transcriptome.fasta.fai:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ [
+ "genome_transcriptome.fasta:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ [
+ "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/ngscheckmate.bed"
+ ],
+ [
+ "genome_transcriptome.gtf:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+ "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/salmon.tar.gz"
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+ "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/transcriptome.fasta"
+ ],
+ [
+ "versions.yml:md5,0bc25597acf1d50abf7070d19d311cd7",
+ "versions.yml:md5,80e9dd350be8cd4c11909d75c914757a",
+ "versions.yml:md5,bc99889446f02427c166b3219b793672",
+ "versions.yml:md5,cc8f32b7c37c35a075d38cb773004eaa"
+ ]
+ ],
+ "meta": {
+ "nf-test": "0.8.4",
+ "nextflow": "24.04.2"
+ },
+ "timestamp": "2024-07-04T17:01:05.223077"
+ },
+ "skip_pseudo_alignment": {
"content": [
[
"/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/transcriptome.fasta"
@@ -426,6 +1527,7 @@
],
[
+ "versions.yml:md5,0bc25597acf1d50abf7070d19d311cd7",
"versions.yml:md5,1cd265cb86a23a27f683ffb2459f37f5",
"versions.yml:md5,71252f1a221be05593361acccb99506b",
"versions.yml:md5,80e9dd350be8cd4c11909d75c914757a",
@@ -434,11 +1536,11 @@
],
"meta": {
"nf-test": "0.8.4",
- "nextflow": "24.04.1"
+ "nextflow": "24.04.2"
},
- "timestamp": "2024-06-20T18:17:57.14732"
+ "timestamp": "2024-07-03T19:16:56.725751"
},
- "with bed": {
+ "skip_bbsplit": {
"content": [
[
"/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/transcriptome.fasta"
@@ -456,7 +1558,7 @@
"genome_gfp.fasta.fai:md5,8fa54c6bd2ea6a369efbb8ab4f30156a"
],
[
- "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/ngscheckmate.bed"
+ "genome_gfp.bed:md5,991993ebef1def1d5823632c21177ec3"
],
[
"genome_gfp.fasta.sizes:md5,9b755f8f349b14accefb4d859f84de26"
@@ -480,19 +1582,19 @@
],
[
- "versions.yml:md5,0bc25597acf1d50abf7070d19d311cd7",
"versions.yml:md5,1cd265cb86a23a27f683ffb2459f37f5",
+ "versions.yml:md5,71252f1a221be05593361acccb99506b",
"versions.yml:md5,80e9dd350be8cd4c11909d75c914757a",
"versions.yml:md5,bc99889446f02427c166b3219b793672"
]
],
"meta": {
"nf-test": "0.8.4",
- "nextflow": "24.04.1"
+ "nextflow": "24.04.2"
},
- "timestamp": "2024-06-20T18:15:52.284517"
+ "timestamp": "2024-07-03T19:16:08.147358"
},
- "skip_alignment": {
+ "with bed": {
"content": [
[
"/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/transcriptome.fasta"
@@ -510,7 +1612,7 @@
"genome_gfp.fasta.fai:md5,8fa54c6bd2ea6a369efbb8ab4f30156a"
],
[
- "genome_gfp.bed:md5,991993ebef1def1d5823632c21177ec3"
+ "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/ngscheckmate.bed"
],
[
"genome_gfp.fasta.sizes:md5,9b755f8f349b14accefb4d859f84de26"
@@ -536,45 +1638,44 @@
[
"versions.yml:md5,0bc25597acf1d50abf7070d19d311cd7",
"versions.yml:md5,1cd265cb86a23a27f683ffb2459f37f5",
- "versions.yml:md5,71252f1a221be05593361acccb99506b",
"versions.yml:md5,80e9dd350be8cd4c11909d75c914757a",
"versions.yml:md5,bc99889446f02427c166b3219b793672"
]
],
"meta": {
"nf-test": "0.8.4",
- "nextflow": "24.04.1"
+ "nextflow": "24.04.2"
},
- "timestamp": "2024-06-20T18:14:04.612027"
+ "timestamp": "2024-07-03T19:18:54.706918"
},
- "gencode = false": {
+ "gtf = false - stub": {
"content": [
[
- "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/transcriptome.fasta"
+ "genome_transcriptome.fasta.sizes:md5,d41d8cd98f00b204e9800998ecf8427e"
],
[
- "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/salmon.tar.gz"
+ "genome_transcriptome.fasta.fai:md5,d41d8cd98f00b204e9800998ecf8427e"
],
[
- "genome_gfp.fasta:md5,e23e302af63736a199985a169fdac055"
+ "genome_transcriptome.fasta:md5,d41d8cd98f00b204e9800998ecf8427e"
],
[
- "genome_gfp.gtf:md5,c98b12c302f15731bfc36bcf297cfe28"
+ "genome_transcriptome.bed:md5,d41d8cd98f00b204e9800998ecf8427e"
],
[
- "genome_gfp.fasta.fai:md5,8fa54c6bd2ea6a369efbb8ab4f30156a"
+ "genome_transcriptome.gtf:md5,d41d8cd98f00b204e9800998ecf8427e"
],
[
- "genome_gfp.bed:md5,991993ebef1def1d5823632c21177ec3"
+
],
[
- "genome_gfp.fasta.sizes:md5,9b755f8f349b14accefb4d859f84de26"
+
],
[
],
[
-
+ "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/salmon.tar.gz"
],
[
@@ -586,21 +1687,23 @@
],
[
-
+ "transcriptome.fixed.fa:md5,d41d8cd98f00b204e9800998ecf8427e"
],
[
"versions.yml:md5,0bc25597acf1d50abf7070d19d311cd7",
- "versions.yml:md5,1cd265cb86a23a27f683ffb2459f37f5",
+ "versions.yml:md5,2a3ed31ad34b8864fb9278dcdef596ec",
"versions.yml:md5,71252f1a221be05593361acccb99506b",
"versions.yml:md5,80e9dd350be8cd4c11909d75c914757a",
- "versions.yml:md5,bc99889446f02427c166b3219b793672"
+ "versions.yml:md5,961ab91198c4e6ec9d795b95e3f61fda",
+ "versions.yml:md5,bc99889446f02427c166b3219b793672",
+ "versions.yml:md5,cc8f32b7c37c35a075d38cb773004eaa"
]
],
"meta": {
"nf-test": "0.8.4",
- "nextflow": "24.04.1"
+ "nextflow": "24.04.2"
},
- "timestamp": "2024-06-20T18:13:13.483047"
+ "timestamp": "2024-07-04T16:59:30.478197"
},
"gff = false": {
"content": [
@@ -653,38 +1756,38 @@
],
"meta": {
"nf-test": "0.8.4",
- "nextflow": "24.04.1"
+ "nextflow": "24.04.2"
},
- "timestamp": "2024-06-20T18:15:00.759762"
+ "timestamp": "2024-07-03T19:17:45.167724"
},
- "default options": {
+ "default options - stub": {
"content": [
[
- "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/transcriptome.fasta"
+ "genome_transcriptome.fasta.sizes:md5,d41d8cd98f00b204e9800998ecf8427e"
],
[
- "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/salmon.tar.gz"
+ "genome_transcriptome.fasta.fai:md5,d41d8cd98f00b204e9800998ecf8427e"
],
[
- "genome_gfp.fasta:md5,e23e302af63736a199985a169fdac055"
+ "genome_transcriptome.fasta:md5,d41d8cd98f00b204e9800998ecf8427e"
],
[
- "genome_gfp.gtf:md5,c98b12c302f15731bfc36bcf297cfe28"
+ "genome_transcriptome.bed:md5,d41d8cd98f00b204e9800998ecf8427e"
],
[
- "genome_gfp.fasta.fai:md5,8fa54c6bd2ea6a369efbb8ab4f30156a"
+ "genome_transcriptome.gtf:md5,d41d8cd98f00b204e9800998ecf8427e"
],
[
- "genome_gfp.bed:md5,991993ebef1def1d5823632c21177ec3"
+
],
[
- "genome_gfp.fasta.sizes:md5,9b755f8f349b14accefb4d859f84de26"
+
],
[
],
[
-
+ "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/salmon.tar.gz"
],
[
@@ -696,21 +1799,21 @@
],
[
-
+ "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/transcriptome.fasta"
],
[
"versions.yml:md5,0bc25597acf1d50abf7070d19d311cd7",
- "versions.yml:md5,1cd265cb86a23a27f683ffb2459f37f5",
"versions.yml:md5,71252f1a221be05593361acccb99506b",
"versions.yml:md5,80e9dd350be8cd4c11909d75c914757a",
- "versions.yml:md5,bc99889446f02427c166b3219b793672"
+ "versions.yml:md5,bc99889446f02427c166b3219b793672",
+ "versions.yml:md5,cc8f32b7c37c35a075d38cb773004eaa"
]
],
"meta": {
"nf-test": "0.8.4",
- "nextflow": "24.04.1"
+ "nextflow": "24.04.2"
},
- "timestamp": "2024-06-20T18:12:54.779065"
+ "timestamp": "2024-07-04T16:56:58.012938"
},
"salmon_index = false": {
"content": [
@@ -763,9 +1866,9 @@
],
"meta": {
"nf-test": "0.8.4",
- "nextflow": "24.04.1"
+ "nextflow": "24.04.2"
},
- "timestamp": "2024-06-20T18:16:27.229869"
+ "timestamp": "2024-07-03T19:19:42.999843"
},
"rsem_index = false": {
"content": [
@@ -818,38 +1921,38 @@
],
"meta": {
"nf-test": "0.8.4",
- "nextflow": "24.04.1"
+ "nextflow": "24.04.2"
},
- "timestamp": "2024-06-20T18:16:09.968836"
+ "timestamp": "2024-07-03T19:19:19.357926"
},
- "skip_psuedo_alignment": {
+ "skip_alignment = true - stub": {
"content": [
[
- "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/transcriptome.fasta"
+ "genome_transcriptome.fasta.sizes:md5,d41d8cd98f00b204e9800998ecf8427e"
],
[
- "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/salmon.tar.gz"
+ "genome_transcriptome.fasta.fai:md5,d41d8cd98f00b204e9800998ecf8427e"
],
[
- "genome_gfp.fasta:md5,e23e302af63736a199985a169fdac055"
+ "genome_transcriptome.fasta:md5,d41d8cd98f00b204e9800998ecf8427e"
],
[
- "genome_gfp.gtf:md5,c98b12c302f15731bfc36bcf297cfe28"
+ "genome_transcriptome.bed:md5,d41d8cd98f00b204e9800998ecf8427e"
],
[
- "genome_gfp.fasta.fai:md5,8fa54c6bd2ea6a369efbb8ab4f30156a"
+ "genome_transcriptome.gtf:md5,d41d8cd98f00b204e9800998ecf8427e"
],
[
- "genome_gfp.bed:md5,991993ebef1def1d5823632c21177ec3"
+
],
[
- "genome_gfp.fasta.sizes:md5,9b755f8f349b14accefb4d859f84de26"
+
],
[
],
[
-
+ "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/salmon.tar.gz"
],
[
@@ -861,50 +1964,50 @@
],
[
-
+ "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/transcriptome.fasta"
],
[
"versions.yml:md5,0bc25597acf1d50abf7070d19d311cd7",
- "versions.yml:md5,1cd265cb86a23a27f683ffb2459f37f5",
"versions.yml:md5,71252f1a221be05593361acccb99506b",
"versions.yml:md5,80e9dd350be8cd4c11909d75c914757a",
- "versions.yml:md5,bc99889446f02427c166b3219b793672"
+ "versions.yml:md5,bc99889446f02427c166b3219b793672",
+ "versions.yml:md5,cc8f32b7c37c35a075d38cb773004eaa"
]
],
"meta": {
"nf-test": "0.8.4",
- "nextflow": "24.04.1"
+ "nextflow": "24.04.2"
},
- "timestamp": "2024-06-20T18:14:22.598093"
+ "timestamp": "2024-07-04T17:04:20.276533"
},
- "transcriptome = false": {
+ "transcriptome = false - stub": {
"content": [
[
- "genome.transcripts.fa:md5,b89a3e02ad30ba3fd600f98c8e2f58d4"
+ "genome_transcriptome.fasta.sizes:md5,d41d8cd98f00b204e9800998ecf8427e"
],
[
- "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/salmon.tar.gz"
+ "genome_transcriptome.fasta.fai:md5,d41d8cd98f00b204e9800998ecf8427e"
],
[
- "genome_gfp.fasta:md5,e23e302af63736a199985a169fdac055"
+ "genome_transcriptome.fasta:md5,d41d8cd98f00b204e9800998ecf8427e"
],
[
- "genome_gfp.gtf:md5,c98b12c302f15731bfc36bcf297cfe28"
+ "genome_transcriptome.bed:md5,d41d8cd98f00b204e9800998ecf8427e"
],
[
- "genome_gfp.fasta.fai:md5,8fa54c6bd2ea6a369efbb8ab4f30156a"
+ "genome_transcriptome.gtf:md5,d41d8cd98f00b204e9800998ecf8427e"
],
[
- "genome_gfp.bed:md5,991993ebef1def1d5823632c21177ec3"
+
],
[
- "genome_gfp.fasta.sizes:md5,9b755f8f349b14accefb4d859f84de26"
+
],
[
],
[
-
+ "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/salmon.tar.gz"
],
[
@@ -916,24 +2019,24 @@
],
[
-
+ "genome.transcripts.fa:md5,d41d8cd98f00b204e9800998ecf8427e"
],
[
"versions.yml:md5,0bc25597acf1d50abf7070d19d311cd7",
- "versions.yml:md5,1cd265cb86a23a27f683ffb2459f37f5",
"versions.yml:md5,71252f1a221be05593361acccb99506b",
"versions.yml:md5,80e9dd350be8cd4c11909d75c914757a",
"versions.yml:md5,918fe0b59c0986eb602ace85841c5ab3",
- "versions.yml:md5,bc99889446f02427c166b3219b793672"
+ "versions.yml:md5,bc99889446f02427c166b3219b793672",
+ "versions.yml:md5,cc8f32b7c37c35a075d38cb773004eaa"
]
],
"meta": {
"nf-test": "0.8.4",
- "nextflow": "24.04.1"
+ "nextflow": "24.04.2"
},
- "timestamp": "2024-06-20T18:15:34.269049"
+ "timestamp": "2024-07-04T17:00:43.920677"
},
- "skip_pseudoalignment = true": {
+ "skip_alignment = true": {
"content": [
[
"/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/transcriptome.fasta"
@@ -984,11 +2087,11 @@
],
"meta": {
"nf-test": "0.8.4",
- "nextflow": "24.04.1"
+ "nextflow": "24.04.2"
},
- "timestamp": "2024-06-20T18:18:35.783312"
+ "timestamp": "2024-07-03T19:22:08.9618"
},
- "skip_alignment = true": {
+ "skip_gtf_filter = true": {
"content": [
[
"/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/transcriptome.fasta"
@@ -1000,7 +2103,7 @@
"genome_gfp.fasta:md5,e23e302af63736a199985a169fdac055"
],
[
- "genome_gfp.gtf:md5,c98b12c302f15731bfc36bcf297cfe28"
+ "genome_gfp.gtf:md5,5e63cda3dcafc0d6ad0a738133af9d54"
],
[
"genome_gfp.fasta.fai:md5,8fa54c6bd2ea6a369efbb8ab4f30156a"
@@ -1033,38 +2136,37 @@
"versions.yml:md5,0bc25597acf1d50abf7070d19d311cd7",
"versions.yml:md5,1cd265cb86a23a27f683ffb2459f37f5",
"versions.yml:md5,71252f1a221be05593361acccb99506b",
- "versions.yml:md5,80e9dd350be8cd4c11909d75c914757a",
"versions.yml:md5,bc99889446f02427c166b3219b793672"
]
],
"meta": {
"nf-test": "0.8.4",
- "nextflow": "24.04.1"
+ "nextflow": "24.04.2"
},
- "timestamp": "2024-06-20T18:18:16.883006"
+ "timestamp": "2024-07-03T19:21:18.583526"
},
- "skip_gtf_filter = true": {
+ "hisat2_index = false - stub": {
"content": [
[
- "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/transcriptome.fasta"
+ "genome_transcriptome.fasta.sizes:md5,d41d8cd98f00b204e9800998ecf8427e"
],
[
- "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/salmon.tar.gz"
+ "genome_transcriptome.fasta.fai:md5,d41d8cd98f00b204e9800998ecf8427e"
],
[
- "genome_gfp.fasta:md5,e23e302af63736a199985a169fdac055"
+ "genome_transcriptome.fasta:md5,d41d8cd98f00b204e9800998ecf8427e"
],
[
- "genome_gfp.gtf:md5,5e63cda3dcafc0d6ad0a738133af9d54"
+ "genome_transcriptome.bed:md5,d41d8cd98f00b204e9800998ecf8427e"
],
[
- "genome_gfp.fasta.fai:md5,8fa54c6bd2ea6a369efbb8ab4f30156a"
+ "genome_transcriptome.gtf:md5,d41d8cd98f00b204e9800998ecf8427e"
],
[
- "genome_gfp.bed:md5,991993ebef1def1d5823632c21177ec3"
+
],
[
- "genome_gfp.fasta.sizes:md5,9b755f8f349b14accefb4d859f84de26"
+
],
[
@@ -1082,19 +2184,133 @@
],
[
-
+ "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/transcriptome.fasta"
],
[
"versions.yml:md5,0bc25597acf1d50abf7070d19d311cd7",
- "versions.yml:md5,1cd265cb86a23a27f683ffb2459f37f5",
"versions.yml:md5,71252f1a221be05593361acccb99506b",
- "versions.yml:md5,bc99889446f02427c166b3219b793672"
+ "versions.yml:md5,80e9dd350be8cd4c11909d75c914757a",
+ "versions.yml:md5,bc99889446f02427c166b3219b793672",
+ "versions.yml:md5,cc8f32b7c37c35a075d38cb773004eaa"
]
],
"meta": {
"nf-test": "0.8.4",
- "nextflow": "24.04.1"
+ "nextflow": "24.04.2"
+ },
+ "timestamp": "2024-07-04T17:02:19.539518"
+ },
+ "skip_bbsplit - stub": {
+ "content": [
+ {
+ "0": [
+ "genome_transcriptome.fasta:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ "1": [
+ "genome_transcriptome.gtf:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ "10": [
+
+ ],
+ "11": [
+
+ ],
+ "12": [
+
+ ],
+ "13": [
+ "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/salmon.tar.gz"
+ ],
+ "14": [
+
+ ],
+ "15": [
+ "versions.yml:md5,71252f1a221be05593361acccb99506b",
+ "versions.yml:md5,80e9dd350be8cd4c11909d75c914757a",
+ "versions.yml:md5,bc99889446f02427c166b3219b793672",
+ "versions.yml:md5,cc8f32b7c37c35a075d38cb773004eaa"
+ ],
+ "2": [
+ "genome_transcriptome.fasta.fai:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ "3": [
+ "genome_transcriptome.bed:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ "4": [
+ "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/transcriptome.fasta"
+ ],
+ "5": [
+ "genome_transcriptome.fasta.sizes:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ "6": [
+
+ ],
+ "7": [
+
+ ],
+ "8": [
+
+ ],
+ "9": [
+
+ ],
+ "bbsplit_index": [
+
+ ],
+ "chrom_sizes": [
+ "genome_transcriptome.fasta.sizes:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ "fai": [
+ "genome_transcriptome.fasta.fai:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ "fasta": [
+ "genome_transcriptome.fasta:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ "gene_bed": [
+ "genome_transcriptome.bed:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ "gtf": [
+ "genome_transcriptome.gtf:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ "hisat2_index": [
+
+ ],
+ "kallisto_index": [
+
+ ],
+ "rrna_fastas": [
+
+ ],
+ "rsem_index": [
+
+ ],
+ "salmon_index": [
+ "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/salmon.tar.gz"
+ ],
+ "sortmerna_index": [
+
+ ],
+ "splicesites": [
+
+ ],
+ "star_index": [
+
+ ],
+ "transcript_fasta": [
+ "/ngi-igenomes/testdata/nf-core/pipelines/rnaseq/3.15/reference/transcriptome.fasta"
+ ],
+ "versions": [
+ "versions.yml:md5,71252f1a221be05593361acccb99506b",
+ "versions.yml:md5,80e9dd350be8cd4c11909d75c914757a",
+ "versions.yml:md5,bc99889446f02427c166b3219b793672",
+ "versions.yml:md5,cc8f32b7c37c35a075d38cb773004eaa"
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
},
- "timestamp": "2024-06-20T18:17:39.358651"
+ "timestamp": "2024-07-22T12:50:45.029123"
}
}
\ No newline at end of file
diff --git a/subworkflows/local/quantify_rsem/tests/main.nf.test b/subworkflows/local/quantify_rsem/tests/main.nf.test
index 818282af3..bba6f4372 100644
--- a/subworkflows/local/quantify_rsem/tests/main.nf.test
+++ b/subworkflows/local/quantify_rsem/tests/main.nf.test
@@ -39,6 +39,7 @@ nextflow_workflow {
assertAll(
{ assert workflow.success },
{ assert snapshot(
+ file(workflow.out.logs[0][1]).name,
workflow.out.counts_gene,
workflow.out.counts_transcript,
workflow.out.stat,
@@ -57,11 +58,48 @@ nextflow_workflow {
workflow.out.merged_counts_transcript,
workflow.out.merged_tpm_transcript,
workflow.out.versions
- ).match()
- },
- { assert snapshot(file(workflow.out.logs[0][1]).name).match('logs') }
+ ).match()}
)
}
}
+ test("homo_sapiens - stub") {
+
+ options "-stub"
+
+ setup {
+ run("RSEM_PREPAREREFERENCE") {
+ script "../../../../modules/nf-core/rsem/preparereference/main.nf"
+ process {
+ """
+ input[0] = Channel.of(file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true))
+ input[1] = Channel.of(file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true))
+ """
+ }
+ }
+ }
+
+ when {
+ workflow {
+ """
+ input[0] = Channel.of([
+ [ id:'test', strandedness: 'forward' ], // meta map
+ [
+ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_rnaseq_1.fastq.gz', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_rnaseq_2.fastq.gz', checkIfExists: true)
+ ]
+ ])
+ input[1] = RSEM_PREPAREREFERENCE.out.index
+ input[2] = Channel.of([[id:'test'], file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)])
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert workflow.success },
+ { assert snapshot(workflow.out).match()}
+ )
+ }
+ }
}
diff --git a/subworkflows/local/quantify_rsem/tests/main.nf.test.snap b/subworkflows/local/quantify_rsem/tests/main.nf.test.snap
index e3d6bd183..847be5d62 100644
--- a/subworkflows/local/quantify_rsem/tests/main.nf.test.snap
+++ b/subworkflows/local/quantify_rsem/tests/main.nf.test.snap
@@ -1,16 +1,282 @@
{
- "logs": {
+ "homo_sapiens - stub": {
"content": [
- "test.log"
+ {
+ "0": [
+ [
+ {
+ "id": "test",
+ "strandedness": "forward"
+ },
+ "test.genes.results:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "1": [
+ [
+ {
+ "id": "test",
+ "strandedness": "forward"
+ },
+ "test.isoforms.results:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "10": [
+ [
+ {
+ "id": "test",
+ "strandedness": "forward"
+ },
+ "test.stats:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "11": [
+ [
+ {
+ "id": "test",
+ "strandedness": "forward"
+ },
+ "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "12": [
+ [
+ {
+ "id": "test",
+ "strandedness": "forward"
+ },
+ "test.idxstats:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "13": [
+ "rsem.merged.gene_counts.tsv:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ "14": [
+ "rsem.merged.gene_tpm.tsv:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ "15": [
+ "rsem.merged.transcript_counts.tsv:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ "16": [
+ "rsem.merged.transcript_tpm.tsv:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ "17": [
+ "versions.yml:md5,2aa5252eb2ffb409cf556a165d40f8a9",
+ "versions.yml:md5,3399809728955f4654ab781f37ea42d3",
+ "versions.yml:md5,4219f710ca21b71a7c7db6b02ac19bb3",
+ "versions.yml:md5,912c613bca84f899b3e890985ecc6fc2",
+ "versions.yml:md5,a4755dd9acbfa60dbc38e172ffda193f",
+ "versions.yml:md5,ae1676b60b6335fff8f1188288103a1c",
+ "versions.yml:md5,f645ee5b20a4e89c6ed48fdc27c21791"
+ ],
+ "2": [
+ [
+ {
+ "id": "test",
+ "strandedness": "forward"
+ },
+ "test.stat:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "3": [
+ [
+ {
+ "id": "test",
+ "strandedness": "forward"
+ },
+ "test.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "4": [
+ [
+ {
+ "id": "test",
+ "strandedness": "forward"
+ },
+ "test.STAR.genome.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "5": [
+ [
+ {
+ "id": "test",
+ "strandedness": "forward"
+ },
+ "test.genome.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "6": [
+ [
+ {
+ "id": "test",
+ "strandedness": "forward"
+ },
+ "test.transcript.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "7": [
+ [
+ {
+ "id": "test",
+ "strandedness": "forward"
+ },
+ "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "8": [
+ [
+ {
+ "id": "test",
+ "strandedness": "forward"
+ },
+ "test.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "9": [
+
+ ],
+ "bai": [
+ [
+ {
+ "id": "test",
+ "strandedness": "forward"
+ },
+ "test.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "bam": [
+ [
+ {
+ "id": "test",
+ "strandedness": "forward"
+ },
+ "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "bam_genome": [
+ [
+ {
+ "id": "test",
+ "strandedness": "forward"
+ },
+ "test.genome.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "bam_star": [
+ [
+ {
+ "id": "test",
+ "strandedness": "forward"
+ },
+ "test.STAR.genome.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "bam_transcript": [
+ [
+ {
+ "id": "test",
+ "strandedness": "forward"
+ },
+ "test.transcript.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "counts_gene": [
+ [
+ {
+ "id": "test",
+ "strandedness": "forward"
+ },
+ "test.genes.results:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "counts_transcript": [
+ [
+ {
+ "id": "test",
+ "strandedness": "forward"
+ },
+ "test.isoforms.results:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "csi": [
+
+ ],
+ "flagstat": [
+ [
+ {
+ "id": "test",
+ "strandedness": "forward"
+ },
+ "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "idxstats": [
+ [
+ {
+ "id": "test",
+ "strandedness": "forward"
+ },
+ "test.idxstats:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "logs": [
+ [
+ {
+ "id": "test",
+ "strandedness": "forward"
+ },
+ "test.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "merged_counts_gene": [
+ "rsem.merged.gene_counts.tsv:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ "merged_counts_transcript": [
+ "rsem.merged.transcript_counts.tsv:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ "merged_tpm_gene": [
+ "rsem.merged.gene_tpm.tsv:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ "merged_tpm_transcript": [
+ "rsem.merged.transcript_tpm.tsv:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ "stat": [
+ [
+ {
+ "id": "test",
+ "strandedness": "forward"
+ },
+ "test.stat:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "stats": [
+ [
+ {
+ "id": "test",
+ "strandedness": "forward"
+ },
+ "test.stats:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "versions": [
+ "versions.yml:md5,2aa5252eb2ffb409cf556a165d40f8a9",
+ "versions.yml:md5,3399809728955f4654ab781f37ea42d3",
+ "versions.yml:md5,4219f710ca21b71a7c7db6b02ac19bb3",
+ "versions.yml:md5,912c613bca84f899b3e890985ecc6fc2",
+ "versions.yml:md5,a4755dd9acbfa60dbc38e172ffda193f",
+ "versions.yml:md5,ae1676b60b6335fff8f1188288103a1c",
+ "versions.yml:md5,f645ee5b20a4e89c6ed48fdc27c21791"
+ ]
+ }
],
"meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.10.1"
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
},
- "timestamp": "2024-03-07T18:25:31.476361"
+ "timestamp": "2024-07-22T19:32:06.579549"
},
"homo_sapiens": {
"content": [
+ "test.log",
[
[
{
@@ -103,8 +369,8 @@
],
"meta": {
"nf-test": "0.8.4",
- "nextflow": "23.10.1"
+ "nextflow": "24.04.2"
},
- "timestamp": "2024-03-07T18:15:03.001083"
+ "timestamp": "2024-07-03T19:53:14.561568"
}
}
\ No newline at end of file
diff --git a/subworkflows/nf-core/bam_dedup_stats_samtools_umitools/tests/main.nf.test b/subworkflows/nf-core/bam_dedup_stats_samtools_umitools/tests/main.nf.test
index cc9c57c04..9d38022b4 100644
--- a/subworkflows/nf-core/bam_dedup_stats_samtools_umitools/tests/main.nf.test
+++ b/subworkflows/nf-core/bam_dedup_stats_samtools_umitools/tests/main.nf.test
@@ -20,9 +20,6 @@ nextflow_workflow {
test("sarscov2_bam_bai") {
when {
- params {
- outdir = "$outputDir"
- }
workflow {
"""
val_get_dedup_stats = false
@@ -43,12 +40,40 @@ nextflow_workflow {
{ assert workflow.out.deduplog.get(0).get(1) ==~ ".*.log"},
{ assert workflow.out.bam.get(0).get(1) ==~ ".*.bam"},
{ assert workflow.out.bai.get(0).get(1) ==~ ".*.bai"},
- { assert snapshot(workflow.out.stats).match("test_bam_dedup_stats_samtools_umitools_stats") },
- { assert snapshot(workflow.out.flagstat).match("test_bam_dedup_stats_samtools_umitools_flagstats") },
- { assert snapshot(workflow.out.idxstats).match("test_bam_dedup_stats_samtools_umitools_idxstats") }
+ { assert snapshot(
+ workflow.out.stats,
+ workflow.out.flagstat,
+ workflow.out.idxstats,
+ workflow.out.versions
+ ).match() }
)
}
-
}
+ test("sarscov2_bam_bai - stub") {
+
+ options "-stub"
+
+ when {
+ workflow {
+ """
+ val_get_dedup_stats = false
+
+ input[0] = Channel.of([
+ [ id:'test'], // meta map
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true)
+ ])
+ input[1] = val_get_dedup_stats
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert workflow.success},
+ { assert snapshot(workflow.out).match() }
+ )
+ }
+ }
}
diff --git a/subworkflows/nf-core/bam_dedup_stats_samtools_umitools/tests/main.nf.test.snap b/subworkflows/nf-core/bam_dedup_stats_samtools_umitools/tests/main.nf.test.snap
index 442776f69..4fd70b5f3 100644
--- a/subworkflows/nf-core/bam_dedup_stats_samtools_umitools/tests/main.nf.test.snap
+++ b/subworkflows/nf-core/bam_dedup_stats_samtools_umitools/tests/main.nf.test.snap
@@ -1,23 +1,14 @@
{
- "test_bam_dedup_stats_samtools_umitools_idxstats": {
+ "sarscov2_bam_bai": {
"content": [
[
[
{
"id": "test"
},
- "test.idxstats:md5,1adb27b52d4d64b826f48b59d61dcd4d"
+ "test.stats:md5,09d1bd8f10e000921202f7ea1cd0679e"
]
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2023-11-06T09:58:40.394333937"
- },
- "test_bam_dedup_stats_samtools_umitools_flagstats": {
- "content": [
+ ],
[
[
{
@@ -25,29 +16,154 @@
},
"test.flagstat:md5,0bb716e40fae381b97484b58e0b16efe"
]
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2023-11-06T09:58:40.385185447"
- },
- "test_bam_dedup_stats_samtools_umitools_stats": {
- "content": [
+ ],
[
[
{
"id": "test"
},
- "test.stats:md5,09d1bd8f10e000921202f7ea1cd0679e"
+ "test.idxstats:md5,1adb27b52d4d64b826f48b59d61dcd4d"
]
+ ],
+ [
+ "versions.yml:md5,32b4a349a563fb5b01cf0688ae3ca860",
+ "versions.yml:md5,803d3f4d3992a7a597a09cf330bd46a4",
+ "versions.yml:md5,9b7824114bf90d4b60110ddaf149f1db",
+ "versions.yml:md5,f0864f64f8ebb81826a1cf5c14b77e69",
+ "versions.yml:md5,f4935d4e563646266cc6bb4d75d0fb7d"
]
],
"meta": {
"nf-test": "0.8.4",
- "nextflow": "23.10.1"
+ "nextflow": "24.04.2"
+ },
+ "timestamp": "2024-07-03T11:53:11.53709"
+ },
+ "sarscov2_bam_bai - stub": {
+ "content": [
+ {
+ "0": [
+ [
+ {
+ "id": "test"
+ },
+ "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "1": [
+ [
+ {
+ "id": "test"
+ },
+ "test.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "2": [
+ [
+ {
+ "id": "test"
+ },
+ "test.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "3": [
+
+ ],
+ "4": [
+ [
+ {
+ "id": "test"
+ },
+ "test.stats:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "5": [
+ [
+ {
+ "id": "test"
+ },
+ "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "6": [
+ [
+ {
+ "id": "test"
+ },
+ "test.idxstats:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "7": [
+ "versions.yml:md5,32b4a349a563fb5b01cf0688ae3ca860",
+ "versions.yml:md5,803d3f4d3992a7a597a09cf330bd46a4",
+ "versions.yml:md5,9b7824114bf90d4b60110ddaf149f1db",
+ "versions.yml:md5,f0864f64f8ebb81826a1cf5c14b77e69",
+ "versions.yml:md5,f4935d4e563646266cc6bb4d75d0fb7d"
+ ],
+ "bai": [
+ [
+ {
+ "id": "test"
+ },
+ "test.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "bam": [
+ [
+ {
+ "id": "test"
+ },
+ "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "csi": [
+
+ ],
+ "deduplog": [
+ [
+ {
+ "id": "test"
+ },
+ "test.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "flagstat": [
+ [
+ {
+ "id": "test"
+ },
+ "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "idxstats": [
+ [
+ {
+ "id": "test"
+ },
+ "test.idxstats:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "stats": [
+ [
+ {
+ "id": "test"
+ },
+ "test.stats:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "versions": [
+ "versions.yml:md5,32b4a349a563fb5b01cf0688ae3ca860",
+ "versions.yml:md5,803d3f4d3992a7a597a09cf330bd46a4",
+ "versions.yml:md5,9b7824114bf90d4b60110ddaf149f1db",
+ "versions.yml:md5,f0864f64f8ebb81826a1cf5c14b77e69",
+ "versions.yml:md5,f4935d4e563646266cc6bb4d75d0fb7d"
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
},
- "timestamp": "2024-05-29T07:36:18.573909434"
+ "timestamp": "2024-07-22T16:34:35.959581"
}
-}
\ No newline at end of file
+}
diff --git a/subworkflows/nf-core/bam_dedup_stats_samtools_umitools/tests/tags.yml b/subworkflows/nf-core/bam_dedup_stats_samtools_umitools/tests/tags.yml
deleted file mode 100644
index bfd5e023e..000000000
--- a/subworkflows/nf-core/bam_dedup_stats_samtools_umitools/tests/tags.yml
+++ /dev/null
@@ -1,2 +0,0 @@
-subworkflows/bam_dedup_stats_samtools_umitools:
- - subworkflows/nf-core/bam_dedup_stats_samtools_umitools/**
diff --git a/subworkflows/nf-core/bam_markduplicates_picard/tests/main.nf.test b/subworkflows/nf-core/bam_markduplicates_picard/tests/main.nf.test
index 7ecf3fe40..f023a9f7d 100644
--- a/subworkflows/nf-core/bam_markduplicates_picard/tests/main.nf.test
+++ b/subworkflows/nf-core/bam_markduplicates_picard/tests/main.nf.test
@@ -28,14 +28,15 @@ nextflow_workflow {
then {
assertAll(
{ assert workflow.success},
+ { assert path(workflow.out.metrics.get(0).get(1)).getText().contains("97") },
{ assert snapshot(
path(workflow.out.bam[0][1]),
path(workflow.out.bai[0][1]),
path(workflow.out.flagstat[0][1]),
path(workflow.out.idxstats[0][1]),
path(workflow.out.stats[0][1]),
- ).match("sarscov2 - bam") },
- { assert path(workflow.out.metrics.get(0).get(1)).getText().contains("97") }
+ workflow.out.versions
+ ).match() }
)
}
}
@@ -64,16 +65,78 @@ nextflow_workflow {
then {
assertAll(
{ assert workflow.success},
+ { assert path(workflow.out.metrics.get(0).get(1)).getText().contains("0.999986") },
{ assert snapshot(
file(workflow.out.cram[0][1]).name,
path(workflow.out.crai[0][1]),
path(workflow.out.flagstat[0][1]),
path(workflow.out.idxstats[0][1]),
path(workflow.out.stats[0][1]),
- ).match("homo_sapiens - cram") },
- { assert path(workflow.out.metrics.get(0).get(1)).getText().contains("0.999986") }
+ workflow.out.versions
+ ).match() }
)
}
}
+ test("sarscov2 - bam - stub") {
+
+ options "-stub"
+
+ when {
+ workflow {
+ """
+ input[0] = Channel.of([
+ [ id:'test', single_end: false ], // meta map
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true)
+ ])
+ input[1] = Channel.of([
+ [ id:'genome' ],
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)
+ ])
+ input[2] = Channel.of([
+ [ id:'genome' ],
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.fai', checkIfExists: true)
+ ])
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert workflow.success},
+ { assert snapshot(workflow.out).match() }
+ )
+ }
+ }
+
+ test("homo_sapiens - cram - stub") {
+
+ options "-stub"
+
+ when {
+ workflow {
+ """
+ input[0] = Channel.of([
+ [ id:'test' ], // meta map
+ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram', checkIfExists: true)
+ ])
+ input[1] = Channel.of([
+ [ id:'genome' ],
+ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)
+ ])
+ input[2] = Channel.of([
+ [ id:'genome' ],
+ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true)
+ ])
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert workflow.success},
+ { assert snapshot(workflow.out).match() }
+ )
+ }
+ }
}
diff --git a/subworkflows/nf-core/bam_markduplicates_picard/tests/main.nf.test.snap b/subworkflows/nf-core/bam_markduplicates_picard/tests/main.nf.test.snap
index 94f8f29c4..32788a18c 100644
--- a/subworkflows/nf-core/bam_markduplicates_picard/tests/main.nf.test.snap
+++ b/subworkflows/nf-core/bam_markduplicates_picard/tests/main.nf.test.snap
@@ -5,13 +5,310 @@
"test.cram.crai:md5,78d47ba01ac4e05f3ae1e353902a989e",
"test.flagstat:md5,93b0ef463df947ede1f42ff60396c34d",
"test.idxstats:md5,e179601fa7b8ebce81ac3765206f6c15",
- "test.stats:md5,372a7d9d9081aa009b21343a913beb14"
+ "test.stats:md5,372a7d9d9081aa009b21343a913beb14",
+ [
+ "versions.yml:md5,0d170c963555870ac9a0d438bf6c2f93",
+ "versions.yml:md5,3729819c49e6d8eed9ada247e5d77de1",
+ "versions.yml:md5,966dcea920866a87b55e665563864fc9",
+ "versions.yml:md5,a62ca6eb27e59dd6f03a93fa8656e656",
+ "versions.yml:md5,fcf804c605f455127f2449403d70390c"
+ ]
],
"meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.10.1"
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
},
- "timestamp": "2024-05-29T07:39:18.809130196"
+ "timestamp": "2024-07-22T19:28:15.15911"
+ },
+ "sarscov2 - bam - stub": {
+ "content": [
+ {
+ "0": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "1": [
+
+ ],
+ "2": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.MarkDuplicates.metrics.txt:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "3": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "4": [
+
+ ],
+ "5": [
+
+ ],
+ "6": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.stats:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "7": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "8": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.idxstats:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "9": [
+ "versions.yml:md5,0d170c963555870ac9a0d438bf6c2f93",
+ "versions.yml:md5,3729819c49e6d8eed9ada247e5d77de1",
+ "versions.yml:md5,966dcea920866a87b55e665563864fc9",
+ "versions.yml:md5,a62ca6eb27e59dd6f03a93fa8656e656",
+ "versions.yml:md5,fcf804c605f455127f2449403d70390c"
+ ],
+ "bai": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "bam": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "crai": [
+
+ ],
+ "cram": [
+
+ ],
+ "csi": [
+
+ ],
+ "flagstat": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "idxstats": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.idxstats:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "metrics": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.MarkDuplicates.metrics.txt:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "stats": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.stats:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "versions": [
+ "versions.yml:md5,0d170c963555870ac9a0d438bf6c2f93",
+ "versions.yml:md5,3729819c49e6d8eed9ada247e5d77de1",
+ "versions.yml:md5,966dcea920866a87b55e665563864fc9",
+ "versions.yml:md5,a62ca6eb27e59dd6f03a93fa8656e656",
+ "versions.yml:md5,fcf804c605f455127f2449403d70390c"
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
+ },
+ "timestamp": "2024-07-22T19:28:40.128144"
+ },
+ "homo_sapiens - cram - stub": {
+ "content": [
+ {
+ "0": [
+
+ ],
+ "1": [
+ [
+ {
+ "id": "test"
+ },
+ "test.cram:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "2": [
+ [
+ {
+ "id": "test"
+ },
+ "test.MarkDuplicates.metrics.txt:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "3": [
+
+ ],
+ "4": [
+ [
+ {
+ "id": "test"
+ },
+ "test.cram.crai:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "5": [
+
+ ],
+ "6": [
+ [
+ {
+ "id": "test"
+ },
+ "test.stats:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "7": [
+ [
+ {
+ "id": "test"
+ },
+ "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "8": [
+ [
+ {
+ "id": "test"
+ },
+ "test.idxstats:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "9": [
+ "versions.yml:md5,0d170c963555870ac9a0d438bf6c2f93",
+ "versions.yml:md5,3729819c49e6d8eed9ada247e5d77de1",
+ "versions.yml:md5,966dcea920866a87b55e665563864fc9",
+ "versions.yml:md5,a62ca6eb27e59dd6f03a93fa8656e656",
+ "versions.yml:md5,fcf804c605f455127f2449403d70390c"
+ ],
+ "bai": [
+
+ ],
+ "bam": [
+
+ ],
+ "crai": [
+ [
+ {
+ "id": "test"
+ },
+ "test.cram.crai:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "cram": [
+ [
+ {
+ "id": "test"
+ },
+ "test.cram:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "csi": [
+
+ ],
+ "flagstat": [
+ [
+ {
+ "id": "test"
+ },
+ "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "idxstats": [
+ [
+ {
+ "id": "test"
+ },
+ "test.idxstats:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "metrics": [
+ [
+ {
+ "id": "test"
+ },
+ "test.MarkDuplicates.metrics.txt:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "stats": [
+ [
+ {
+ "id": "test"
+ },
+ "test.stats:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "versions": [
+ "versions.yml:md5,0d170c963555870ac9a0d438bf6c2f93",
+ "versions.yml:md5,3729819c49e6d8eed9ada247e5d77de1",
+ "versions.yml:md5,966dcea920866a87b55e665563864fc9",
+ "versions.yml:md5,a62ca6eb27e59dd6f03a93fa8656e656",
+ "versions.yml:md5,fcf804c605f455127f2449403d70390c"
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
+ },
+ "timestamp": "2024-07-22T19:29:04.075263"
},
"sarscov2 - bam": {
"content": [
@@ -19,12 +316,19 @@
"test.bam.bai:md5,4d3ae8d013444b55e17aa0149a2ab404",
"test.flagstat:md5,4f7ffd1e6a5e85524d443209ac97d783",
"test.idxstats:md5,df60a8c8d6621100d05178c93fb053a2",
- "test.stats:md5,cca83e4fc9406fc3875b5e60055d6574"
+ "test.stats:md5,cca83e4fc9406fc3875b5e60055d6574",
+ [
+ "versions.yml:md5,0d170c963555870ac9a0d438bf6c2f93",
+ "versions.yml:md5,3729819c49e6d8eed9ada247e5d77de1",
+ "versions.yml:md5,966dcea920866a87b55e665563864fc9",
+ "versions.yml:md5,a62ca6eb27e59dd6f03a93fa8656e656",
+ "versions.yml:md5,fcf804c605f455127f2449403d70390c"
+ ]
],
"meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.10.1"
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
},
- "timestamp": "2024-05-29T07:39:07.280687689"
+ "timestamp": "2024-07-22T19:27:47.343274"
}
}
\ No newline at end of file
diff --git a/subworkflows/nf-core/bam_rseqc/tests/main.nf.test b/subworkflows/nf-core/bam_rseqc/tests/main.nf.test
index eb87c27c9..492cfb6fe 100644
--- a/subworkflows/nf-core/bam_rseqc/tests/main.nf.test
+++ b/subworkflows/nf-core/bam_rseqc/tests/main.nf.test
@@ -25,27 +25,19 @@ nextflow_workflow {
then {
assertAll(
{ assert workflow.success},
- { assert snapshot(workflow.out.bamstat_txt).match("bamstat_txt")},
-
- { assert snapshot(workflow.out.innerdistance_all.findAll { it[1].endsWith('.pdf') == false }).match("innerdistance_all")},
{ assert workflow.out.innerdistance_all.any { it[1].endsWith('.pdf') && file(it[1]).exists() } },
-
- { assert snapshot(workflow.out.inferexperiment_txt).match("inferexperiment_txt")},
-
- { assert snapshot(workflow.out.junctionannotation_all.findAll {
- it[1].endsWith('.xls') == false &&
- it[1].endsWith('.r') == false }).match("junctionannotation_all")},
-
- { assert snapshot(workflow.out.junctionsaturation_all.findAll { it[1].endsWith('.pdf') == false }).match("junctionsaturation_all")},
- { assert workflow.out.junctionsaturation_all.any { it[1].endsWith('.pdf') && file(it[1]).exists() } },
-
- { assert snapshot(workflow.out.readdistribution_txt).match("readdistribution_txt")},
-
- { assert snapshot(workflow.out.readduplication_all.findAll { it[1].endsWith('.pdf') == false }).match("readduplication_all")},
{ assert workflow.out.readduplication_all.any { it[1].endsWith('.pdf') && file(it[1]).exists() } },
-
- { assert snapshot(workflow.out.tin_txt).match("tin_txt")},
- { assert snapshot(workflow.out.versions).match("versions")},
+ { assert workflow.out.junctionsaturation_all.any { it[1].endsWith('.pdf') && file(it[1]).exists() } },
+ { assert snapshot(
+ workflow.out.bamstat_txt,
+ workflow.out.innerdistance_all.findAll { it[1].endsWith('.pdf') == false },
+ workflow.out.inferexperiment_txt,
+ workflow.out.junctionannotation_all.findAll { it[1].endsWith('.xls') == false && it[1].endsWith('.r') == false },
+ workflow.out.junctionsaturation_all.findAll { it[1].endsWith('.pdf') == false },
+ workflow.out.readdistribution_txt,
+ workflow.out.readduplication_all.findAll { it[1].endsWith('.pdf') == false },
+ workflow.out.tin_txt,
+ workflow.out.versions).match()}
)
}
}
@@ -79,9 +71,64 @@ nextflow_workflow {
{ assert workflow.out.readdistribution_txt.size() == 0 },
{ assert workflow.out.readduplication_all.size() == 0 },
{ assert workflow.out.tin_txt.size() == 0 },
- { assert workflow.out.versions.size() == 0 },
+ { assert workflow.out.versions.size() == 0 }
+ )
+ }
+ }
+
+ test("sarscov2 paired-end [bam] - stub") {
+
+ options "-stub"
+
+ when {
+ workflow {
+ """
+ input[0] = Channel.of([
+ [ id:'test' ], // meta map
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true)
+ ])
+ input[1] = Channel.of([
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/bed/test.bed12', checkIfExists: true)
+ ])
+ input[2] = ['bam_stat', 'inner_distance', 'infer_experiment', 'junction_annotation', 'junction_saturation', 'read_distribution', 'read_duplication', 'tin']
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert workflow.success},
+ { assert snapshot(workflow.out).match()}
)
}
}
+ test("sarscov2 paired-end [bam] no modules - stub") {
+
+ options "-stub"
+
+ when {
+ workflow {
+ """
+ input[0] = Channel.of([
+ [ id:'test' ], // meta map
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true)
+ ])
+ input[1] = Channel.of([
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/bed/test.bed12', checkIfExists: true)
+ ])
+ input[2] = []
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert workflow.success},
+ { assert snapshot(workflow.out).match()}
+ )
+ }
+ }
}
diff --git a/subworkflows/nf-core/bam_rseqc/tests/main.nf.test.snap b/subworkflows/nf-core/bam_rseqc/tests/main.nf.test.snap
index 8bd21052f..0040810cc 100644
--- a/subworkflows/nf-core/bam_rseqc/tests/main.nf.test.snap
+++ b/subworkflows/nf-core/bam_rseqc/tests/main.nf.test.snap
@@ -1,5 +1,5 @@
{
- "bamstat_txt": {
+ "sarscov2 paired-end [bam]": {
"content": [
[
[
@@ -8,98 +8,57 @@
},
"test.bam_stat.txt:md5,2675857864c1d1139b2a19d25dc36b09"
]
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.10.1"
- },
- "timestamp": "2023-12-08T14:37:45.671792186"
- },
- "readduplication_all": {
- "content": [
+ ],
[
[
{
"id": "test"
},
- "test.DupRate_plot.r:md5,3c0325095cee4835b921e57d61c23dca"
+ "test.inner_distance.txt:md5,a1acc9def0f64a5500d4c4cb47cbe32b"
],
[
{
"id": "test"
},
- "test.pos.DupRate.xls:md5,a859bc2031d46bf1cc4336205847caa3"
+ "test.inner_distance_freq.txt:md5,3fc037501f5899b5da009c8ce02fc25e"
],
[
{
"id": "test"
},
- "test.seq.DupRate.xls:md5,ee8783399eec5a18522a6f08bece338b"
+ "test.inner_distance_mean.txt:md5,58398b7d5a29a5e564f9e3c50b55996c"
+ ],
+ [
+ {
+ "id": "test"
+ },
+ "test.inner_distance_plot.r:md5,5859fbd5b42046d47e8b9aa85077f4ea"
]
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.10.1"
- },
- "timestamp": "2023-12-08T14:37:45.927253593"
- },
- "tin_txt": {
- "content": [
+ ],
[
[
{
"id": "test"
},
- "test.paired_end.sorted.summary.txt:md5,9d98447e178b89a89f6f5aba7a772fe6"
+ "test.infer_experiment.txt:md5,f9d0bfc239df637cd8aeda40ade3c59a"
]
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.10.1"
- },
- "timestamp": "2024-02-06T15:29:37.545261"
- },
- "junctionsaturation_all": {
- "content": [
+ ],
[
[
{
"id": "test"
},
- "test.junctionSaturation_plot.r:md5,caa6e63dcb477aabb169882b2f30dadd"
+ "test.junction_annotation.log:md5,d75e0f5d62fada8aa9449991b209554c"
]
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.10.1"
- },
- "timestamp": "2023-12-08T14:37:45.825157699"
- },
- "versions": {
- "content": [
+ ],
[
- "versions.yml:md5,60dc1afce7fecb7270e998a00ee393e2",
- "versions.yml:md5,9bc3caee6aeb54f23f5296b499546515",
- "versions.yml:md5,a25161998ca60d5ce4e9a86abbf1bcb8",
- "versions.yml:md5,c175b92f50b5be38a8808cbf7ac7452e",
- "versions.yml:md5,ca7e95cf7ff7cff5d052b890729f7ead",
- "versions.yml:md5,d03beea3c68934c3f3623a005c1424d2",
- "versions.yml:md5,f2f3ecd549045f7595245f904f5d9414",
- "versions.yml:md5,fd16f1098b9c285f3ea7bd3daf4e8f10"
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.10.1"
- },
- "timestamp": "2023-12-14T14:58:10.874440924"
- },
- "readdistribution_txt": {
- "content": [
+ [
+ {
+ "id": "test"
+ },
+ "test.junctionSaturation_plot.r:md5,caa6e63dcb477aabb169882b2f30dadd"
+ ]
+ ],
[
[
{
@@ -107,81 +66,838 @@
},
"test.read_distribution.txt:md5,56893fdc0809d968629a363551a1655f"
]
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.10.1"
- },
- "timestamp": "2023-12-08T14:37:45.841855468"
- },
- "innerdistance_all": {
- "content": [
+ ],
[
[
{
"id": "test"
},
- "test.inner_distance.txt:md5,a1acc9def0f64a5500d4c4cb47cbe32b"
+ "test.DupRate_plot.r:md5,3c0325095cee4835b921e57d61c23dca"
],
[
{
"id": "test"
},
- "test.inner_distance_freq.txt:md5,3fc037501f5899b5da009c8ce02fc25e"
+ "test.pos.DupRate.xls:md5,a859bc2031d46bf1cc4336205847caa3"
],
[
{
"id": "test"
},
- "test.inner_distance_mean.txt:md5,58398b7d5a29a5e564f9e3c50b55996c"
- ],
+ "test.seq.DupRate.xls:md5,ee8783399eec5a18522a6f08bece338b"
+ ]
+ ],
+ [
[
{
"id": "test"
},
- "test.inner_distance_plot.r:md5,5859fbd5b42046d47e8b9aa85077f4ea"
+ "test.paired_end.sorted.summary.txt:md5,9d98447e178b89a89f6f5aba7a772fe6"
]
+ ],
+ [
+ "versions.yml:md5,60dc1afce7fecb7270e998a00ee393e2",
+ "versions.yml:md5,9bc3caee6aeb54f23f5296b499546515",
+ "versions.yml:md5,a25161998ca60d5ce4e9a86abbf1bcb8",
+ "versions.yml:md5,c175b92f50b5be38a8808cbf7ac7452e",
+ "versions.yml:md5,ca7e95cf7ff7cff5d052b890729f7ead",
+ "versions.yml:md5,d03beea3c68934c3f3623a005c1424d2",
+ "versions.yml:md5,f2f3ecd549045f7595245f904f5d9414",
+ "versions.yml:md5,fd16f1098b9c285f3ea7bd3daf4e8f10"
]
],
"meta": {
"nf-test": "0.8.4",
- "nextflow": "23.10.1"
+ "nextflow": "24.04.2"
},
- "timestamp": "2023-12-08T14:37:45.734509133"
+ "timestamp": "2024-07-03T12:07:54.452949"
},
- "inferexperiment_txt": {
+ "sarscov2 paired-end [bam] - stub": {
"content": [
- [
- [
- {
- "id": "test"
- },
- "test.infer_experiment.txt:md5,f9d0bfc239df637cd8aeda40ade3c59a"
+ {
+ "0": [
+ [
+ {
+ "id": "test"
+ },
+ "test.bam_stat.txt:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "1": [
+ [
+ {
+ "id": "test"
+ },
+ "test.inner_distance.txt:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ [
+ {
+ "id": "test"
+ },
+ "test.inner_distance_freq.txt:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ [
+ {
+ "id": "test"
+ },
+ "test.inner_distance_mean.txt:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ [
+ {
+ "id": "test"
+ },
+ "test.inner_distance_plot.pdf:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ [
+ {
+ "id": "test"
+ },
+ "test.inner_distance_plot.r:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "10": [
+ [
+ {
+ "id": "test"
+ },
+ "test.Interact.bed:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "11": [
+ [
+ {
+ "id": "test"
+ },
+ "test.junction.xls:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "12": [
+ [
+ {
+ "id": "test"
+ },
+ "test.junction.pdf:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "13": [
+ [
+ {
+ "id": "test"
+ },
+ "test.events.pdf:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "14": [
+ [
+ {
+ "id": "test"
+ },
+ "test.junction_plot.r:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "15": [
+ [
+ {
+ "id": "test"
+ },
+ "test.junction_annotation.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "16": [
+ [
+ {
+ "id": "test"
+ },
+ "test.junctionSaturation_plot.pdf:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ [
+ {
+ "id": "test"
+ },
+ "test.junctionSaturation_plot.r:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "17": [
+ [
+ {
+ "id": "test"
+ },
+ "test.junctionSaturation_plot.pdf:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "18": [
+ [
+ {
+ "id": "test"
+ },
+ "test.junctionSaturation_plot.r:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "19": [
+ [
+ {
+ "id": "test"
+ },
+ "test.read_distribution.txt:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "2": [
+ [
+ {
+ "id": "test"
+ },
+ "test.inner_distance.txt:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "20": [
+ [
+ {
+ "id": "test"
+ },
+ "test.DupRate_plot.pdf:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ [
+ {
+ "id": "test"
+ },
+ "test.DupRate_plot.r:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ [
+ {
+ "id": "test"
+ },
+ "test.pos.DupRate.xls:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ [
+ {
+ "id": "test"
+ },
+ "test.seq.DupRate.xls:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "21": [
+ [
+ {
+ "id": "test"
+ },
+ "test.seq.DupRate.xls:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "22": [
+ [
+ {
+ "id": "test"
+ },
+ "test.pos.DupRate.xls:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "23": [
+ [
+ {
+ "id": "test"
+ },
+ "test.DupRate_plot.pdf:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "24": [
+ [
+ {
+ "id": "test"
+ },
+ "test.DupRate_plot.r:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "25": [
+ [
+ {
+ "id": "test"
+ },
+ "test.paired_end.sorted.bam.summary.txt:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "26": [
+ "versions.yml:md5,60dc1afce7fecb7270e998a00ee393e2",
+ "versions.yml:md5,9bc3caee6aeb54f23f5296b499546515",
+ "versions.yml:md5,a25161998ca60d5ce4e9a86abbf1bcb8",
+ "versions.yml:md5,c175b92f50b5be38a8808cbf7ac7452e",
+ "versions.yml:md5,ca7e95cf7ff7cff5d052b890729f7ead",
+ "versions.yml:md5,d03beea3c68934c3f3623a005c1424d2",
+ "versions.yml:md5,f2f3ecd549045f7595245f904f5d9414",
+ "versions.yml:md5,fd16f1098b9c285f3ea7bd3daf4e8f10"
+ ],
+ "3": [
+ [
+ {
+ "id": "test"
+ },
+ "test.inner_distance_freq.txt:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "4": [
+ [
+ {
+ "id": "test"
+ },
+ "test.inner_distance_mean.txt:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "5": [
+ [
+ {
+ "id": "test"
+ },
+ "test.inner_distance_plot.pdf:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "6": [
+ [
+ {
+ "id": "test"
+ },
+ "test.inner_distance_plot.r:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "7": [
+ [
+ {
+ "id": "test"
+ },
+ "test.infer_experiment.txt:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "8": [
+ [
+ {
+ "id": "test"
+ },
+ "test.Interact.bed:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ [
+ {
+ "id": "test"
+ },
+ "test.events.pdf:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ [
+ {
+ "id": "test"
+ },
+ "test.junction.bed:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ [
+ {
+ "id": "test"
+ },
+ "test.junction.pdf:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ [
+ {
+ "id": "test"
+ },
+ "test.junction.xls:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ [
+ {
+ "id": "test"
+ },
+ "test.junction_annotation.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ [
+ {
+ "id": "test"
+ },
+ "test.junction_plot.r:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "9": [
+ [
+ {
+ "id": "test"
+ },
+ "test.junction.bed:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "bamstat_txt": [
+ [
+ {
+ "id": "test"
+ },
+ "test.bam_stat.txt:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "inferexperiment_txt": [
+ [
+ {
+ "id": "test"
+ },
+ "test.infer_experiment.txt:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "innerdistance_all": [
+ [
+ {
+ "id": "test"
+ },
+ "test.inner_distance.txt:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ [
+ {
+ "id": "test"
+ },
+ "test.inner_distance_freq.txt:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ [
+ {
+ "id": "test"
+ },
+ "test.inner_distance_mean.txt:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ [
+ {
+ "id": "test"
+ },
+ "test.inner_distance_plot.pdf:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ [
+ {
+ "id": "test"
+ },
+ "test.inner_distance_plot.r:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "innerdistance_distance": [
+ [
+ {
+ "id": "test"
+ },
+ "test.inner_distance.txt:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "innerdistance_freq": [
+ [
+ {
+ "id": "test"
+ },
+ "test.inner_distance_freq.txt:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "innerdistance_mean": [
+ [
+ {
+ "id": "test"
+ },
+ "test.inner_distance_mean.txt:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "innerdistance_pdf": [
+ [
+ {
+ "id": "test"
+ },
+ "test.inner_distance_plot.pdf:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "innerdistance_rscript": [
+ [
+ {
+ "id": "test"
+ },
+ "test.inner_distance_plot.r:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "junctionannotation_all": [
+ [
+ {
+ "id": "test"
+ },
+ "test.Interact.bed:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ [
+ {
+ "id": "test"
+ },
+ "test.events.pdf:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ [
+ {
+ "id": "test"
+ },
+ "test.junction.bed:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ [
+ {
+ "id": "test"
+ },
+ "test.junction.pdf:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ [
+ {
+ "id": "test"
+ },
+ "test.junction.xls:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ [
+ {
+ "id": "test"
+ },
+ "test.junction_annotation.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ [
+ {
+ "id": "test"
+ },
+ "test.junction_plot.r:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "junctionannotation_bed": [
+ [
+ {
+ "id": "test"
+ },
+ "test.junction.bed:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "junctionannotation_events_pdf": [
+ [
+ {
+ "id": "test"
+ },
+ "test.events.pdf:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "junctionannotation_interact_bed": [
+ [
+ {
+ "id": "test"
+ },
+ "test.Interact.bed:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "junctionannotation_log": [
+ [
+ {
+ "id": "test"
+ },
+ "test.junction_annotation.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "junctionannotation_pdf": [
+ [
+ {
+ "id": "test"
+ },
+ "test.junction.pdf:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "junctionannotation_rscript": [
+ [
+ {
+ "id": "test"
+ },
+ "test.junction_plot.r:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "junctionannotation_xls": [
+ [
+ {
+ "id": "test"
+ },
+ "test.junction.xls:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "junctionsaturation_all": [
+ [
+ {
+ "id": "test"
+ },
+ "test.junctionSaturation_plot.pdf:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ [
+ {
+ "id": "test"
+ },
+ "test.junctionSaturation_plot.r:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "junctionsaturation_pdf": [
+ [
+ {
+ "id": "test"
+ },
+ "test.junctionSaturation_plot.pdf:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "junctionsaturation_rscript": [
+ [
+ {
+ "id": "test"
+ },
+ "test.junctionSaturation_plot.r:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "readdistribution_txt": [
+ [
+ {
+ "id": "test"
+ },
+ "test.read_distribution.txt:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "readduplication_all": [
+ [
+ {
+ "id": "test"
+ },
+ "test.DupRate_plot.pdf:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ [
+ {
+ "id": "test"
+ },
+ "test.DupRate_plot.r:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ [
+ {
+ "id": "test"
+ },
+ "test.pos.DupRate.xls:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ],
+ [
+ {
+ "id": "test"
+ },
+ "test.seq.DupRate.xls:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "readduplication_pdf": [
+ [
+ {
+ "id": "test"
+ },
+ "test.DupRate_plot.pdf:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "readduplication_pos_xls": [
+ [
+ {
+ "id": "test"
+ },
+ "test.pos.DupRate.xls:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "readduplication_rscript": [
+ [
+ {
+ "id": "test"
+ },
+ "test.DupRate_plot.r:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "readduplication_seq_xls": [
+ [
+ {
+ "id": "test"
+ },
+ "test.seq.DupRate.xls:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "tin_txt": [
+ [
+ {
+ "id": "test"
+ },
+ "test.paired_end.sorted.bam.summary.txt:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "versions": [
+ "versions.yml:md5,60dc1afce7fecb7270e998a00ee393e2",
+ "versions.yml:md5,9bc3caee6aeb54f23f5296b499546515",
+ "versions.yml:md5,a25161998ca60d5ce4e9a86abbf1bcb8",
+ "versions.yml:md5,c175b92f50b5be38a8808cbf7ac7452e",
+ "versions.yml:md5,ca7e95cf7ff7cff5d052b890729f7ead",
+ "versions.yml:md5,d03beea3c68934c3f3623a005c1424d2",
+ "versions.yml:md5,f2f3ecd549045f7595245f904f5d9414",
+ "versions.yml:md5,fd16f1098b9c285f3ea7bd3daf4e8f10"
]
- ]
+ }
],
"meta": {
"nf-test": "0.8.4",
- "nextflow": "23.10.1"
+ "nextflow": "24.04.2"
},
- "timestamp": "2024-02-06T15:29:37.537104"
+ "timestamp": "2024-07-03T12:08:17.304769"
},
- "junctionannotation_all": {
+ "sarscov2 paired-end [bam] no modules - stub": {
"content": [
- [
- [
- {
- "id": "test"
- },
- "test.junction_annotation.log:md5,d75e0f5d62fada8aa9449991b209554c"
+ {
+ "0": [
+
+ ],
+ "1": [
+
+ ],
+ "10": [
+
+ ],
+ "11": [
+
+ ],
+ "12": [
+
+ ],
+ "13": [
+
+ ],
+ "14": [
+
+ ],
+ "15": [
+
+ ],
+ "16": [
+
+ ],
+ "17": [
+
+ ],
+ "18": [
+
+ ],
+ "19": [
+
+ ],
+ "2": [
+
+ ],
+ "20": [
+
+ ],
+ "21": [
+
+ ],
+ "22": [
+
+ ],
+ "23": [
+
+ ],
+ "24": [
+
+ ],
+ "25": [
+
+ ],
+ "26": [
+
+ ],
+ "3": [
+
+ ],
+ "4": [
+
+ ],
+ "5": [
+
+ ],
+ "6": [
+
+ ],
+ "7": [
+
+ ],
+ "8": [
+
+ ],
+ "9": [
+
+ ],
+ "bamstat_txt": [
+
+ ],
+ "inferexperiment_txt": [
+
+ ],
+ "innerdistance_all": [
+
+ ],
+ "innerdistance_distance": [
+
+ ],
+ "innerdistance_freq": [
+
+ ],
+ "innerdistance_mean": [
+
+ ],
+ "innerdistance_pdf": [
+
+ ],
+ "innerdistance_rscript": [
+
+ ],
+ "junctionannotation_all": [
+
+ ],
+ "junctionannotation_bed": [
+
+ ],
+ "junctionannotation_events_pdf": [
+
+ ],
+ "junctionannotation_interact_bed": [
+
+ ],
+ "junctionannotation_log": [
+
+ ],
+ "junctionannotation_pdf": [
+
+ ],
+ "junctionannotation_rscript": [
+
+ ],
+ "junctionannotation_xls": [
+
+ ],
+ "junctionsaturation_all": [
+
+ ],
+ "junctionsaturation_pdf": [
+
+ ],
+ "junctionsaturation_rscript": [
+
+ ],
+ "readdistribution_txt": [
+
+ ],
+ "readduplication_all": [
+
+ ],
+ "readduplication_pdf": [
+
+ ],
+ "readduplication_pos_xls": [
+
+ ],
+ "readduplication_rscript": [
+
+ ],
+ "readduplication_seq_xls": [
+
+ ],
+ "tin_txt": [
+
+ ],
+ "versions": [
+
]
- ]
+ }
],
"meta": {
"nf-test": "0.8.4",
- "nextflow": "23.10.1"
+ "nextflow": "24.04.2"
},
- "timestamp": "2023-12-14T17:42:43.31783911"
+ "timestamp": "2024-07-03T12:08:24.443731"
}
}
\ No newline at end of file
diff --git a/subworkflows/nf-core/bam_sort_stats_samtools/tests/main.nf.test b/subworkflows/nf-core/bam_sort_stats_samtools/tests/main.nf.test
index 2045512c8..a21782114 100644
--- a/subworkflows/nf-core/bam_sort_stats_samtools/tests/main.nf.test
+++ b/subworkflows/nf-core/bam_sort_stats_samtools/tests/main.nf.test
@@ -7,9 +7,6 @@ nextflow_workflow {
test("test_bam_sort_stats_samtools_single_end") {
when {
- params {
- outdir = "$outputDir"
- }
workflow {
"""
input[0] = Channel.of([
@@ -29,9 +26,11 @@ nextflow_workflow {
{ assert workflow.success},
{ assert workflow.out.bam.get(0).get(1) ==~ ".*.bam"},
{ assert workflow.out.bai.get(0).get(1) ==~ ".*.bai"},
- { assert snapshot(workflow.out.stats).match("test_bam_sort_stats_samtools_single_end_stats") },
- { assert snapshot(workflow.out.flagstat).match("test_bam_sort_stats_samtools_single_end_flagstats") },
- { assert snapshot(workflow.out.idxstats).match("test_bam_sort_stats_samtools_single_end_idxstats") }
+ { assert snapshot(
+ workflow.out.flagstat,
+ workflow.out.idxstats,
+ workflow.out.stats,
+ workflow.out.versions).match() }
)
}
}
@@ -39,9 +38,6 @@ nextflow_workflow {
test("test_bam_sort_stats_samtools_paired_end") {
when {
- params {
- outdir = "$outputDir"
- }
workflow {
"""
input[0] = Channel.of([
@@ -61,9 +57,65 @@ nextflow_workflow {
{ assert workflow.success},
{ assert workflow.out.bam.get(0).get(1) ==~ ".*.bam"},
{ assert workflow.out.bai.get(0).get(1) ==~ ".*.bai"},
- { assert snapshot(workflow.out.stats).match("test_bam_sort_stats_samtools_paired_end_stats") },
- { assert snapshot(workflow.out.flagstat).match("test_bam_sort_stats_samtools_paired_end_flagstats") },
- { assert snapshot(workflow.out.idxstats).match("test_bam_sort_stats_samtools_paired_end_idxstats") }
+ { assert snapshot(
+ workflow.out.flagstat,
+ workflow.out.idxstats,
+ workflow.out.stats,
+ workflow.out.versions).match() }
+ )
+ }
+ }
+
+ test("test_bam_sort_stats_samtools_single_end - stub") {
+
+ options "-stub"
+
+ when {
+ workflow {
+ """
+ input[0] = Channel.of([
+ [ id:'test', single_end:false ], // meta map
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.single_end.bam', checkIfExists: true)
+ ])
+ input[1] = Channel.of([
+ [ id:'genome' ],
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)
+ ])
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert workflow.success},
+ { assert snapshot(workflow.out).match() }
+ )
+ }
+ }
+
+ test("test_bam_sort_stats_samtools_paired_end - stub") {
+
+ options "-stub"
+
+ when {
+ workflow {
+ """
+ input[0] = Channel.of([
+ [ id:'test', single_end:false ], // meta map
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.bam', checkIfExists: true)
+ ])
+ input[1] = Channel.of([
+ [ id:'genome' ],
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)
+ ])
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert workflow.success},
+ { assert snapshot(workflow.out).match() }
)
}
}
diff --git a/subworkflows/nf-core/bam_sort_stats_samtools/tests/main.nf.test.snap b/subworkflows/nf-core/bam_sort_stats_samtools/tests/main.nf.test.snap
index db063837f..b7f4da177 100644
--- a/subworkflows/nf-core/bam_sort_stats_samtools/tests/main.nf.test.snap
+++ b/subworkflows/nf-core/bam_sort_stats_samtools/tests/main.nf.test.snap
@@ -1,5 +1,5 @@
{
- "test_bam_sort_stats_samtools_paired_end_flagstats": {
+ "test_bam_sort_stats_samtools_single_end": {
"content": [
[
[
@@ -7,36 +7,18 @@
"id": "test",
"single_end": false
},
- "test.flagstat:md5,4f7ffd1e6a5e85524d443209ac97d783"
+ "test.flagstat:md5,2191911d72575a2358b08b1df64ccb53"
]
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2023-10-22T20:25:03.687121177"
- },
- "test_bam_sort_stats_samtools_paired_end_idxstats": {
- "content": [
+ ],
[
[
{
"id": "test",
"single_end": false
},
- "test.idxstats:md5,df60a8c8d6621100d05178c93fb053a2"
+ "test.idxstats:md5,613e048487662c694aa4a2f73ca96a20"
]
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2023-10-22T20:25:03.709648916"
- },
- "test_bam_sort_stats_samtools_single_end_stats": {
- "content": [
+ ],
[
[
{
@@ -45,15 +27,22 @@
},
"test.stats:md5,d32de3b3716a11039cef2367c3c1a56e"
]
+ ],
+ [
+ "versions.yml:md5,494b5530a1aa29fd5867cf655bebbfe1",
+ "versions.yml:md5,9fcb0cd845bfb1f89d83201bb20649b4",
+ "versions.yml:md5,bacc323ec4055d6f69f07a09089772d1",
+ "versions.yml:md5,ce946e97097c6a9ccf834a3f91f6da30",
+ "versions.yml:md5,d6c8dae685f1b7d050165fc15c7a20b5"
]
],
"meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.10.1"
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
},
- "timestamp": "2024-05-29T07:47:44.044172487"
+ "timestamp": "2024-07-22T17:02:44.34964"
},
- "test_bam_sort_stats_samtools_paired_end_stats": {
+ "test_bam_sort_stats_samtools_paired_end": {
"content": [
[
[
@@ -61,50 +50,281 @@
"id": "test",
"single_end": false
},
- "test.stats:md5,cca83e4fc9406fc3875b5e60055d6574"
+ "test.flagstat:md5,4f7ffd1e6a5e85524d443209ac97d783"
]
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.10.1"
- },
- "timestamp": "2024-05-29T07:47:51.426232891"
- },
- "test_bam_sort_stats_samtools_single_end_idxstats": {
- "content": [
+ ],
[
[
{
"id": "test",
"single_end": false
},
- "test.idxstats:md5,613e048487662c694aa4a2f73ca96a20"
+ "test.idxstats:md5,df60a8c8d6621100d05178c93fb053a2"
]
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-01-18T17:10:02.84631"
- },
- "test_bam_sort_stats_samtools_single_end_flagstats": {
- "content": [
+ ],
[
[
{
"id": "test",
"single_end": false
},
- "test.flagstat:md5,2191911d72575a2358b08b1df64ccb53"
+ "test.stats:md5,cca83e4fc9406fc3875b5e60055d6574"
]
+ ],
+ [
+ "versions.yml:md5,494b5530a1aa29fd5867cf655bebbfe1",
+ "versions.yml:md5,9fcb0cd845bfb1f89d83201bb20649b4",
+ "versions.yml:md5,bacc323ec4055d6f69f07a09089772d1",
+ "versions.yml:md5,ce946e97097c6a9ccf834a3f91f6da30",
+ "versions.yml:md5,d6c8dae685f1b7d050165fc15c7a20b5"
]
],
"meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
+ },
+ "timestamp": "2024-07-22T17:03:02.583095"
+ },
+ "test_bam_sort_stats_samtools_single_end - stub": {
+ "content": [
+ {
+ "0": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "1": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "2": [
+
+ ],
+ "3": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.stats:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "4": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "5": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.idxstats:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "6": [
+ "versions.yml:md5,494b5530a1aa29fd5867cf655bebbfe1",
+ "versions.yml:md5,9fcb0cd845bfb1f89d83201bb20649b4",
+ "versions.yml:md5,bacc323ec4055d6f69f07a09089772d1",
+ "versions.yml:md5,ce946e97097c6a9ccf834a3f91f6da30",
+ "versions.yml:md5,d6c8dae685f1b7d050165fc15c7a20b5"
+ ],
+ "bai": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "bam": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "csi": [
+
+ ],
+ "flagstat": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "idxstats": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.idxstats:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "stats": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.stats:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "versions": [
+ "versions.yml:md5,494b5530a1aa29fd5867cf655bebbfe1",
+ "versions.yml:md5,9fcb0cd845bfb1f89d83201bb20649b4",
+ "versions.yml:md5,bacc323ec4055d6f69f07a09089772d1",
+ "versions.yml:md5,ce946e97097c6a9ccf834a3f91f6da30",
+ "versions.yml:md5,d6c8dae685f1b7d050165fc15c7a20b5"
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
+ },
+ "timestamp": "2024-07-22T17:03:22.328703"
+ },
+ "test_bam_sort_stats_samtools_paired_end - stub": {
+ "content": [
+ {
+ "0": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "1": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "2": [
+
+ ],
+ "3": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.stats:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "4": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "5": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.idxstats:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "6": [
+ "versions.yml:md5,494b5530a1aa29fd5867cf655bebbfe1",
+ "versions.yml:md5,9fcb0cd845bfb1f89d83201bb20649b4",
+ "versions.yml:md5,bacc323ec4055d6f69f07a09089772d1",
+ "versions.yml:md5,ce946e97097c6a9ccf834a3f91f6da30",
+ "versions.yml:md5,d6c8dae685f1b7d050165fc15c7a20b5"
+ ],
+ "bai": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "bam": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "csi": [
+
+ ],
+ "flagstat": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "idxstats": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.idxstats:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "stats": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.stats:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "versions": [
+ "versions.yml:md5,494b5530a1aa29fd5867cf655bebbfe1",
+ "versions.yml:md5,9fcb0cd845bfb1f89d83201bb20649b4",
+ "versions.yml:md5,bacc323ec4055d6f69f07a09089772d1",
+ "versions.yml:md5,ce946e97097c6a9ccf834a3f91f6da30",
+ "versions.yml:md5,d6c8dae685f1b7d050165fc15c7a20b5"
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
},
- "timestamp": "2024-01-18T17:10:02.829756"
+ "timestamp": "2024-07-22T17:03:38.833662"
}
}
\ No newline at end of file
diff --git a/subworkflows/nf-core/bam_stats_samtools/tests/main.nf.test b/subworkflows/nf-core/bam_stats_samtools/tests/main.nf.test
index 1eabc2b36..4597aea27 100644
--- a/subworkflows/nf-core/bam_stats_samtools/tests/main.nf.test
+++ b/subworkflows/nf-core/bam_stats_samtools/tests/main.nf.test
@@ -7,9 +7,6 @@ nextflow_workflow {
test("test_bam_stats_samtools_single_end") {
when {
- params {
- outdir = "$outputDir"
- }
workflow {
"""
input[0] = Channel.of([
@@ -28,9 +25,11 @@ nextflow_workflow {
then {
assertAll(
{ assert workflow.success},
- { assert snapshot(workflow.out.stats).match("test_bam_stats_samtools_single_end_stats") },
- { assert snapshot(workflow.out.flagstat).match("test_bam_stats_samtools_single_end_flagstats") },
- { assert snapshot(workflow.out.idxstats).match("test_bam_stats_samtools_single_end_idxstats") }
+ { assert snapshot(
+ workflow.out.flagstat,
+ workflow.out.idxstats,
+ workflow.out.stats,
+ workflow.out.versions).match() }
)
}
}
@@ -38,9 +37,6 @@ nextflow_workflow {
test("test_bam_stats_samtools_paired_end") {
when {
- params {
- outdir = "$outputDir"
- }
workflow {
"""
input[0] = Channel.of([
@@ -59,9 +55,11 @@ nextflow_workflow {
then {
assertAll(
{ assert workflow.success },
- { assert snapshot(workflow.out.stats).match("test_bam_stats_samtools_paired_end_stats") },
- { assert snapshot(workflow.out.flagstat).match("test_bam_stats_samtools_paired_end_flagstats") },
- { assert snapshot(workflow.out.idxstats).match("test_bam_stats_samtools_paired_end_idxstats") }
+ { assert snapshot(
+ workflow.out.flagstat,
+ workflow.out.idxstats,
+ workflow.out.stats,
+ workflow.out.versions).match() }
)
}
}
@@ -69,9 +67,6 @@ nextflow_workflow {
test("test_bam_stats_samtools_paired_end_cram") {
when {
- params {
- outdir = "$outputDir"
- }
workflow {
"""
input[0] = Channel.of([
@@ -90,11 +85,96 @@ nextflow_workflow {
then {
assertAll(
{ assert workflow.success},
- { assert snapshot(workflow.out.stats).match("test_bam_stats_samtools_paired_end_cram_stats") },
- { assert snapshot(workflow.out.flagstat).match("test_bam_stats_samtools_paired_end_cram_flagstats") },
- { assert snapshot(workflow.out.idxstats).match("test_bam_stats_samtools_paired_end_cram_idxstats") }
+ { assert snapshot(
+ workflow.out.flagstat,
+ workflow.out.idxstats,
+ workflow.out.stats,
+ workflow.out.versions).match() }
)
}
}
+ test ("test_bam_stats_samtools_single_end - stub") {
+
+ options "-stub"
+
+ when {
+ workflow {
+ """
+ input[0] = Channel.of([
+ [ id:'test', single_end:true ], // meta map
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.single_end.sorted.bam', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.single_end.sorted.bam.bai', checkIfExists: true)
+ ])
+ input[1] = Channel.of([
+ [ id:'genome' ],
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)
+ ])
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert workflow.success},
+ { assert snapshot(workflow.out).match() }
+ )
+ }
+ }
+
+ test("test_bam_stats_samtools_paired_end - stub") {
+
+ options "-stub"
+
+ when {
+ workflow {
+ """
+ input[0] = Channel.of([
+ [ id:'test', single_end:true ], // meta map
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true)
+ ])
+ input[1] = Channel.of([
+ [ id:'genome' ],
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)
+ ])
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert workflow.success },
+ { assert snapshot(workflow.out).match() }
+ )
+ }
+ }
+
+ test("test_bam_stats_samtools_paired_end_cram - stub") {
+
+ options "-stub"
+
+ when {
+ workflow {
+ """
+ input[0] = Channel.of([
+ [ id:'test', single_end:false ], // meta map
+ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram.crai', checkIfExists: true)
+ ])
+ input[1] = Channel.of([
+ [ id:'genome' ],
+ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)
+ ])
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert workflow.success},
+ { assert snapshot(workflow.out).match() }
+ )
+ }
+ }
}
diff --git a/subworkflows/nf-core/bam_stats_samtools/tests/main.nf.test.snap b/subworkflows/nf-core/bam_stats_samtools/tests/main.nf.test.snap
index c2cb4dec0..a3ddcc5ce 100644
--- a/subworkflows/nf-core/bam_stats_samtools/tests/main.nf.test.snap
+++ b/subworkflows/nf-core/bam_stats_samtools/tests/main.nf.test.snap
@@ -1,59 +1,230 @@
{
- "test_bam_stats_samtools_paired_end_cram_flagstats": {
+ "test_bam_stats_samtools_paired_end - stub": {
"content": [
- [
- [
- {
- "id": "test",
- "single_end": false
- },
- "test.flagstat:md5,a53f3d26e2e9851f7d528442bbfe9781"
+ {
+ "0": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.stats:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "1": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "2": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.idxstats:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "3": [
+ "versions.yml:md5,3c485730f712b115bcdc235e7294133b",
+ "versions.yml:md5,90f593a26a2d53e0f0345df7888f448e",
+ "versions.yml:md5,9ae003814e63a0907d52eec64d5d3ca3"
+ ],
+ "flagstat": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "idxstats": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.idxstats:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "stats": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.stats:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "versions": [
+ "versions.yml:md5,3c485730f712b115bcdc235e7294133b",
+ "versions.yml:md5,90f593a26a2d53e0f0345df7888f448e",
+ "versions.yml:md5,9ae003814e63a0907d52eec64d5d3ca3"
]
- ]
+ }
],
"meta": {
"nf-test": "0.8.4",
- "nextflow": "24.01.0"
+ "nextflow": "24.04.2"
},
- "timestamp": "2023-11-06T09:31:26.194017574"
+ "timestamp": "2024-07-03T12:20:06.699297"
},
- "test_bam_stats_samtools_paired_end_stats": {
+ "test_bam_stats_samtools_single_end - stub": {
"content": [
- [
- [
- {
- "id": "test",
- "single_end": true
- },
- "test.stats:md5,7afd486ad6abb9a2a3dac90c99e1d87b"
+ {
+ "0": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.stats:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "1": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "2": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.idxstats:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "3": [
+ "versions.yml:md5,3c485730f712b115bcdc235e7294133b",
+ "versions.yml:md5,90f593a26a2d53e0f0345df7888f448e",
+ "versions.yml:md5,9ae003814e63a0907d52eec64d5d3ca3"
+ ],
+ "flagstat": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "idxstats": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.idxstats:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "stats": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.stats:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "versions": [
+ "versions.yml:md5,3c485730f712b115bcdc235e7294133b",
+ "versions.yml:md5,90f593a26a2d53e0f0345df7888f448e",
+ "versions.yml:md5,9ae003814e63a0907d52eec64d5d3ca3"
]
- ]
+ }
],
"meta": {
"nf-test": "0.8.4",
- "nextflow": "23.10.1"
+ "nextflow": "24.04.2"
},
- "timestamp": "2024-05-29T07:46:05.502831991"
+ "timestamp": "2024-07-03T12:19:57.708621"
},
- "test_bam_stats_samtools_paired_end_flagstats": {
+ "test_bam_stats_samtools_paired_end_cram - stub": {
"content": [
- [
- [
- {
- "id": "test",
- "single_end": true
- },
- "test.flagstat:md5,4f7ffd1e6a5e85524d443209ac97d783"
+ {
+ "0": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.stats:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "1": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "2": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.idxstats:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "3": [
+ "versions.yml:md5,3c485730f712b115bcdc235e7294133b",
+ "versions.yml:md5,90f593a26a2d53e0f0345df7888f448e",
+ "versions.yml:md5,9ae003814e63a0907d52eec64d5d3ca3"
+ ],
+ "flagstat": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "idxstats": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.idxstats:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "stats": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.stats:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "versions": [
+ "versions.yml:md5,3c485730f712b115bcdc235e7294133b",
+ "versions.yml:md5,90f593a26a2d53e0f0345df7888f448e",
+ "versions.yml:md5,9ae003814e63a0907d52eec64d5d3ca3"
]
- ]
+ }
],
"meta": {
"nf-test": "0.8.4",
- "nextflow": "24.01.0"
+ "nextflow": "24.04.2"
},
- "timestamp": "2024-01-18T17:17:27.717482"
+ "timestamp": "2024-07-03T12:20:17.051493"
},
- "test_bam_stats_samtools_single_end_flagstats": {
+ "test_bam_stats_samtools_single_end": {
"content": [
[
[
@@ -63,34 +234,16 @@
},
"test.flagstat:md5,2191911d72575a2358b08b1df64ccb53"
]
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2023-11-06T09:26:10.340046381"
- },
- "test_bam_stats_samtools_paired_end_cram_idxstats": {
- "content": [
+ ],
[
[
{
"id": "test",
- "single_end": false
+ "single_end": true
},
- "test.idxstats:md5,e179601fa7b8ebce81ac3765206f6c15"
+ "test.idxstats:md5,613e048487662c694aa4a2f73ca96a20"
]
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2023-11-06T09:31:26.207052003"
- },
- "test_bam_stats_samtools_single_end_stats": {
- "content": [
+ ],
[
[
{
@@ -99,16 +252,30 @@
},
"test.stats:md5,4a0c429c661d6aa0b60acb9309da642d"
]
+ ],
+ [
+ "versions.yml:md5,3c485730f712b115bcdc235e7294133b",
+ "versions.yml:md5,90f593a26a2d53e0f0345df7888f448e",
+ "versions.yml:md5,9ae003814e63a0907d52eec64d5d3ca3"
]
],
"meta": {
"nf-test": "0.8.4",
- "nextflow": "23.10.1"
+ "nextflow": "24.04.2"
},
- "timestamp": "2024-05-29T07:45:59.612412212"
+ "timestamp": "2024-07-03T12:19:25.801394"
},
- "test_bam_stats_samtools_paired_end_idxstats": {
+ "test_bam_stats_samtools_paired_end": {
"content": [
+ [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.flagstat:md5,4f7ffd1e6a5e85524d443209ac97d783"
+ ]
+ ],
[
[
{
@@ -117,34 +284,48 @@
},
"test.idxstats:md5,df60a8c8d6621100d05178c93fb053a2"
]
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-01-18T17:17:27.726719"
- },
- "test_bam_stats_samtools_single_end_idxstats": {
- "content": [
+ ],
[
[
{
"id": "test",
"single_end": true
},
- "test.idxstats:md5,613e048487662c694aa4a2f73ca96a20"
+ "test.stats:md5,7afd486ad6abb9a2a3dac90c99e1d87b"
]
+ ],
+ [
+ "versions.yml:md5,3c485730f712b115bcdc235e7294133b",
+ "versions.yml:md5,90f593a26a2d53e0f0345df7888f448e",
+ "versions.yml:md5,9ae003814e63a0907d52eec64d5d3ca3"
]
],
"meta": {
"nf-test": "0.8.4",
- "nextflow": "24.01.0"
+ "nextflow": "24.04.2"
},
- "timestamp": "2023-11-06T09:26:10.349439801"
+ "timestamp": "2024-07-03T12:19:36.158768"
},
- "test_bam_stats_samtools_paired_end_cram_stats": {
+ "test_bam_stats_samtools_paired_end_cram": {
"content": [
+ [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.flagstat:md5,a53f3d26e2e9851f7d528442bbfe9781"
+ ]
+ ],
+ [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.idxstats:md5,e179601fa7b8ebce81ac3765206f6c15"
+ ]
+ ],
[
[
{
@@ -153,12 +334,17 @@
},
"test.stats:md5,16b59a1f2c99d9fe30f711adc3ebe32d"
]
+ ],
+ [
+ "versions.yml:md5,3c485730f712b115bcdc235e7294133b",
+ "versions.yml:md5,90f593a26a2d53e0f0345df7888f448e",
+ "versions.yml:md5,9ae003814e63a0907d52eec64d5d3ca3"
]
],
"meta": {
"nf-test": "0.8.4",
- "nextflow": "23.10.1"
+ "nextflow": "24.04.2"
},
- "timestamp": "2024-05-29T07:46:11.96999343"
+ "timestamp": "2024-07-03T12:19:46.625907"
}
}
\ No newline at end of file
diff --git a/subworkflows/nf-core/bedgraph_bedclip_bedgraphtobigwig/tests/main.nf.test b/subworkflows/nf-core/bedgraph_bedclip_bedgraphtobigwig/tests/main.nf.test
index 94b66019e..17ec676ca 100644
--- a/subworkflows/nf-core/bedgraph_bedclip_bedgraphtobigwig/tests/main.nf.test
+++ b/subworkflows/nf-core/bedgraph_bedclip_bedgraphtobigwig/tests/main.nf.test
@@ -4,7 +4,7 @@ nextflow_workflow {
script "../main.nf"
workflow "BEDGRAPH_BEDCLIP_BEDGRAPHTOBIGWIG"
config "./nextflow.config"
-
+
test("sarscov2 [bedgraph] [genome_sizes]") {
when {
@@ -26,4 +26,28 @@ nextflow_workflow {
)
}
}
+
+ test("sarscov2 [bedgraph] [genome_sizes] - stub") {
+
+ options "-stub"
+
+ when {
+ workflow {
+ """
+ input[0] = Channel.of([
+ [ id:'test', single_end:false ], // meta map
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bedgraph/test.bedgraph', checkIfExists: true)
+ ])
+ input[1] = Channel.of(file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.sizes', checkIfExists: true))
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert workflow.success },
+ { assert snapshot(workflow.out).match() }
+ )
+ }
+ }
}
diff --git a/subworkflows/nf-core/bedgraph_bedclip_bedgraphtobigwig/tests/main.nf.test.snap b/subworkflows/nf-core/bedgraph_bedclip_bedgraphtobigwig/tests/main.nf.test.snap
index e67bed326..26ed39c00 100644
--- a/subworkflows/nf-core/bedgraph_bedclip_bedgraphtobigwig/tests/main.nf.test.snap
+++ b/subworkflows/nf-core/bedgraph_bedclip_bedgraphtobigwig/tests/main.nf.test.snap
@@ -48,6 +48,65 @@
]
}
],
+ "meta": {
+ "nf-test": "0.8.4",
+ "nextflow": "24.04.2"
+ },
"timestamp": "2023-11-26T01:55:31.016058335"
+ },
+ "sarscov2 [bedgraph] [genome_sizes] - stub": {
+ "content": [
+ {
+ "0": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.bigWig:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "1": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.clip.bedGraph:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "2": [
+ "versions.yml:md5,21c57fc724b374139b11f88017251733",
+ "versions.yml:md5,72a7b07bc0e796ff6805c57f7340337f"
+ ],
+ "bedgraph": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.clip.bedGraph:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "bigwig": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.bigWig:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "versions": [
+ "versions.yml:md5,21c57fc724b374139b11f88017251733",
+ "versions.yml:md5,72a7b07bc0e796ff6805c57f7340337f"
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.8.4",
+ "nextflow": "24.04.2"
+ },
+ "timestamp": "2024-07-03T12:22:51.388076"
}
}
\ No newline at end of file
diff --git a/subworkflows/nf-core/fastq_align_hisat2/tests/main.nf.test b/subworkflows/nf-core/fastq_align_hisat2/tests/main.nf.test
index 884d130a2..0048b3b33 100644
--- a/subworkflows/nf-core/fastq_align_hisat2/tests/main.nf.test
+++ b/subworkflows/nf-core/fastq_align_hisat2/tests/main.nf.test
@@ -17,6 +17,19 @@ nextflow_workflow {
"""
}
}
+
+ run("HISAT2_EXTRACTSPLICESITES", alias: "HISAT2_EXTRACTSPLICESITES_STUB") {
+ script "../../../../modules/nf-core/hisat2/extractsplicesites/main.nf"
+ process {
+ """
+ input[0] = Channel.of([
+ [id: 'test'],
+ file(params.modules_testdata_base_path + "genomics/sarscov2/genome/genome.gtf", checkIfExists: true)
+ ])
+ """
+ }
+ }
+
run("HISAT2_BUILD") {
script "../../../../modules/nf-core/hisat2/build/main.nf"
process {
@@ -33,6 +46,23 @@ nextflow_workflow {
"""
}
}
+
+ run("HISAT2_BUILD", alias: "HISAT2_BUILD_STUB") {
+ script "../../../../modules/nf-core/hisat2/build/main.nf"
+ process {
+ """
+ input[0] = Channel.of([
+ [id: 'test'],
+ file(params.modules_testdata_base_path + "genomics/sarscov2/genome/genome.fasta", checkIfExists: true)
+ ])
+ input[1] = Channel.of([
+ [id: 'test'],
+ file(params.modules_testdata_base_path + "genomics/sarscov2/genome/genome.gtf", checkIfExists: true)
+ ])
+ input[2] = HISAT2_EXTRACTSPLICESITES_STUB.out.txt
+ """
+ }
+ }
}
test("sarscov2 - bam - single_end") {
@@ -59,16 +89,17 @@ nextflow_workflow {
then {
assertAll(
{ assert workflow.success},
- { assert snapshot(file(workflow.out.bai[0][1]).name).match("se - bai")},
- { assert snapshot(file(workflow.out.bam[0][1]).name).match("se - bam")},
- { assert snapshot(file(workflow.out.orig_bam[0][1]).name).match("se - orig_bam")},
- { assert snapshot(workflow.out.csi).match("se - csi")},
- { assert snapshot(workflow.out.fastq).match("se - fastq")},
- { assert snapshot(workflow.out.flagstat).match("se - flagstat")},
- { assert snapshot(workflow.out.idxstats).match("se - idxstats")},
- { assert snapshot(workflow.out.stats).match("se - stats")},
- { assert snapshot(workflow.out.summary).match("se - summary")},
- { assert snapshot(workflow.out.versions).match("se - versions")}
+ { assert snapshot(
+ file(workflow.out.bai[0][1]).name,
+ file(workflow.out.bam[0][1]).name,
+ file(workflow.out.orig_bam[0][1]).name,
+ workflow.out.csi,
+ workflow.out.fastq,
+ workflow.out.flagstat,
+ workflow.out.idxstats,
+ workflow.out.stats,
+ workflow.out.summary,
+ workflow.out.versions).match()}
)
}
}
@@ -97,16 +128,79 @@ nextflow_workflow {
then {
assertAll(
{ assert workflow.success},
- { assert snapshot(file(workflow.out.bai[0][1]).name).match("pe - bai")},
- { assert snapshot(file(workflow.out.bam[0][1]).name).match("pe - bam")},
- { assert snapshot(file(workflow.out.orig_bam[0][1]).name).match("pe - orig_bam")},
- { assert snapshot(workflow.out.csi).match("pe - csi")},
- { assert snapshot(workflow.out.fastq).match("pe - fastq")},
- { assert snapshot(workflow.out.flagstat).match("pe - flagstat")},
- { assert snapshot(workflow.out.idxstats).match("pe - idxstats")},
- { assert snapshot(workflow.out.stats).match("pe - stats")},
- { assert snapshot(workflow.out.summary).match("pe - summary")},
- { assert snapshot(workflow.out.versions).match("pe - versions")}
+ { assert snapshot(
+ file(workflow.out.bai[0][1]).name,
+ file(workflow.out.bam[0][1]).name,
+ file(workflow.out.orig_bam[0][1]).name,
+ workflow.out.csi,
+ workflow.out.fastq,
+ workflow.out.flagstat,
+ workflow.out.idxstats,
+ workflow.out.stats,
+ workflow.out.summary,
+ workflow.out.versions).match()}
+ )
+ }
+ }
+
+ test("sarscov2 - bam - single_end - stub") {
+
+ options "-stub"
+
+ when {
+ workflow {
+ """
+ input[0] = Channel.of([
+ [ id:'test', single_end:true ],
+ [
+ file(params.modules_testdata_base_path + "genomics/sarscov2/illumina/fastq/test_1.fastq.gz", checkIfExists: true)
+ ]
+ ])
+ input[1] = HISAT2_BUILD_STUB.out.index
+ input[2] = HISAT2_EXTRACTSPLICESITES_STUB.out.txt
+ input[3] = Channel.of([
+ [ id:'test' ],
+ file(params.modules_testdata_base_path + "genomics/sarscov2/genome/genome.fasta", checkIfExists: true)
+ ])
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert workflow.success},
+ { assert snapshot(workflow.out).match()}
+ )
+ }
+ }
+ test("sarscov2 - bam - paired_end - stub") {
+
+ options "-stub"
+
+ when {
+ workflow {
+ """
+ input[0] = Channel.of([
+ [ id:'test', single_end:false ],
+ [
+ file(params.modules_testdata_base_path + "genomics/sarscov2/illumina/fastq/test_1.fastq.gz", checkIfExists: true),
+ file(params.modules_testdata_base_path + "genomics/sarscov2/illumina/fastq/test_2.fastq.gz", checkIfExists: true)
+ ]
+ ])
+ input[1] = HISAT2_BUILD_STUB.out.index
+ input[2] = HISAT2_EXTRACTSPLICESITES_STUB.out.txt
+ input[3] = Channel.of([
+ [ id:'test' ],
+ file(params.modules_testdata_base_path + "genomics/sarscov2/genome/genome.fasta", checkIfExists: true)
+ ])
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert workflow.success},
+ { assert snapshot(workflow.out).match()}
)
}
}
diff --git a/subworkflows/nf-core/fastq_align_hisat2/tests/main.nf.test.snap b/subworkflows/nf-core/fastq_align_hisat2/tests/main.nf.test.snap
index 6a24fc922..408dabff0 100644
--- a/subworkflows/nf-core/fastq_align_hisat2/tests/main.nf.test.snap
+++ b/subworkflows/nf-core/fastq_align_hisat2/tests/main.nf.test.snap
@@ -1,84 +1,42 @@
{
- "pe - stats": {
+ "sarscov2 - bam - single_end": {
"content": [
+ "test.sorted.bam.bai",
+ "test.sorted.bam",
+ "test.bam",
+ [
+
+ ],
+ [
+
+ ],
[
[
{
"id": "test",
- "single_end": false
+ "single_end": true
},
- "test.stats:md5,603fa8c9e0e9eb3769498fc989a29250"
+ "test.flagstat:md5,6de3bfde9582ad2532033832091f5c46"
]
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.04.2"
- },
- "timestamp": "2024-06-20T17:49:22.610136"
- },
- "pe - csi": {
- "content": [
+ ],
[
-
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-02-29T13:28:06.081055"
- },
- "se - bai": {
- "content": [
- "test.sorted.bam.bai"
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-02-29T13:27:50.763127"
- },
- "pe - flagstat": {
- "content": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.idxstats:md5,2a5df85e0d90e55bb2b359f6e05d5fbb"
+ ]
+ ],
[
[
{
"id": "test",
- "single_end": false
+ "single_end": true
},
- "test.flagstat:md5,2fa0d90162a1b655863796c2a6bd8f45"
+ "test.stats:md5,845655ccfd1fd701b9f692f8db9508af"
]
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-02-29T13:28:06.08653"
- },
- "pe - orig_bam": {
- "content": [
- "test.bam"
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-02-29T13:28:06.077797"
- },
- "se - bam": {
- "content": [
- "test.sorted.bam"
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-02-29T13:27:50.773767"
- },
- "se - summary": {
- "content": [
+ ],
[
[
{
@@ -87,26 +45,7 @@
},
"test.hisat2.summary.log:md5,7b8a9e61b7646da1089b041333c41a87"
]
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-02-29T13:27:50.818659"
- },
- "pe - bam": {
- "content": [
- "test.sorted.bam"
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-02-29T13:28:06.074968"
- },
- "se - versions": {
- "content": [
+ ],
[
"versions.yml:md5,2d9432e15956fe71fe0ba811547acea6",
"versions.yml:md5,5fcbed7fee2404be4ecee6efab5914b8",
@@ -120,102 +59,211 @@
"nf-test": "0.8.4",
"nextflow": "24.04.2"
},
- "timestamp": "2024-06-20T17:49:02.049644"
+ "timestamp": "2024-07-03T12:36:06.813423"
},
- "pe - idxstats": {
+ "sarscov2 - bam - single_end - stub": {
"content": [
- [
- [
- {
- "id": "test",
- "single_end": false
- },
- "test.idxstats:md5,1adb27b52d4d64b826f48b59d61dcd4d"
+ {
+ "0": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "1": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.hisat2.summary.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "2": [
+
+ ],
+ "3": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.sorted.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "4": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.sorted.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "5": [
+
+ ],
+ "6": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.stats:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "7": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "8": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.idxstats:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "9": [
+ "versions.yml:md5,2d9432e15956fe71fe0ba811547acea6",
+ "versions.yml:md5,5fcbed7fee2404be4ecee6efab5914b8",
+ "versions.yml:md5,6b9d9eed13bf074965d1623a7e8a1741",
+ "versions.yml:md5,7767a57d88fff540ce475902df2e9e0a",
+ "versions.yml:md5,b4ccce0351e5718d36600858452dd4b1",
+ "versions.yml:md5,bb6710ee58b84a1ed212f9c599d84066"
+ ],
+ "bai": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.sorted.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "bam": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.sorted.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "csi": [
+
+ ],
+ "fastq": [
+
+ ],
+ "flagstat": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "idxstats": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.idxstats:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "orig_bam": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "stats": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.stats:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "summary": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.hisat2.summary.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "versions": [
+ "versions.yml:md5,2d9432e15956fe71fe0ba811547acea6",
+ "versions.yml:md5,5fcbed7fee2404be4ecee6efab5914b8",
+ "versions.yml:md5,6b9d9eed13bf074965d1623a7e8a1741",
+ "versions.yml:md5,7767a57d88fff540ce475902df2e9e0a",
+ "versions.yml:md5,b4ccce0351e5718d36600858452dd4b1",
+ "versions.yml:md5,bb6710ee58b84a1ed212f9c599d84066"
]
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-02-29T13:28:06.089411"
- },
- "pe - bai": {
- "content": [
- "test.sorted.bam.bai"
+ }
],
"meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
},
- "timestamp": "2024-02-29T13:28:06.071767"
+ "timestamp": "2024-07-22T19:36:23.861012"
},
- "pe - fastq": {
+ "sarscov2 - bam - paired_end": {
"content": [
+ "test.sorted.bam.bai",
+ "test.sorted.bam",
+ "test.bam",
[
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-02-29T13:28:06.083598"
- },
- "se - fastq": {
- "content": [
+ ],
[
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-02-29T13:27:50.782981"
- },
- "se - csi": {
- "content": [
+ ],
[
-
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-02-29T13:27:50.77962"
- },
- "se - idxstats": {
- "content": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.flagstat:md5,2fa0d90162a1b655863796c2a6bd8f45"
+ ]
+ ],
[
[
{
"id": "test",
- "single_end": true
+ "single_end": false
},
- "test.idxstats:md5,2a5df85e0d90e55bb2b359f6e05d5fbb"
+ "test.idxstats:md5,1adb27b52d4d64b826f48b59d61dcd4d"
]
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-02-29T13:27:50.798637"
- },
- "se - orig_bam": {
- "content": [
- "test.bam"
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-02-29T13:27:50.776773"
- },
- "pe - summary": {
- "content": [
+ ],
+ [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.stats:md5,603fa8c9e0e9eb3769498fc989a29250"
+ ]
+ ],
[
[
{
@@ -224,16 +272,7 @@
},
"test.hisat2.summary.log:md5,9839b31db795958cc4b70711a3414e9c"
]
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-02-29T13:28:06.095265"
- },
- "pe - versions": {
- "content": [
+ ],
[
"versions.yml:md5,2d9432e15956fe71fe0ba811547acea6",
"versions.yml:md5,5fcbed7fee2404be4ecee6efab5914b8",
@@ -247,42 +286,171 @@
"nf-test": "0.8.4",
"nextflow": "24.04.2"
},
- "timestamp": "2024-06-20T17:49:22.664338"
+ "timestamp": "2024-07-03T12:36:25.071168"
},
- "se - flagstat": {
+ "sarscov2 - bam - paired_end - stub": {
"content": [
- [
- [
- {
- "id": "test",
- "single_end": true
- },
- "test.flagstat:md5,6de3bfde9582ad2532033832091f5c46"
+ {
+ "0": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "1": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.hisat2.summary.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "2": [
+
+ ],
+ "3": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.sorted.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "4": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.sorted.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "5": [
+
+ ],
+ "6": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.stats:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "7": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "8": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.idxstats:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "9": [
+ "versions.yml:md5,2d9432e15956fe71fe0ba811547acea6",
+ "versions.yml:md5,5fcbed7fee2404be4ecee6efab5914b8",
+ "versions.yml:md5,6b9d9eed13bf074965d1623a7e8a1741",
+ "versions.yml:md5,7767a57d88fff540ce475902df2e9e0a",
+ "versions.yml:md5,b4ccce0351e5718d36600858452dd4b1",
+ "versions.yml:md5,bb6710ee58b84a1ed212f9c599d84066"
+ ],
+ "bai": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.sorted.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "bam": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.sorted.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "csi": [
+
+ ],
+ "fastq": [
+
+ ],
+ "flagstat": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "idxstats": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.idxstats:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "orig_bam": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "stats": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.stats:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "summary": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.hisat2.summary.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "versions": [
+ "versions.yml:md5,2d9432e15956fe71fe0ba811547acea6",
+ "versions.yml:md5,5fcbed7fee2404be4ecee6efab5914b8",
+ "versions.yml:md5,6b9d9eed13bf074965d1623a7e8a1741",
+ "versions.yml:md5,7767a57d88fff540ce475902df2e9e0a",
+ "versions.yml:md5,b4ccce0351e5718d36600858452dd4b1",
+ "versions.yml:md5,bb6710ee58b84a1ed212f9c599d84066"
]
- ]
+ }
],
"meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-02-29T13:27:50.786813"
- },
- "se - stats": {
- "content": [
- [
- [
- {
- "id": "test",
- "single_end": true
- },
- "test.stats:md5,845655ccfd1fd701b9f692f8db9508af"
- ]
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.04.2"
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
},
- "timestamp": "2024-06-20T17:49:01.982358"
+ "timestamp": "2024-07-22T19:36:44.894976"
}
}
\ No newline at end of file
diff --git a/subworkflows/nf-core/fastq_fastqc_umitools_fastp/tests/main.nf.test b/subworkflows/nf-core/fastq_fastqc_umitools_fastp/tests/main.nf.test
index 7bcb4b052..48ba5f48b 100644
--- a/subworkflows/nf-core/fastq_fastqc_umitools_fastp/tests/main.nf.test
+++ b/subworkflows/nf-core/fastq_fastqc_umitools_fastp/tests/main.nf.test
@@ -5,6 +5,15 @@ nextflow_workflow {
workflow "FASTQ_FASTQC_UMITOOLS_FASTP"
config './nextflow.config'
+ tag "subworkflows"
+ tag "subworkflows_nfcore"
+ tag "subworkflows/fastq_fastqc_umitools_fastp"
+ tag "fastq_fastqc_umitools_fastp"
+ tag "fastqc"
+ tag "umitools/extract"
+ tag "fastp"
+
+
test("sarscov2 paired-end [fastq]") {
when {
@@ -43,24 +52,23 @@ nextflow_workflow {
then {
assertAll(
{ assert workflow.success },
+ { assert workflow.out.fastqc_raw_html },
+ { assert workflow.out.fastqc_raw_zip },
+ { assert workflow.out.fastqc_trim_html },
+ { assert workflow.out.fastqc_trim_zip },
+ { assert workflow.out.trim_html },
+ { assert workflow.out.trim_log },
{ assert snapshot(
+ workflow.out.adapter_seq,
workflow.out.reads,
- workflow.out.umi_log,
workflow.out.trim_json,
+ workflow.out.trim_read_count,
workflow.out.trim_reads_fail,
workflow.out.trim_reads_merged,
- workflow.out.adapter_seq,
- workflow.out.trim_read_count,
+ workflow.out.umi_log,
workflow.out.versions
).match()
- },
-
- { assert workflow.out.fastqc_raw_html },
- { assert workflow.out.fastqc_raw_zip },
- { assert workflow.out.trim_html },
- { assert workflow.out.trim_log },
- { assert workflow.out.fastqc_trim_html },
- { assert workflow.out.fastqc_trim_zip }
+ }
)
}
}
@@ -103,24 +111,23 @@ nextflow_workflow {
then {
assertAll(
{ assert workflow.success },
+ { assert workflow.out.trim_html },
+ { assert workflow.out.trim_log },
+ { assert !workflow.out.fastqc_raw_html },
+ { assert !workflow.out.fastqc_raw_zip },
+ { assert !workflow.out.fastqc_trim_html },
+ { assert !workflow.out.fastqc_trim_zip },
{ assert snapshot(
+ workflow.out.adapter_seq,
workflow.out.reads,
- workflow.out.umi_log,
workflow.out.trim_json,
+ workflow.out.trim_read_count,
workflow.out.trim_reads_fail,
workflow.out.trim_reads_merged,
- workflow.out.adapter_seq,
- workflow.out.trim_read_count,
+ workflow.out.umi_log,
workflow.out.versions
).match()
- },
-
- { assert !workflow.out.fastqc_raw_html },
- { assert !workflow.out.fastqc_raw_zip },
- { assert workflow.out.trim_html },
- { assert workflow.out.trim_log },
- { assert !workflow.out.fastqc_trim_html },
- { assert !workflow.out.fastqc_trim_zip }
+ }
)
}
}
@@ -163,23 +170,22 @@ nextflow_workflow {
then {
assertAll(
{ assert workflow.success },
+ { assert workflow.out.fastqc_raw_html },
+ { assert workflow.out.fastqc_raw_zip },
+ { assert workflow.out.fastqc_trim_html },
+ { assert workflow.out.fastqc_trim_zip },
+ { assert workflow.out.trim_html },
+ { assert workflow.out.trim_log },
{ assert snapshot(
+ workflow.out.adapter_seq,
workflow.out.reads,
workflow.out.trim_json,
+ workflow.out.trim_read_count,
workflow.out.trim_reads_fail,
workflow.out.trim_reads_merged,
- workflow.out.adapter_seq,
- workflow.out.trim_read_count,
workflow.out.versions
).match()
- },
-
- { assert workflow.out.fastqc_raw_html },
- { assert workflow.out.fastqc_raw_zip },
- { assert workflow.out.trim_html },
- { assert workflow.out.trim_log },
- { assert workflow.out.fastqc_trim_html },
- { assert workflow.out.fastqc_trim_zip }
+ }
)
}
}
@@ -223,24 +229,23 @@ nextflow_workflow {
then {
assertAll(
{ assert workflow.success },
+ { assert workflow.out.fastqc_raw_html },
+ { assert workflow.out.fastqc_raw_zip },
+ { assert workflow.out.fastqc_trim_html },
+ { assert workflow.out.fastqc_trim_zip },
+ { assert workflow.out.trim_html },
+ { assert workflow.out.trim_log },
{ assert snapshot(
+ workflow.out.adapter_seq,
workflow.out.reads,
- workflow.out.umi_log,
workflow.out.trim_json,
+ workflow.out.trim_read_count,
workflow.out.trim_reads_fail,
workflow.out.trim_reads_merged,
- workflow.out.adapter_seq,
- workflow.out.trim_read_count,
+ workflow.out.umi_log,
workflow.out.versions
).match()
- },
-
- { assert workflow.out.fastqc_raw_html },
- { assert workflow.out.fastqc_raw_zip },
- { assert workflow.out.trim_html },
- { assert workflow.out.trim_log },
- { assert workflow.out.fastqc_trim_html },
- { assert workflow.out.fastqc_trim_zip }
+ }
)
}
}
@@ -283,24 +288,23 @@ nextflow_workflow {
then {
assertAll(
{ assert workflow.success },
+ { assert workflow.out.fastqc_raw_html },
+ { assert workflow.out.fastqc_raw_zip },
+ { assert workflow.out.fastqc_trim_html },
+ { assert workflow.out.fastqc_trim_zip },
+ { assert workflow.out.trim_html },
+ { assert workflow.out.trim_log },
{ assert snapshot(
+ workflow.out.adapter_seq,
workflow.out.reads,
- workflow.out.umi_log,
workflow.out.trim_json,
+ workflow.out.trim_read_count,
workflow.out.trim_reads_fail,
workflow.out.trim_reads_merged,
- workflow.out.adapter_seq,
- workflow.out.trim_read_count,
+ workflow.out.umi_log,
workflow.out.versions
).match()
- },
-
- { assert workflow.out.fastqc_raw_html },
- { assert workflow.out.fastqc_raw_zip },
- { assert workflow.out.trim_html },
- { assert workflow.out.trim_log },
- { assert workflow.out.fastqc_trim_html },
- { assert workflow.out.fastqc_trim_zip }
+ }
)
}
}
@@ -343,27 +347,24 @@ nextflow_workflow {
then {
assertAll(
{ assert workflow.success },
+ { assert workflow.out.fastqc_raw_html },
+ { assert workflow.out.fastqc_raw_zip },
+ { assert !workflow.out.fastqc_trim_html },
+ { assert !workflow.out.fastqc_trim_zip },
+ { assert !workflow.out.trim_html },
+ { assert !workflow.out.trim_log },
{ assert snapshot(
+ // If we skip trimming then input is output, so not snapshotting
+ workflow.out.adapter_seq,
workflow.out.reads.get(0).get(0), // Reads meta map
- // Because the input file is passed to the output file, we have to do check the filename only
- file(workflow.out.reads.get(0).get(1).get(0)).name,
- file(workflow.out.reads.get(0).get(1).get(1)).name,
- workflow.out.umi_log,
workflow.out.trim_json,
+ workflow.out.trim_read_count,
workflow.out.trim_reads_fail,
workflow.out.trim_reads_merged,
- workflow.out.adapter_seq,
- workflow.out.trim_read_count,
+ workflow.out.umi_log,
workflow.out.versions
).match()
- },
-
- { assert workflow.out.fastqc_raw_html },
- { assert workflow.out.fastqc_raw_zip },
- { assert !workflow.out.trim_html },
- { assert !workflow.out.trim_log },
- { assert !workflow.out.fastqc_trim_html },
- { assert !workflow.out.fastqc_trim_zip }
+ }
)
}
}
@@ -408,24 +409,23 @@ nextflow_workflow {
then {
assertAll(
{ assert workflow.success },
+ { assert workflow.out.fastqc_raw_html },
+ { assert workflow.out.fastqc_raw_zip },
+ { assert workflow.out.fastqc_trim_html },
+ { assert workflow.out.fastqc_trim_zip },
+ { assert workflow.out.trim_html },
+ { assert workflow.out.trim_log },
{ assert snapshot(
+ workflow.out.adapter_seq,
workflow.out.reads,
- workflow.out.umi_log,
workflow.out.trim_json,
+ workflow.out.trim_read_count,
workflow.out.trim_reads_fail,
workflow.out.trim_reads_merged,
- workflow.out.adapter_seq,
- workflow.out.trim_read_count,
+ workflow.out.umi_log,
workflow.out.versions
).match()
- },
-
- { assert workflow.out.fastqc_raw_html },
- { assert workflow.out.fastqc_raw_zip },
- { assert workflow.out.trim_html },
- { assert workflow.out.trim_log },
- { assert workflow.out.fastqc_trim_html },
- { assert workflow.out.fastqc_trim_zip }
+ }
)
}
}
@@ -468,24 +468,23 @@ nextflow_workflow {
then {
assertAll(
{ assert workflow.success },
+ { assert workflow.out.fastqc_raw_html },
+ { assert workflow.out.fastqc_raw_zip },
+ { assert workflow.out.fastqc_trim_html },
+ { assert workflow.out.fastqc_trim_zip },
+ { assert workflow.out.trim_html },
+ { assert workflow.out.trim_log },
{ assert snapshot(
+ workflow.out.adapter_seq,
workflow.out.reads,
- workflow.out.umi_log,
workflow.out.trim_json,
+ workflow.out.trim_read_count,
workflow.out.trim_reads_fail,
workflow.out.trim_reads_merged,
- workflow.out.adapter_seq,
- workflow.out.trim_read_count,
+ workflow.out.umi_log,
workflow.out.versions
).match()
- },
-
- { assert workflow.out.fastqc_raw_html },
- { assert workflow.out.fastqc_raw_zip },
- { assert workflow.out.trim_html },
- { assert workflow.out.trim_log },
- { assert workflow.out.fastqc_trim_html },
- { assert workflow.out.fastqc_trim_zip }
+ }
)
}
}
@@ -529,24 +528,23 @@ nextflow_workflow {
then {
assertAll(
{ assert workflow.success },
+ { assert workflow.out.fastqc_raw_html },
+ { assert workflow.out.fastqc_raw_zip },
+ { assert workflow.out.fastqc_trim_html },
+ { assert workflow.out.fastqc_trim_zip },
+ { assert workflow.out.trim_html },
+ { assert workflow.out.trim_log },
{ assert snapshot(
+ workflow.out.adapter_seq,
workflow.out.reads,
- workflow.out.umi_log,
workflow.out.trim_json,
+ workflow.out.trim_read_count,
workflow.out.trim_reads_fail,
workflow.out.trim_reads_merged,
- workflow.out.adapter_seq,
- workflow.out.trim_read_count,
+ workflow.out.umi_log,
workflow.out.versions
).match()
- },
-
- { assert workflow.out.fastqc_raw_html },
- { assert workflow.out.fastqc_raw_zip },
- { assert workflow.out.trim_html },
- { assert workflow.out.trim_log },
- { assert workflow.out.fastqc_trim_html },
- { assert workflow.out.fastqc_trim_zip }
+ }
)
}
}
@@ -595,4 +593,381 @@ nextflow_workflow {
)
}
}
+
+ test("skip_fastqc - stub") {
+
+ options "-stub"
+
+ when {
+ workflow {
+ """
+ skip_fastqc = true
+ with_umi = false
+ skip_umi_extract = false
+ umi_discard_read = 1
+ skip_trimming = false
+ adapter_fasta = []
+ save_trimmed_fail = false
+ save_merged = false
+ min_trimmed_reads = 1
+
+ input[0] = Channel.of([
+ [ id:'test', single_end: false ], // meta map
+ [
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)
+ ]
+ ])
+ input[1] = skip_fastqc
+ input[2] = with_umi
+ input[3] = skip_umi_extract
+ input[4] = umi_discard_read
+ input[5] = skip_trimming
+ input[6] = adapter_fasta
+ input[7] = save_trimmed_fail
+ input[8] = save_merged
+ input[9] = min_trimmed_reads
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert workflow.success },
+ { assert snapshot(workflow.out).match() }
+ )
+ }
+ }
+
+ test("with_umi - stub") {
+
+ options "-stub"
+
+ when {
+ workflow {
+ """
+ skip_fastqc = false
+ with_umi = true
+ skip_umi_extract = false
+ umi_discard_read = 1
+ skip_trimming = false
+ adapter_fasta = []
+ save_trimmed_fail = false
+ save_merged = false
+ min_trimmed_reads = 1
+
+ input[0] = Channel.of([
+ [ id:'test', single_end:false ], // meta map
+ [
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)
+ ]
+ ])
+ input[1] = skip_fastqc
+ input[2] = with_umi
+ input[3] = skip_umi_extract
+ input[4] = umi_discard_read
+ input[5] = skip_trimming
+ input[6] = adapter_fasta
+ input[7] = save_trimmed_fail
+ input[8] = save_merged
+ input[9] = min_trimmed_reads
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert workflow.success },
+ { assert snapshot(workflow.out).match() }
+ )
+ }
+ }
+
+
+ test("skip_umi_extract - stub") {
+
+ options "-stub"
+
+ when {
+ workflow {
+ """
+ skip_fastqc = false
+ with_umi = true
+ skip_umi_extract = true
+ umi_discard_read = 1
+ skip_trimming = false
+ adapter_fasta = []
+ save_trimmed_fail = false
+ save_merged = false
+ min_trimmed_reads = 1
+
+ input[0] = Channel.of([
+ [ id:'test', single_end:false ], // meta map
+ [
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)
+ ]
+ ])
+ input[1] = skip_fastqc
+ input[2] = with_umi
+ input[3] = skip_umi_extract
+ input[4] = umi_discard_read
+ input[5] = skip_trimming
+ input[6] = adapter_fasta
+ input[7] = save_trimmed_fail
+ input[8] = save_merged
+ input[9] = min_trimmed_reads
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert workflow.success },
+ { assert snapshot(workflow.out).match() }
+ )
+ }
+ }
+
+ test("umi_discard_read = 2 - stub") {
+
+ options "-stub"
+
+ when {
+ workflow {
+ """
+ skip_fastqc = false
+ with_umi = true
+ skip_umi_extract = true
+ umi_discard_read = 2
+ skip_trimming = false
+ adapter_fasta = []
+ save_trimmed_fail = false
+ save_merged = false
+ min_trimmed_reads = 1
+
+ input[0] = Channel.of([
+ [ id:'test', single_end:false ], // meta map
+ [
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)
+ ]
+ ])
+ input[1] = skip_fastqc
+ input[2] = with_umi
+ input[3] = skip_umi_extract
+ input[4] = umi_discard_read
+ input[5] = skip_trimming
+ input[6] = adapter_fasta
+ input[7] = save_trimmed_fail
+ input[8] = save_merged
+ input[9] = min_trimmed_reads
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert workflow.success },
+ { assert snapshot(workflow.out).match() }
+ )
+ }
+ }
+
+ test("skip_trimming - stub") {
+
+ options "-stub"
+
+ when {
+ workflow {
+ """
+ skip_fastqc = false
+ with_umi = false
+ skip_umi_extract = false
+ umi_discard_read = 1
+ skip_trimming = true
+ adapter_fasta = []
+ save_trimmed_fail = false
+ save_merged = false
+ min_trimmed_reads = 1
+
+ input[0] = Channel.of([
+ [ id:'test', single_end:false ], // meta map
+ [
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)
+ ]
+ ])
+ input[1] = skip_fastqc
+ input[2] = with_umi
+ input[3] = skip_umi_extract
+ input[4] = umi_discard_read
+ input[5] = skip_trimming
+ input[6] = adapter_fasta
+ input[7] = save_trimmed_fail
+ input[8] = save_merged
+ input[9] = min_trimmed_reads
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert workflow.success },
+ { assert snapshot(
+ workflow.out.adapter_seq,
+ workflow.out.fastqc_raw_html,
+ workflow.out.fastqc_raw_zip,
+ workflow.out.fastqc_trim_html,
+ workflow.out.fastqc_trim_zip,
+ workflow.out.trim_html,
+ workflow.out.trim_json,
+ workflow.out.trim_log,
+ workflow.out.trim_read_count,
+ workflow.out.trim_reads_fail,
+ workflow.out.trim_reads_merged,
+ workflow.out.umi_log,
+ workflow.out.versions).match() }
+ )
+ }
+ }
+
+ test("save_trimmed_fail - stub") {
+
+ options "-stub"
+
+ config './nextflow.save_trimmed.config'
+
+ when {
+ workflow {
+ """
+ skip_fastqc = false
+ with_umi = false
+ skip_umi_extract = false
+ umi_discard_read = 1
+ skip_trimming = false
+ adapter_fasta = []
+ save_trimmed_fail = true
+ save_merged = false
+ min_trimmed_reads = 1
+
+ input[0] = Channel.of([
+ [ id:'test', single_end:false ], // meta map
+ [
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)
+ ]
+ ])
+ input[1] = skip_fastqc
+ input[2] = with_umi
+ input[3] = skip_umi_extract
+ input[4] = umi_discard_read
+ input[5] = skip_trimming
+ input[6] = adapter_fasta
+ input[7] = save_trimmed_fail
+ input[8] = save_merged
+ input[9] = min_trimmed_reads
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert workflow.success },
+ { assert snapshot(workflow.out).match() }
+ )
+ }
+ }
+
+ test("save_merged - stub") {
+
+ options "-stub"
+
+ when {
+ workflow {
+ """
+ skip_fastqc = false
+ with_umi = false
+ skip_umi_extract = false
+ umi_discard_read = 1
+ skip_trimming = false
+ adapter_fasta = []
+ save_trimmed_fail = false
+ save_merged = true
+ min_trimmed_reads = 1
+
+ input[0] = Channel.of([
+ [ id:'test', single_end:false ], // meta map
+ [
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)
+ ]
+ ])
+ input[1] = skip_fastqc
+ input[2] = with_umi
+ input[3] = skip_umi_extract
+ input[4] = umi_discard_read
+ input[5] = skip_trimming
+ input[6] = adapter_fasta
+ input[7] = save_trimmed_fail
+ input[8] = save_merged
+ input[9] = min_trimmed_reads
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert workflow.success },
+ { assert snapshot(workflow.out).match() }
+ )
+ }
+ }
+
+ test("min_trimmed_reads = 26 - stub") {
+ // Subworkflow should stop after FASTP which trims down to 25 reads
+
+ options "-stub"
+
+ when {
+ workflow {
+ """
+ skip_fastqc = false
+ with_umi = false
+ skip_umi_extract = false
+ umi_discard_read = 1
+ skip_trimming = false
+ adapter_fasta = []
+ save_trimmed_fail = false
+ save_merged = true
+ min_trimmed_reads = 26
+
+ input[0] = Channel.of([
+ [ id:'test', single_end:false ], // meta map
+ [
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)
+ ]
+ ])
+ input[1] = skip_fastqc
+ input[2] = with_umi
+ input[3] = skip_umi_extract
+ input[4] = umi_discard_read
+ input[5] = skip_trimming
+ input[6] = adapter_fasta
+ input[7] = save_trimmed_fail
+ input[8] = save_merged
+ input[9] = min_trimmed_reads
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert workflow.success },
+ { assert snapshot(workflow.out).match() }
+ )
+ }
+ }
}
diff --git a/subworkflows/nf-core/fastq_fastqc_umitools_fastp/tests/main.nf.test.snap b/subworkflows/nf-core/fastq_fastqc_umitools_fastp/tests/main.nf.test.snap
index b591fab90..e7d1f51ed 100644
--- a/subworkflows/nf-core/fastq_fastqc_umitools_fastp/tests/main.nf.test.snap
+++ b/subworkflows/nf-core/fastq_fastqc_umitools_fastp/tests/main.nf.test.snap
@@ -1,36 +1,6 @@
{
"skip_fastqc": {
"content": [
- [
- [
- {
- "id": "test",
- "single_end": false
- },
- [
- "test_1.fastp.fastq.gz:md5,67b2bbae47f073e05a97a9c2edce23c7",
- "test_2.fastp.fastq.gz:md5,25cbdca08e2083dbd4f0502de6b62f39"
- ]
- ]
- ],
- [
-
- ],
- [
- [
- {
- "id": "test",
- "single_end": false
- },
- "test.fastp.json:md5,1e0f8e27e71728e2b63fc64086be95cd"
- ]
- ],
- [
-
- ],
- [
-
- ],
[
[
{
@@ -40,27 +10,6 @@
"unspecified"
]
],
- [
- [
- {
- "id": "test",
- "single_end": false
- },
- 198
- ]
- ],
- [
- "versions.yml:md5,85bd0117e5778fff18e3920972a296ad"
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.04.2"
- },
- "timestamp": "2024-06-10T15:08:06.209854813"
- },
- "save_trimmed_fail": {
- "content": [
[
[
{
@@ -68,13 +17,10 @@
"single_end": false
},
[
- "test_1.fastp.fastq.gz:md5,6ff32a64c5188b9a9192be1398c262c7",
- "test_2.fastp.fastq.gz:md5,db0cb7c9977e94ac2b4b446ebd017a8a"
+ "test_1.fastp.fastq.gz:md5,67b2bbae47f073e05a97a9c2edce23c7",
+ "test_2.fastp.fastq.gz:md5,25cbdca08e2083dbd4f0502de6b62f39"
]
]
- ],
- [
-
],
[
[
@@ -82,7 +28,7 @@
"id": "test",
"single_end": false
},
- "test.fastp.json:md5,4c3268ddb50ea5b33125984776aa3519"
+ "test.fastp.json:md5,1e0f8e27e71728e2b63fc64086be95cd"
]
],
[
@@ -91,47 +37,29 @@
"id": "test",
"single_end": false
},
- [
- "test.paired.fail.fastq.gz:md5,409b687c734cedd7a1fec14d316e1366",
- "test_1.fail.fastq.gz:md5,4f273cf3159c13f79e8ffae12f5661f6",
- "test_2.fail.fastq.gz:md5,f97b9edefb5649aab661fbc9e71fc995"
- ]
+ 198
]
],
[
],
[
- [
- {
- "id": "test",
- "single_end": false
- },
- "unspecified"
- ]
+
],
[
- [
- {
- "id": "test",
- "single_end": false
- },
- 162
- ]
+
],
[
- "versions.yml:md5,85bd0117e5778fff18e3920972a296ad",
- "versions.yml:md5,c50aa59475ab901bc6f9a2cf7b1a14e0",
- "versions.yml:md5,f3dcaae948e8eed92b4a5557b4c6668e"
+ "versions.yml:md5,85bd0117e5778fff18e3920972a296ad"
]
],
"meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.04.2"
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
},
- "timestamp": "2024-06-10T15:09:56.338504908"
+ "timestamp": "2024-07-22T16:56:01.933832"
},
- "skip_umi_extract": {
+ "save_trimmed_fail": {
"content": [
[
[
@@ -139,14 +67,8 @@
"id": "test",
"single_end": false
},
- [
- "test_1.fastp.fastq.gz:md5,67b2bbae47f073e05a97a9c2edce23c7",
- "test_2.fastp.fastq.gz:md5,25cbdca08e2083dbd4f0502de6b62f39"
- ]
+ "unspecified"
]
- ],
- [
-
],
[
[
@@ -154,14 +76,11 @@
"id": "test",
"single_end": false
},
- "test.fastp.json:md5,1e0f8e27e71728e2b63fc64086be95cd"
+ [
+ "test_1.fastp.fastq.gz:md5,6ff32a64c5188b9a9192be1398c262c7",
+ "test_2.fastp.fastq.gz:md5,db0cb7c9977e94ac2b4b446ebd017a8a"
+ ]
]
- ],
- [
-
- ],
- [
-
],
[
[
@@ -169,7 +88,7 @@
"id": "test",
"single_end": false
},
- "unspecified"
+ "test.fastp.json:md5,4c3268ddb50ea5b33125984776aa3519"
]
],
[
@@ -178,23 +97,9 @@
"id": "test",
"single_end": false
},
- 198
+ 162
]
],
- [
- "versions.yml:md5,85bd0117e5778fff18e3920972a296ad",
- "versions.yml:md5,c50aa59475ab901bc6f9a2cf7b1a14e0",
- "versions.yml:md5,f3dcaae948e8eed92b4a5557b4c6668e"
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.04.2"
- },
- "timestamp": "2024-06-10T15:08:51.174735433"
- },
- "umi_discard_read = 2": {
- "content": [
[
[
{
@@ -202,46 +107,17 @@
"single_end": false
},
[
- "test_1.fastp.fastq.gz:md5,67b2bbae47f073e05a97a9c2edce23c7",
- "test_2.fastp.fastq.gz:md5,25cbdca08e2083dbd4f0502de6b62f39"
+ "test.paired.fail.fastq.gz:md5,409b687c734cedd7a1fec14d316e1366",
+ "test_1.fail.fastq.gz:md5,4f273cf3159c13f79e8ffae12f5661f6",
+ "test_2.fail.fastq.gz:md5,f97b9edefb5649aab661fbc9e71fc995"
]
]
],
[
- ],
- [
- [
- {
- "id": "test",
- "single_end": false
- },
- "test.fastp.json:md5,1e0f8e27e71728e2b63fc64086be95cd"
- ]
- ],
- [
-
],
[
- ],
- [
- [
- {
- "id": "test",
- "single_end": false
- },
- "unspecified"
- ]
- ],
- [
- [
- {
- "id": "test",
- "single_end": false
- },
- 198
- ]
],
[
"versions.yml:md5,85bd0117e5778fff18e3920972a296ad",
@@ -250,12 +126,12 @@
]
],
"meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.04.2"
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
},
- "timestamp": "2024-06-10T15:09:14.145250471"
+ "timestamp": "2024-07-22T16:57:38.736"
},
- "save_merged": {
+ "skip_umi_extract": {
"content": [
[
[
@@ -263,26 +139,8 @@
"id": "test",
"single_end": false
},
- [
- "test_1.fastp.fastq.gz:md5,54b726a55e992a869fd3fa778afe1672",
- "test_2.fastp.fastq.gz:md5,29d3b33b869f7b63417b8ff07bb128ba"
- ]
- ]
- ],
- [
-
- ],
- [
- [
- {
- "id": "test",
- "single_end": false
- },
- "test.fastp.json:md5,b712fd68ed0322f4bec49ff2a5237fcc"
+ "unspecified"
]
- ],
- [
-
],
[
[
@@ -290,7 +148,10 @@
"id": "test",
"single_end": false
},
- "test.merged.fastq.gz:md5,c873bb1ab3fa859dcc47306465e749d5"
+ [
+ "test_1.fastp.fastq.gz:md5,67b2bbae47f073e05a97a9c2edce23c7",
+ "test_2.fastp.fastq.gz:md5,25cbdca08e2083dbd4f0502de6b62f39"
+ ]
]
],
[
@@ -299,7 +160,7 @@
"id": "test",
"single_end": false
},
- "unspecified"
+ "test.fastp.json:md5,1e0f8e27e71728e2b63fc64086be95cd"
]
],
[
@@ -308,37 +169,8 @@
"id": "test",
"single_end": false
},
- 75
+ 198
]
- ],
- [
- "versions.yml:md5,85bd0117e5778fff18e3920972a296ad",
- "versions.yml:md5,c50aa59475ab901bc6f9a2cf7b1a14e0",
- "versions.yml:md5,f3dcaae948e8eed92b4a5557b4c6668e"
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.04.2"
- },
- "timestamp": "2024-06-10T15:10:16.25526763"
- },
- "skip_trimming": {
- "content": [
- {
- "id": "test",
- "single_end": false
- },
- "test_1.fastq.gz",
- "test_2.fastq.gz",
- [
-
- ],
- [
-
- ],
- [
-
],
[
@@ -350,16 +182,18 @@
],
[
+ "versions.yml:md5,85bd0117e5778fff18e3920972a296ad",
+ "versions.yml:md5,c50aa59475ab901bc6f9a2cf7b1a14e0",
"versions.yml:md5,f3dcaae948e8eed92b4a5557b4c6668e"
]
],
"meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.10.1"
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
},
- "timestamp": "2024-03-19T15:49:26.574759"
+ "timestamp": "2024-07-22T16:56:47.905105"
},
- "sarscov2 paired-end [fastq]": {
+ "umi_discard_read = 2": {
"content": [
[
[
@@ -367,14 +201,8 @@
"id": "test",
"single_end": false
},
- [
- "test_1.fastp.fastq.gz:md5,67b2bbae47f073e05a97a9c2edce23c7",
- "test_2.fastp.fastq.gz:md5,25cbdca08e2083dbd4f0502de6b62f39"
- ]
+ "unspecified"
]
- ],
- [
-
],
[
[
@@ -382,14 +210,11 @@
"id": "test",
"single_end": false
},
- "test.fastp.json:md5,1e0f8e27e71728e2b63fc64086be95cd"
+ [
+ "test_1.fastp.fastq.gz:md5,67b2bbae47f073e05a97a9c2edce23c7",
+ "test_2.fastp.fastq.gz:md5,25cbdca08e2083dbd4f0502de6b62f39"
+ ]
]
- ],
- [
-
- ],
- [
-
],
[
[
@@ -397,7 +222,7 @@
"id": "test",
"single_end": false
},
- "unspecified"
+ "test.fastp.json:md5,1e0f8e27e71728e2b63fc64086be95cd"
]
],
[
@@ -408,6 +233,15 @@
},
198
]
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+
],
[
"versions.yml:md5,85bd0117e5778fff18e3920972a296ad",
@@ -416,25 +250,238 @@
]
],
"meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.04.2"
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
},
- "timestamp": "2024-06-10T15:07:52.031579846"
+ "timestamp": "2024-07-22T16:57:05.436744"
},
- "min_trimmed_reads = 26": {
+ "umi_discard_read = 2 - stub": {
"content": [
- [
- [
- {
- "id": "test",
- "single_end": false
- },
+ {
+ "0": [
[
- "test_1.fastp.fastq.gz:md5,54b726a55e992a869fd3fa778afe1672",
- "test_2.fastp.fastq.gz:md5,29d3b33b869f7b63417b8ff07bb128ba"
- ]
- ]
- ],
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+ "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ]
+ ],
+ "1": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "10": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ 1
+ ]
+ ],
+ "11": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "12": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "13": [
+ "versions.yml:md5,85bd0117e5778fff18e3920972a296ad",
+ "versions.yml:md5,c50aa59475ab901bc6f9a2cf7b1a14e0",
+ "versions.yml:md5,f3dcaae948e8eed92b4a5557b4c6668e"
+ ],
+ "2": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "3": [
+
+ ],
+ "4": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ ""
+ ]
+ ],
+ "5": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "6": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "7": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "8": [
+
+ ],
+ "9": [
+
+ ],
+ "adapter_seq": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ ""
+ ]
+ ],
+ "fastqc_raw_html": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "fastqc_raw_zip": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "fastqc_trim_html": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "fastqc_trim_zip": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "reads": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+ "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ]
+ ],
+ "trim_html": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "trim_json": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "trim_log": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "trim_read_count": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ 1
+ ]
+ ],
+ "trim_reads_fail": [
+
+ ],
+ "trim_reads_merged": [
+
+ ],
+ "umi_log": [
+
+ ],
+ "versions": [
+ "versions.yml:md5,85bd0117e5778fff18e3920972a296ad",
+ "versions.yml:md5,c50aa59475ab901bc6f9a2cf7b1a14e0",
+ "versions.yml:md5,f3dcaae948e8eed92b4a5557b4c6668e"
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
+ },
+ "timestamp": "2024-07-22T16:59:27.273892"
+ },
+ "skip_trimming - stub": {
+ "content": [
[
],
@@ -444,11 +491,8 @@
"id": "test",
"single_end": false
},
- "test.fastp.json:md5,b712fd68ed0322f4bec49ff2a5237fcc"
+ "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
]
- ],
- [
-
],
[
[
@@ -456,65 +500,150 @@
"id": "test",
"single_end": false
},
- "test.merged.fastq.gz:md5,c873bb1ab3fa859dcc47306465e749d5"
+ "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
]
],
[
- [
- {
- "id": "test",
- "single_end": false
- },
- "unspecified"
- ]
+
],
[
- [
- {
- "id": "test",
- "single_end": false
- },
- 75
- ]
+
],
[
- "versions.yml:md5,85bd0117e5778fff18e3920972a296ad",
- "versions.yml:md5,c50aa59475ab901bc6f9a2cf7b1a14e0",
- "versions.yml:md5,f3dcaae948e8eed92b4a5557b4c6668e"
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.04.2"
- },
- "timestamp": "2024-06-10T15:10:34.68796644"
- },
- "with_umi": {
- "content": [
+
+ ],
[
- [
- {
- "id": "test",
- "single_end": true
+
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+ "versions.yml:md5,f3dcaae948e8eed92b4a5557b4c6668e"
+ ]
+ ],
+ "meta": {
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
+ },
+ "timestamp": "2024-07-22T16:59:39.247758"
+ },
+ "save_merged": {
+ "content": [
+ [
+ [
+ {
+ "id": "test",
+ "single_end": false
},
- "test.fastp.fastq.gz:md5,ba8c6c3a7ce718d9a2c5857e2edf53bc"
+ "unspecified"
]
],
[
[
{
"id": "test",
- "single_end": true
+ "single_end": false
},
- "test.fastp.json:md5,d39c5c6d9a2e35fb60d26ced46569af6"
+ [
+ "test_1.fastp.fastq.gz:md5,54b726a55e992a869fd3fa778afe1672",
+ "test_2.fastp.fastq.gz:md5,29d3b33b869f7b63417b8ff07bb128ba"
+ ]
+ ]
+ ],
+ [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.json:md5,b712fd68ed0322f4bec49ff2a5237fcc"
+ ]
+ ],
+ [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ 75
+ ]
+ ],
+ [
+
+ ],
+ [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.merged.fastq.gz:md5,c873bb1ab3fa859dcc47306465e749d5"
]
],
[
+ ],
+ [
+ "versions.yml:md5,85bd0117e5778fff18e3920972a296ad",
+ "versions.yml:md5,c50aa59475ab901bc6f9a2cf7b1a14e0",
+ "versions.yml:md5,f3dcaae948e8eed92b4a5557b4c6668e"
+ ]
+ ],
+ "meta": {
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
+ },
+ "timestamp": "2024-07-22T16:57:57.472342"
+ },
+ "skip_trimming": {
+ "content": [
+ [
+
+ ],
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+
],
[
],
+ [
+ "versions.yml:md5,f3dcaae948e8eed92b4a5557b4c6668e"
+ ]
+ ],
+ "meta": {
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
+ },
+ "timestamp": "2024-07-22T16:57:19.875543"
+ },
+ "with_umi": {
+ "content": [
[
[
{
@@ -524,6 +653,24 @@
""
]
],
+ [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.fastp.fastq.gz:md5,ba8c6c3a7ce718d9a2c5857e2edf53bc"
+ ]
+ ],
+ [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.fastp.json:md5,d39c5c6d9a2e35fb60d26ced46569af6"
+ ]
+ ],
[
[
{
@@ -532,6 +679,12 @@
},
99
]
+ ],
+ [
+
+ ],
+ [
+
],
[
"versions.yml:md5,01f264f78de3c6d893c449cc6d3cd721",
@@ -541,12 +694,1492 @@
]
],
"meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.04.2"
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
},
- "timestamp": "2024-06-10T15:08:32.267769943"
+ "timestamp": "2024-07-22T16:56:26.778625"
},
- "sarscov2 paired-end [fastq] - stub": {
+ "min_trimmed_reads = 26": {
+ "content": [
+ [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "unspecified"
+ ]
+ ],
+ [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test_1.fastp.fastq.gz:md5,54b726a55e992a869fd3fa778afe1672",
+ "test_2.fastp.fastq.gz:md5,29d3b33b869f7b63417b8ff07bb128ba"
+ ]
+ ]
+ ],
+ [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.json:md5,b712fd68ed0322f4bec49ff2a5237fcc"
+ ]
+ ],
+ [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ 75
+ ]
+ ],
+ [
+
+ ],
+ [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.merged.fastq.gz:md5,c873bb1ab3fa859dcc47306465e749d5"
+ ]
+ ],
+ [
+
+ ],
+ [
+ "versions.yml:md5,85bd0117e5778fff18e3920972a296ad",
+ "versions.yml:md5,c50aa59475ab901bc6f9a2cf7b1a14e0",
+ "versions.yml:md5,f3dcaae948e8eed92b4a5557b4c6668e"
+ ]
+ ],
+ "meta": {
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
+ },
+ "timestamp": "2024-07-22T16:58:16.36697"
+ },
+ "min_trimmed_reads = 26 - stub": {
+ "content": [
+ {
+ "0": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+ "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ]
+ ],
+ "1": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "10": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ 26
+ ]
+ ],
+ "11": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "12": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "13": [
+ "versions.yml:md5,85bd0117e5778fff18e3920972a296ad",
+ "versions.yml:md5,c50aa59475ab901bc6f9a2cf7b1a14e0",
+ "versions.yml:md5,f3dcaae948e8eed92b4a5557b4c6668e"
+ ],
+ "2": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "3": [
+
+ ],
+ "4": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ ""
+ ]
+ ],
+ "5": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "6": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "7": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "8": [
+
+ ],
+ "9": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ],
+ "adapter_seq": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ ""
+ ]
+ ],
+ "fastqc_raw_html": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "fastqc_raw_zip": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "fastqc_trim_html": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "fastqc_trim_zip": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "reads": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+ "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ]
+ ],
+ "trim_html": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "trim_json": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "trim_log": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "trim_read_count": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ 26
+ ]
+ ],
+ "trim_reads_fail": [
+
+ ],
+ "trim_reads_merged": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ],
+ "umi_log": [
+
+ ],
+ "versions": [
+ "versions.yml:md5,85bd0117e5778fff18e3920972a296ad",
+ "versions.yml:md5,c50aa59475ab901bc6f9a2cf7b1a14e0",
+ "versions.yml:md5,f3dcaae948e8eed92b4a5557b4c6668e"
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
+ },
+ "timestamp": "2024-07-22T17:00:16.524361"
+ },
+ "with_umi - stub": {
+ "content": [
+ {
+ "0": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ],
+ "1": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "10": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ 1
+ ]
+ ],
+ "11": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "12": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "13": [
+ "versions.yml:md5,01f264f78de3c6d893c449cc6d3cd721",
+ "versions.yml:md5,85bd0117e5778fff18e3920972a296ad",
+ "versions.yml:md5,c50aa59475ab901bc6f9a2cf7b1a14e0",
+ "versions.yml:md5,f3dcaae948e8eed92b4a5557b4c6668e"
+ ],
+ "2": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "3": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.umi_extract.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "4": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ ""
+ ]
+ ],
+ "5": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "6": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "7": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "8": [
+
+ ],
+ "9": [
+
+ ],
+ "adapter_seq": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ ""
+ ]
+ ],
+ "fastqc_raw_html": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "fastqc_raw_zip": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "fastqc_trim_html": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "fastqc_trim_zip": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "reads": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ],
+ "trim_html": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "trim_json": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "trim_log": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "trim_read_count": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ 1
+ ]
+ ],
+ "trim_reads_fail": [
+
+ ],
+ "trim_reads_merged": [
+
+ ],
+ "umi_log": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.umi_extract.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "versions": [
+ "versions.yml:md5,01f264f78de3c6d893c449cc6d3cd721",
+ "versions.yml:md5,85bd0117e5778fff18e3920972a296ad",
+ "versions.yml:md5,c50aa59475ab901bc6f9a2cf7b1a14e0",
+ "versions.yml:md5,f3dcaae948e8eed92b4a5557b4c6668e"
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
+ },
+ "timestamp": "2024-07-22T16:58:56.42517"
+ },
+ "skip_fastqc - stub": {
+ "content": [
+ {
+ "0": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+ "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ]
+ ],
+ "1": [
+
+ ],
+ "10": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ 1
+ ]
+ ],
+ "11": [
+
+ ],
+ "12": [
+
+ ],
+ "13": [
+ "versions.yml:md5,85bd0117e5778fff18e3920972a296ad"
+ ],
+ "2": [
+
+ ],
+ "3": [
+
+ ],
+ "4": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ ""
+ ]
+ ],
+ "5": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "6": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "7": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "8": [
+
+ ],
+ "9": [
+
+ ],
+ "adapter_seq": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ ""
+ ]
+ ],
+ "fastqc_raw_html": [
+
+ ],
+ "fastqc_raw_zip": [
+
+ ],
+ "fastqc_trim_html": [
+
+ ],
+ "fastqc_trim_zip": [
+
+ ],
+ "reads": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+ "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ]
+ ],
+ "trim_html": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "trim_json": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "trim_log": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "trim_read_count": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ 1
+ ]
+ ],
+ "trim_reads_fail": [
+
+ ],
+ "trim_reads_merged": [
+
+ ],
+ "umi_log": [
+
+ ],
+ "versions": [
+ "versions.yml:md5,85bd0117e5778fff18e3920972a296ad"
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
+ },
+ "timestamp": "2024-07-22T16:58:41.207281"
+ },
+ "save_merged - stub": {
+ "content": [
+ {
+ "0": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+ "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ]
+ ],
+ "1": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "10": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ 1
+ ]
+ ],
+ "11": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "12": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "13": [
+ "versions.yml:md5,85bd0117e5778fff18e3920972a296ad",
+ "versions.yml:md5,c50aa59475ab901bc6f9a2cf7b1a14e0",
+ "versions.yml:md5,f3dcaae948e8eed92b4a5557b4c6668e"
+ ],
+ "2": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "3": [
+
+ ],
+ "4": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ ""
+ ]
+ ],
+ "5": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "6": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "7": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "8": [
+
+ ],
+ "9": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ],
+ "adapter_seq": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ ""
+ ]
+ ],
+ "fastqc_raw_html": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "fastqc_raw_zip": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "fastqc_trim_html": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "fastqc_trim_zip": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "reads": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+ "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ]
+ ],
+ "trim_html": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "trim_json": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "trim_log": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "trim_read_count": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ 1
+ ]
+ ],
+ "trim_reads_fail": [
+
+ ],
+ "trim_reads_merged": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ],
+ "umi_log": [
+
+ ],
+ "versions": [
+ "versions.yml:md5,85bd0117e5778fff18e3920972a296ad",
+ "versions.yml:md5,c50aa59475ab901bc6f9a2cf7b1a14e0",
+ "versions.yml:md5,f3dcaae948e8eed92b4a5557b4c6668e"
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
+ },
+ "timestamp": "2024-07-22T17:00:03.695409"
+ },
+ "sarscov2 paired-end [fastq]": {
+ "content": [
+ [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "unspecified"
+ ]
+ ],
+ [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test_1.fastp.fastq.gz:md5,67b2bbae47f073e05a97a9c2edce23c7",
+ "test_2.fastp.fastq.gz:md5,25cbdca08e2083dbd4f0502de6b62f39"
+ ]
+ ]
+ ],
+ [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.json:md5,1e0f8e27e71728e2b63fc64086be95cd"
+ ]
+ ],
+ [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ 198
+ ]
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+ "versions.yml:md5,85bd0117e5778fff18e3920972a296ad",
+ "versions.yml:md5,c50aa59475ab901bc6f9a2cf7b1a14e0",
+ "versions.yml:md5,f3dcaae948e8eed92b4a5557b4c6668e"
+ ]
+ ],
+ "meta": {
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
+ },
+ "timestamp": "2024-07-22T16:55:50.614571"
+ },
+ "sarscov2 paired-end [fastq] - stub": {
+ "content": [
+ {
+ "0": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+ "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ]
+ ],
+ "1": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "10": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ 1
+ ]
+ ],
+ "11": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "12": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "13": [
+ "versions.yml:md5,85bd0117e5778fff18e3920972a296ad",
+ "versions.yml:md5,c50aa59475ab901bc6f9a2cf7b1a14e0",
+ "versions.yml:md5,f3dcaae948e8eed92b4a5557b4c6668e"
+ ],
+ "2": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "3": [
+
+ ],
+ "4": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ ""
+ ]
+ ],
+ "5": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "6": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "7": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "8": [
+
+ ],
+ "9": [
+
+ ],
+ "adapter_seq": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ ""
+ ]
+ ],
+ "fastqc_raw_html": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "fastqc_raw_zip": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "fastqc_trim_html": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "fastqc_trim_zip": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "reads": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+ "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ]
+ ],
+ "trim_html": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "trim_json": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "trim_log": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "trim_read_count": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ 1
+ ]
+ ],
+ "trim_reads_fail": [
+
+ ],
+ "trim_reads_merged": [
+
+ ],
+ "umi_log": [
+
+ ],
+ "versions": [
+ "versions.yml:md5,85bd0117e5778fff18e3920972a296ad",
+ "versions.yml:md5,c50aa59475ab901bc6f9a2cf7b1a14e0",
+ "versions.yml:md5,f3dcaae948e8eed92b4a5557b4c6668e"
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
+ },
+ "timestamp": "2024-07-22T16:58:29.296468"
+ },
+ "save_trimmed_fail - stub": {
+ "content": [
+ {
+ "0": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+ "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ]
+ ],
+ "1": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "10": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ 1
+ ]
+ ],
+ "11": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "12": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "13": [
+ "versions.yml:md5,85bd0117e5778fff18e3920972a296ad",
+ "versions.yml:md5,c50aa59475ab901bc6f9a2cf7b1a14e0",
+ "versions.yml:md5,f3dcaae948e8eed92b4a5557b4c6668e"
+ ],
+ "2": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "3": [
+
+ ],
+ "4": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ ""
+ ]
+ ],
+ "5": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "6": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "7": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "8": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test.paired.fail.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+ "test_1.fail.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+ "test_2.fail.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ]
+ ],
+ "9": [
+
+ ],
+ "adapter_seq": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ ""
+ ]
+ ],
+ "fastqc_raw_html": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "fastqc_raw_zip": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "fastqc_trim_html": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "fastqc_trim_zip": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "reads": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test_1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+ "test_2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ]
+ ],
+ "trim_html": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "trim_json": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "trim_log": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "trim_read_count": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ 1
+ ]
+ ],
+ "trim_reads_fail": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test.paired.fail.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+ "test_1.fail.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+ "test_2.fail.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ]
+ ],
+ "trim_reads_merged": [
+
+ ],
+ "umi_log": [
+
+ ],
+ "versions": [
+ "versions.yml:md5,85bd0117e5778fff18e3920972a296ad",
+ "versions.yml:md5,c50aa59475ab901bc6f9a2cf7b1a14e0",
+ "versions.yml:md5,f3dcaae948e8eed92b4a5557b4c6668e"
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
+ },
+ "timestamp": "2024-07-22T16:59:51.615894"
+ },
+ "skip_umi_extract - stub": {
"content": [
{
"0": [
@@ -766,9 +2399,9 @@
}
],
"meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.04.2"
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
},
- "timestamp": "2024-06-21T14:46:58.329605"
+ "timestamp": "2024-07-22T16:59:12.592278"
}
}
\ No newline at end of file
diff --git a/subworkflows/nf-core/fastq_fastqc_umitools_trimgalore/tests/main.nf.test b/subworkflows/nf-core/fastq_fastqc_umitools_trimgalore/tests/main.nf.test
index 6d01cbbd1..3fffd234b 100644
--- a/subworkflows/nf-core/fastq_fastqc_umitools_trimgalore/tests/main.nf.test
+++ b/subworkflows/nf-core/fastq_fastqc_umitools_trimgalore/tests/main.nf.test
@@ -28,10 +28,11 @@ nextflow_workflow {
assertAll(
{ assert workflow.success},
{ assert path(workflow.out.fastqc_html[0][1]).text.contains("File type | Conventional base calls |
") },
- { assert snapshot(workflow.out.reads).match("se - reads") },
- { assert snapshot(workflow.out.trim_read_count).match("se - trim_read_count") },
- { assert snapshot(workflow.out.trim_unpaired).match("se - trim_unpaired") },
- { assert snapshot(workflow.out.versions).match("se - versions") }
+ { assert snapshot(
+ workflow.out.reads,
+ workflow.out.trim_read_count,
+ workflow.out.trim_unpaired,
+ workflow.out.versions).match() }
)
}
}
@@ -61,10 +62,11 @@ nextflow_workflow {
then {
assertAll(
{ assert workflow.success},
- { assert snapshot(workflow.out.reads).match("pe - reads") },
- { assert snapshot(workflow.out.trim_read_count).match("pe - trim_read_count") },
- { assert snapshot(workflow.out.trim_unpaired).match("pe - trim_unpaired") },
- { assert snapshot(workflow.out.versions).match("pe - versions") }
+ { assert snapshot(
+ workflow.out.reads,
+ workflow.out.trim_read_count,
+ workflow.out.trim_unpaired,
+ workflow.out.versions).match() }
)
}
}
@@ -93,10 +95,11 @@ nextflow_workflow {
then {
assertAll(
{ assert workflow.success},
- { assert snapshot(workflow.out.reads).match("pe no umi - reads") },
- { assert snapshot(workflow.out.trim_read_count).match("pe no umi - trim_read_count") },
- { assert snapshot(workflow.out.trim_unpaired).match("pe no umi - trim_unpaired") },
- { assert snapshot(workflow.out.versions).match("pe no umi - versions") }
+ { assert snapshot(
+ workflow.out.reads,
+ workflow.out.trim_read_count,
+ workflow.out.trim_unpaired,
+ workflow.out.versions).match() }
)
}
}
@@ -126,9 +129,134 @@ nextflow_workflow {
then {
assertAll(
{ assert workflow.success},
- { assert snapshot(workflow.out.trim_read_count).match("pe skip all - trim_read_count") },
- { assert snapshot(workflow.out.trim_unpaired).match("pe skip all - trim_unpaired") },
- { assert snapshot(workflow.out.versions).match("pe skip all - versions") }
+ { assert snapshot(
+ workflow.out.trim_read_count,
+ workflow.out.trim_unpaired,
+ workflow.out.versions).match() }
+ )
+ }
+ }
+
+ test("test single end read with UMI - stub") {
+
+ options "-stub"
+
+ when {
+ workflow {
+ """
+ input[0] = Channel.of([
+ [ id:'test', single_end:true ], // meta map
+ [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ]
+ ])
+ input[1] = false // skip_fastqc
+ input[2] = true // with_umi
+ input[3] = false // skip_umi_extract
+ input[4] = false // skip_trimming
+ input[5] = 1 // umi_discard_read
+ input[6] = 1 // min_trimmed_reads
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert workflow.success},
+ { assert snapshot(workflow.out).match() }
+ )
+ }
+ }
+
+ test("test paired end read with UMI - stub") {
+
+ options "-stub"
+
+ when {
+ workflow {
+ """
+ input[0] = Channel.of([
+ [ id:'test', single_end:false ], // meta map
+ [
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)
+ ]
+ ])
+ input[1] = false // skip_fastqc
+ input[2] = true // with_umi
+ input[3] = false // skip_umi_extract
+ input[4] = false // skip_trimming
+ input[5] = 1 // umi_discard_read
+ input[6] = 1 // min_trimmed_reads
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert workflow.success},
+ { assert snapshot(workflow.out).match() }
+ )
+ }
+ }
+ test("test paired end read without UMI - stub") {
+
+ options "-stub"
+
+ when {
+ workflow {
+ """
+ input[0] = Channel.of([
+ [ id:'test', single_end:false ], // meta map
+ [
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)
+ ]
+ ])
+ input[1] = false // skip_fastqc
+ input[2] = false // with_umi
+ input[3] = false // skip_umi_extract
+ input[4] = false // skip_trimming
+ input[5] = 1 // umi_discard_read
+ input[6] = 1 // min_trimmed_reads
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert workflow.success},
+ { assert snapshot(workflow.out).match() }
+ )
+ }
+ }
+
+ test("test skip all steps - stub") {
+
+ options "-stub"
+
+ when {
+ workflow {
+ """
+ input[0] = Channel.of([
+ [ id:'test', single_end:false ], // meta map
+ [
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)
+ ]
+ ])
+ input[1] = true // skip_fastqc
+ input[2] = true // with_umi
+ input[3] = true // skip_umi_extract
+ input[4] = true // skip_trimming
+ input[5] = 0 // umi_discard_read
+ input[6] = 1 // min_trimmed_reads
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert workflow.success}
+ // No snapshot when skipping all as output is input
)
}
}
diff --git a/subworkflows/nf-core/fastq_fastqc_umitools_trimgalore/tests/main.nf.test.snap b/subworkflows/nf-core/fastq_fastqc_umitools_trimgalore/tests/main.nf.test.snap
index 23b5fc9ea..034591495 100644
--- a/subworkflows/nf-core/fastq_fastqc_umitools_trimgalore/tests/main.nf.test.snap
+++ b/subworkflows/nf-core/fastq_fastqc_umitools_trimgalore/tests/main.nf.test.snap
@@ -1,110 +1,304 @@
{
- "pe no umi - reads": {
+ "test paired end read with UMI - stub": {
"content": [
- [
- [
- {
- "id": "test",
- "single_end": false
- },
+ {
+ "0": [
+
+ ],
+ "1": [
[
- "test_1_val_1.fq.gz:md5,566d44cca0d22c522d6cf0e50c7165dc",
- "test_2_val_2.fq.gz:md5,3c023e8e890b897821df3dc98f48c2b3"
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "2": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "3": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.umi_extract.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "4": [
+
+ ],
+ "5": [
+
+ ],
+ "6": [
+
+ ],
+ "7": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.fastq.gz_trimming_report.txt:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "8": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ 0
+ ]
+ ],
+ "9": [
+ "versions.yml:md5,0a5b8fa83ba29cf645bf9e9471cca150",
+ "versions.yml:md5,3e4b7f058c0aa96ba41c3e4d6df6e839",
+ "versions.yml:md5,7e740129a23c5ac21c27476e30f8a6d2"
+ ],
+ "fastqc_html": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "fastqc_zip": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
]
+ ],
+ "reads": [
+
+ ],
+ "trim_html": [
+
+ ],
+ "trim_log": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.fastq.gz_trimming_report.txt:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "trim_read_count": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ 0
+ ]
+ ],
+ "trim_unpaired": [
+
+ ],
+ "trim_zip": [
+
+ ],
+ "umi_log": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.umi_extract.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "versions": [
+ "versions.yml:md5,0a5b8fa83ba29cf645bf9e9471cca150",
+ "versions.yml:md5,3e4b7f058c0aa96ba41c3e4d6df6e839",
+ "versions.yml:md5,7e740129a23c5ac21c27476e30f8a6d2"
]
- ]
+ }
],
"meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
},
- "timestamp": "2024-03-01T14:42:34.197155"
+ "timestamp": "2024-07-22T17:06:34.919444"
},
- "pe skip all - trim_unpaired": {
+ "test paired end read without UMI - stub": {
"content": [
- [
-
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-01T14:42:44.569875"
- },
- "pe skip all - versions": {
- "content": [
- [
-
- ]
+ {
+ "0": [
+
+ ],
+ "1": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "2": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "3": [
+
+ ],
+ "4": [
+
+ ],
+ "5": [
+
+ ],
+ "6": [
+
+ ],
+ "7": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test_1.fastq.gz_trimming_report.txt:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test_2.fastq.gz_trimming_report.txt:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ ],
+ "8": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ 0
+ ]
+ ],
+ "9": [
+ "versions.yml:md5,0a5b8fa83ba29cf645bf9e9471cca150",
+ "versions.yml:md5,7e740129a23c5ac21c27476e30f8a6d2"
+ ],
+ "fastqc_html": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "fastqc_zip": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "reads": [
+
+ ],
+ "trim_html": [
+
+ ],
+ "trim_log": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test_1.fastq.gz_trimming_report.txt:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test_2.fastq.gz_trimming_report.txt:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ ],
+ "trim_read_count": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ 0
+ ]
+ ],
+ "trim_unpaired": [
+
+ ],
+ "trim_zip": [
+
+ ],
+ "umi_log": [
+
+ ],
+ "versions": [
+ "versions.yml:md5,0a5b8fa83ba29cf645bf9e9471cca150",
+ "versions.yml:md5,7e740129a23c5ac21c27476e30f8a6d2"
+ ]
+ }
],
"meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
},
- "timestamp": "2024-03-01T14:42:44.578583"
+ "timestamp": "2024-07-22T17:06:51.765414"
},
- "pe - trim_read_count": {
+ "test paired end read without UMI": {
"content": [
[
[
{
"id": "test",
- "single_end": true
+ "single_end": false
},
- 100.0
+ [
+ "test_1_val_1.fq.gz:md5,566d44cca0d22c522d6cf0e50c7165dc",
+ "test_2_val_2.fq.gz:md5,3c023e8e890b897821df3dc98f48c2b3"
+ ]
]
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-01T14:42:16.730434"
- },
- "se - trim_read_count": {
- "content": [
+ ],
[
[
{
"id": "test",
- "single_end": true
+ "single_end": false
},
100.0
]
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-01T14:41:56.047953"
- },
- "se - trim_unpaired": {
- "content": [
+ ],
[
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-01T14:41:56.052782"
- },
- "pe no umi - trim_unpaired": {
- "content": [
+ ],
[
-
+ "versions.yml:md5,0a5b8fa83ba29cf645bf9e9471cca150",
+ "versions.yml:md5,7e740129a23c5ac21c27476e30f8a6d2"
]
],
"meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
},
- "timestamp": "2024-03-01T14:42:34.210238"
+ "timestamp": "2024-07-22T17:05:37.366404"
},
- "pe - reads": {
+ "test single end read with UMI": {
"content": [
[
[
@@ -112,36 +306,21 @@
"id": "test",
"single_end": true
},
- "test_trimmed.fq.gz:md5,9c58b78ac2c7b5ce9ca6b090eee1d39c"
+ "test_trimmed.fq.gz:md5,faae784affdd7d84e2fa9da9e9425229"
]
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-01T14:42:16.720251"
- },
- "se - reads": {
- "content": [
+ ],
[
[
{
"id": "test",
"single_end": true
},
- "test_trimmed.fq.gz:md5,faae784affdd7d84e2fa9da9e9425229"
+ 100.0
]
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-01T14:41:56.033273"
- },
- "se - versions": {
- "content": [
+ ],
+ [
+
+ ],
[
"versions.yml:md5,0a5b8fa83ba29cf645bf9e9471cca150",
"versions.yml:md5,3e4b7f058c0aa96ba41c3e4d6df6e839",
@@ -149,44 +328,34 @@
]
],
"meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
},
- "timestamp": "2024-03-01T14:41:56.056939"
+ "timestamp": "2024-07-22T17:04:53.072227"
},
- "pe no umi - versions": {
+ "test paired end read with UMI": {
"content": [
[
- "versions.yml:md5,0a5b8fa83ba29cf645bf9e9471cca150",
- "versions.yml:md5,7e740129a23c5ac21c27476e30f8a6d2"
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-01T14:42:34.216606"
- },
- "pe no umi - trim_read_count": {
- "content": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test_trimmed.fq.gz:md5,9c58b78ac2c7b5ce9ca6b090eee1d39c"
+ ]
+ ],
[
[
{
"id": "test",
- "single_end": false
+ "single_end": true
},
100.0
]
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
- },
- "timestamp": "2024-03-01T14:42:34.203868"
- },
- "pe - versions": {
- "content": [
+ ],
+ [
+
+ ],
[
"versions.yml:md5,0a5b8fa83ba29cf645bf9e9471cca150",
"versions.yml:md5,3e4b7f058c0aa96ba41c3e4d6df6e839",
@@ -194,33 +363,162 @@
]
],
"meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
},
- "timestamp": "2024-03-01T14:42:16.758431"
+ "timestamp": "2024-07-22T17:05:16.709704"
},
- "pe skip all - trim_read_count": {
+ "test skip all steps": {
"content": [
[
+ ],
+ [
+
+ ],
+ [
+
]
],
"meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
},
- "timestamp": "2024-03-01T14:42:44.557631"
+ "timestamp": "2024-07-22T17:05:49.455992"
},
- "pe - trim_unpaired": {
+ "test single end read with UMI - stub": {
"content": [
- [
-
- ]
+ {
+ "0": [
+
+ ],
+ "1": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "2": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "3": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.umi_extract.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "4": [
+
+ ],
+ "5": [
+
+ ],
+ "6": [
+
+ ],
+ "7": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.fastq.gz_trimming_report.txt:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "8": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ 0
+ ]
+ ],
+ "9": [
+ "versions.yml:md5,0a5b8fa83ba29cf645bf9e9471cca150",
+ "versions.yml:md5,3e4b7f058c0aa96ba41c3e4d6df6e839",
+ "versions.yml:md5,7e740129a23c5ac21c27476e30f8a6d2"
+ ],
+ "fastqc_html": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "fastqc_zip": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "reads": [
+
+ ],
+ "trim_html": [
+
+ ],
+ "trim_log": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.fastq.gz_trimming_report.txt:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "trim_read_count": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ 0
+ ]
+ ],
+ "trim_unpaired": [
+
+ ],
+ "trim_zip": [
+
+ ],
+ "umi_log": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.umi_extract.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "versions": [
+ "versions.yml:md5,0a5b8fa83ba29cf645bf9e9471cca150",
+ "versions.yml:md5,3e4b7f058c0aa96ba41c3e4d6df6e839",
+ "versions.yml:md5,7e740129a23c5ac21c27476e30f8a6d2"
+ ]
+ }
],
"meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.01.0"
+ "nf-test": "0.9.0",
+ "nextflow": "24.04.3"
},
- "timestamp": "2024-03-01T14:42:16.743003"
+ "timestamp": "2024-07-22T17:06:09.844235"
}
-}
\ No newline at end of file
+}
diff --git a/subworkflows/nf-core/fastq_qc_trim_filter_setstrandedness/tests/main.nf.test b/subworkflows/nf-core/fastq_qc_trim_filter_setstrandedness/tests/main.nf.test
index 5242f2bee..c752e176c 100644
--- a/subworkflows/nf-core/fastq_qc_trim_filter_setstrandedness/tests/main.nf.test
+++ b/subworkflows/nf-core/fastq_qc_trim_filter_setstrandedness/tests/main.nf.test
@@ -5,21 +5,6 @@ nextflow_workflow {
workflow "FASTQ_QC_TRIM_FILTER_SETSTRANDEDNESS"
config "./nextflow.config"
- tag "subworkflows"
- tag "subworkflows_nfcore"
- tag "subworkflows/fastq_qc_trim_filter_setstrandedness"
-
- tag "bbmap/bbsplit"
- tag "cat"
- tag "cat/fastq"
- tag "fastqc"
- tag "sortmerna"
- tag "subworkflows/fastq_fastqc_umitools_trimgalore"
- tag "subworkflows/fastq_fastqc_umitools_fastp"
- tag "subworkflows/fastq_subsample_fq_salmon"
-
-
-
test("homo_sapiens paired-end [fastq] fastp") {
when {
diff --git a/subworkflows/nf-core/fastq_qc_trim_filter_setstrandedness/tests/tags.yml b/subworkflows/nf-core/fastq_qc_trim_filter_setstrandedness/tests/tags.yml
deleted file mode 100644
index cafd4a33d..000000000
--- a/subworkflows/nf-core/fastq_qc_trim_filter_setstrandedness/tests/tags.yml
+++ /dev/null
@@ -1,2 +0,0 @@
-subworkflows/preprocess_rnaseq:
- - subworkflows/nf-core/preprocess_rnaseq/**
diff --git a/subworkflows/nf-core/fastq_subsample_fq_salmon/tests/main.nf.test b/subworkflows/nf-core/fastq_subsample_fq_salmon/tests/main.nf.test
index 0a4b29706..077d9c758 100644
--- a/subworkflows/nf-core/fastq_subsample_fq_salmon/tests/main.nf.test
+++ b/subworkflows/nf-core/fastq_subsample_fq_salmon/tests/main.nf.test
@@ -43,16 +43,61 @@ nextflow_workflow {
def readlines2 = path(workflow.out.reads[0][1][1]).linesGzip
assertAll(
{ assert workflow.success },
- { assert snapshot(readlines1[0..5]).match("test_reads_1_lines") },
- { assert snapshot(readlines1.size()).match("test_reads_1_size") },
- { assert snapshot(readlines2[0..5]).match("test_reads_2_lines") },
- { assert snapshot(readlines2.size()).match("test_reads_2_size") },
- { assert snapshot(workflow.out.versions).match("versions") },
- { assert snapshot(workflow.out.lib_format_counts).match("lib_format_counts") },
-
{ assert workflow.out.index },
+ { assert workflow.out.json_info },
{ assert workflow.out.results },
- { assert workflow.out.json_info }
+ { assert snapshot(
+ readlines1[0..5],
+ readlines1.size(),
+ readlines2[0..5],
+ readlines2.size(),
+ workflow.out.lib_format_counts,
+ workflow.out.versions).match() }
+ )
+ }
+ }
+
+ test("homo_sapiens paired-end [fastq] - stub") {
+
+ options "-stub"
+
+ setup {
+ run("SALMON_INDEX") {
+ script "../../../../modules/nf-core/salmon/index/main.nf"
+ process {
+ """
+ input[0] = Channel.of(file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)) // genome_fasta
+ input[1] = Channel.of(file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/transcriptome.fasta', checkIfExists: true)) // transcriptome_fasta
+ """
+ }
+ }
+ }
+
+ when {
+ workflow {
+ """
+ make_index = false
+
+ input[0] = Channel.of([
+ [ id:'test', single_end:false ], // meta map
+ [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ]
+ ])
+ input[1] = Channel.of(file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)) // genome_fasta
+ input[2] = Channel.of(file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/transcriptome.fasta', checkIfExists: true)) // transcriptome_fasta
+ input[3] = Channel.of(file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true)) // genome_gtf
+ input[4] = SALMON_INDEX.out.index
+ input[5] = make_index
+ """
+ }
+ }
+
+ then {
+ def readlines1 = path(workflow.out.reads[0][1][0]).linesGzip
+ def readlines2 = path(workflow.out.reads[0][1][1]).linesGzip
+ assertAll(
+ { assert workflow.success },
+ { assert snapshot(workflow.out).match() }
)
}
}
diff --git a/subworkflows/nf-core/fastq_subsample_fq_salmon/tests/main.nf.test.snap b/subworkflows/nf-core/fastq_subsample_fq_salmon/tests/main.nf.test.snap
index 8bef73cc4..e0c944f31 100644
--- a/subworkflows/nf-core/fastq_subsample_fq_salmon/tests/main.nf.test.snap
+++ b/subworkflows/nf-core/fastq_subsample_fq_salmon/tests/main.nf.test.snap
@@ -1,28 +1,5 @@
{
- "test_reads_1_size": {
- "content": [
- 1066944
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.10.1"
- },
- "timestamp": "2024-06-14T10:32:16.109988"
- },
- "versions": {
- "content": [
- [
- "versions.yml:md5,12c0d1f67c2afb97470ae0974e5e01bb",
- "versions.yml:md5,885fde9e7beac002b3a17b66b92db4bd"
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.10.1"
- },
- "timestamp": "2024-06-14T10:32:16.112471"
- },
- "test_reads_1_lines": {
+ "homo_sapiens paired-end [fastq]": {
"content": [
[
"@normal#21#998579#1/1",
@@ -31,16 +8,8 @@
"102302000331;3333;23133320233330*33/233333333333333/313232333/3;3;3/333000;11/00;;01//103*1032323233",
"@normal#21#998572#2/1",
"CTCCTCTCCTTCTACCTGCTGGGGTTGCTTGTCAGTAGCGGGCAAGGTCGGAGTGTTGCGCTTTATTGCATTTACTTTCCCTCCCCCTTCCACCCGGCCA"
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.10.1"
- },
- "timestamp": "2024-06-14T10:32:16.108208"
- },
- "test_reads_2_lines": {
- "content": [
+ ],
+ 1066944,
[
"@normal#21#998579#1/2",
"AAAAAAAAAGAAGAAGCAGAAGCTGTTTCCCTGGATATCCTGCTCACCGATTCCCCTCTCCAATTCTGTATTTTCCCTTCTCTTATTTAAGGGTCTCCAC",
@@ -48,26 +17,8 @@
"023333233332333310333302333211/3333;0300;*/;000/32;201003031/22;21333032;;11/23030322;2332333313/030",
"@normal#21#998572#2/2",
"TTCCCCTCTCCAATTGAGTATTTTCCCTTCTCTTATTTAAGGGTCTCCACACAAACAGATACAATTTTAGGGACAGCTAGGAGAAAGAACGAAAATAATAA"
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.10.1"
- },
- "timestamp": "2024-06-14T10:32:16.111188"
- },
- "test_reads_2_size": {
- "content": [
- 1066944
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.10.1"
- },
- "timestamp": "2024-06-14T10:32:16.111792"
- },
- "lib_format_counts": {
- "content": [
+ ],
+ 1066944,
[
[
{
@@ -76,12 +27,155 @@
},
"test_lib_format_counts.json:md5,0b0e2dc090e5ad88f9a9d6dbe9c3e4a0"
]
+ ],
+ [
+ "versions.yml:md5,12c0d1f67c2afb97470ae0974e5e01bb",
+ "versions.yml:md5,885fde9e7beac002b3a17b66b92db4bd"
]
],
"meta": {
"nf-test": "0.8.4",
- "nextflow": "23.10.1"
+ "nextflow": "24.04.2"
+ },
+ "timestamp": "2024-07-03T15:08:35.832206"
+ },
+ "homo_sapiens paired-end [fastq] - stub": {
+ "content": [
+ {
+ "0": [
+ [
+ "complete_ref_lens.bin:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "ctable.bin:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "ctg_offsets.bin:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "duplicate_clusters.tsv:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "info.json:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "mphf.bin:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "pos.bin:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "pre_indexing.log:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "rank.bin:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "refAccumLengths.bin:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "ref_indexing.log:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "reflengths.bin:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "refseq.bin:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "seq.bin:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "versionInfo.json:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "1": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test_R1.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+ "test_R2.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ]
+ ],
+ "2": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+
+ ]
+ ]
+ ],
+ "3": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test_meta_info.json:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "4": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test_lib_format_counts.json:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "5": [
+ "versions.yml:md5,12c0d1f67c2afb97470ae0974e5e01bb",
+ "versions.yml:md5,885fde9e7beac002b3a17b66b92db4bd"
+ ],
+ "index": [
+ [
+ "complete_ref_lens.bin:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "ctable.bin:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "ctg_offsets.bin:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "duplicate_clusters.tsv:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "info.json:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "mphf.bin:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "pos.bin:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "pre_indexing.log:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "rank.bin:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "refAccumLengths.bin:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "ref_indexing.log:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "reflengths.bin:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "refseq.bin:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "seq.bin:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "versionInfo.json:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "json_info": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test_meta_info.json:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "lib_format_counts": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test_lib_format_counts.json:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "reads": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test_R1.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+ "test_R2.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ]
+ ],
+ "results": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+
+ ]
+ ]
+ ],
+ "versions": [
+ "versions.yml:md5,12c0d1f67c2afb97470ae0974e5e01bb",
+ "versions.yml:md5,885fde9e7beac002b3a17b66b92db4bd"
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.8.4",
+ "nextflow": "24.04.2"
},
- "timestamp": "2024-06-14T10:32:16.114075"
+ "timestamp": "2024-07-03T15:08:56.819"
}
}
\ No newline at end of file
diff --git a/subworkflows/nf-core/quantify_pseudo_alignment/tests/main.nf.test b/subworkflows/nf-core/quantify_pseudo_alignment/tests/main.nf.test
index 21004870a..d0a59629e 100644
--- a/subworkflows/nf-core/quantify_pseudo_alignment/tests/main.nf.test
+++ b/subworkflows/nf-core/quantify_pseudo_alignment/tests/main.nf.test
@@ -50,24 +50,23 @@ nextflow_workflow {
assertAll(
{ assert workflow.success },
{ assert snapshot(
- workflow.out.tpm_gene,
+ file(workflow.out.merged_gene_rds[0][1]).name,
+ file(workflow.out.merged_gene_rds_length_scaled[0][1]).name,
+ file(workflow.out.merged_gene_rds_scaled[0][1]).name,
+ file(workflow.out.merged_transcript_rds[0][1]).name,
workflow.out.counts_gene,
- workflow.out.lengths_gene,
workflow.out.counts_gene_length_scaled,
- workflow.out.tpm_transcript,
+ workflow.out.lengths_gene,
workflow.out.lengths_transcript,
workflow.out.merged_counts_transcript,
workflow.out.merged_tpm_transcript,
- workflow.out.versions,
- file(workflow.out.merged_gene_rds[0][1]).name,
- file(workflow.out.merged_gene_rds_length_scaled[0][1]).name,
- file(workflow.out.merged_gene_rds_scaled[0][1]).name,
- file(workflow.out.merged_transcript_rds[0][1]).name
+ workflow.out.tpm_gene,
+ workflow.out.tpm_transcript,
+ workflow.out.versions
).match()
}
)
}
-
}
test("kallisto") {
@@ -86,7 +85,6 @@ nextflow_workflow {
}
}
-
when {
workflow {
"""
@@ -119,22 +117,126 @@ nextflow_workflow {
assertAll(
{ assert workflow.success },
{ assert snapshot(
- workflow.out.tpm_gene,
- workflow.out.counts_gene,
- workflow.out.lengths_gene,
- workflow.out.counts_gene_length_scaled,
- workflow.out.tpm_transcript,
- workflow.out.lengths_transcript,
- workflow.out.versions,
file(workflow.out.merged_gene_rds[0][1]).name,
file(workflow.out.merged_gene_rds_length_scaled[0][1]).name,
file(workflow.out.merged_gene_rds_scaled[0][1]).name,
- file(workflow.out.merged_transcript_rds[0][1]).name
+ file(workflow.out.merged_transcript_rds[0][1]).name,
+ workflow.out.counts_gene,
+ workflow.out.counts_gene_length_scaled,
+ workflow.out.lengths_gene,
+ workflow.out.lengths_transcript,
+ workflow.out.tpm_gene,
+ workflow.out.tpm_transcript,
+ workflow.out.versions
).match()
}
)
}
+ }
+
+ test("salmon - stub") {
+
+ options "-stub"
+
+ setup {
+ run("SALMON_INDEX") {
+ script "../../../../modules/nf-core/salmon/index/main.nf"
+ process {
+ """
+ input[0] = Channel.of([file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/genome.fasta", checkIfExists: true)])
+ input[1] = Channel.of([file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/transcriptome.fasta", checkIfExists: true)])
+ """
+ }
+ }
+ }
+
+ when {
+ workflow {
+ """
+ input[0] = [
+ [ id: 'samplesheet' ],
+ file(params.modules_testdata_base_path + '/genomics/sarscov2/illumina/csv/samplesheet_micro.csv', checkIfExists: true)
+ ]
+ input[1] = [
+ [ id: 'test' ],
+ [
+ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_2.fastq.gz', checkIfExists: true)
+ ]
+ ]
+ input[2] = SALMON_INDEX.out.index
+ input[3] = Channel.of(file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/transcriptome.fasta", checkIfExists: true))
+ input[4] = Channel.of(file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/genome.gtf", checkIfExists: true))
+ input[5] = 'gene_id'
+ input[6] = 'gene_name'
+ input[7] = 'salmon'
+ input[8] = false
+ input[9] = 'A'
+ input[10] = null
+ input[11] = null
+ """
+ }
+ }
+ then {
+ assertAll(
+ { assert workflow.success },
+ { assert snapshot(workflow.out).match()}
+ )
+ }
}
+ test("kallisto - stub") {
+
+ options "-stub"
+
+ setup {
+ run("KALLISTO_INDEX") {
+ script "../../../../modules/nf-core/kallisto/index/main.nf"
+ process {
+ """
+ input[0] = Channel.of([
+ [ id:'transcriptome' ], // meta map
+ file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/transcriptome.fasta", checkIfExists: true)
+ ])
+ """
+ }
+ }
+ }
+
+ when {
+ workflow {
+ """
+ input[0] = [
+ [ id: 'samplesheet' ],
+ file(params.modules_testdata_base_path + '/genomics/sarscov2/illumina/csv/samplesheet_micro.csv', checkIfExists: true)
+ ]
+ input[1] = [
+ [ id: 'test' ],
+ [
+ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/fastq/test_2.fastq.gz', checkIfExists: true)
+ ]
+ ]
+ input[2] = KALLISTO_INDEX.out.index
+ input[3] = Channel.of(file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/transcriptome.fasta", checkIfExists: true))
+ input[4] = Channel.of(file(params.modules_testdata_base_path + "genomics/homo_sapiens/genome/genome.gtf", checkIfExists: true))
+ input[5] = 'gene_id'
+ input[6] = 'gene_name'
+ input[7] = 'kallisto'
+ input[8] = null
+ input[9] = null
+ input[10] = []
+ input[11] = []
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert workflow.success },
+ { assert snapshot(workflow.out).match()}
+ )
+ }
+ }
}
diff --git a/subworkflows/nf-core/quantify_pseudo_alignment/tests/main.nf.test.snap b/subworkflows/nf-core/quantify_pseudo_alignment/tests/main.nf.test.snap
index c5f435665..4db35cced 100644
--- a/subworkflows/nf-core/quantify_pseudo_alignment/tests/main.nf.test.snap
+++ b/subworkflows/nf-core/quantify_pseudo_alignment/tests/main.nf.test.snap
@@ -1,12 +1,16 @@
{
"kallisto": {
"content": [
+ "all_samples.SummarizedExperiment.rds",
+ "all_samples.SummarizedExperiment.rds",
+ "all_samples.SummarizedExperiment.rds",
+ "all_samples.SummarizedExperiment.rds",
[
[
{
"id": "all_samples"
},
- "all_samples.gene_tpm.tsv:md5,23fa0c64cfbd198806b53897de791b8b"
+ "all_samples.gene_counts.tsv:md5,4ba44e5ebc9ed0ca2ca008d10a1dddc3"
]
],
[
@@ -14,7 +18,7 @@
{
"id": "all_samples"
},
- "all_samples.gene_counts.tsv:md5,4ba44e5ebc9ed0ca2ca008d10a1dddc3"
+ "all_samples.gene_counts_length_scaled.tsv:md5,078746568e3fd0c995559352b661b2d9"
]
],
[
@@ -30,7 +34,7 @@
{
"id": "all_samples"
},
- "all_samples.gene_counts_length_scaled.tsv:md5,078746568e3fd0c995559352b661b2d9"
+ "all_samples.transcript_lengths.tsv:md5,131952a97905469ab012f0f46e52405c"
]
],
[
@@ -38,7 +42,7 @@
{
"id": "all_samples"
},
- "all_samples.transcript_tpm.tsv:md5,de458e1c2a579e53bd7671c5176f5d0c"
+ "all_samples.gene_tpm.tsv:md5,23fa0c64cfbd198806b53897de791b8b"
]
],
[
@@ -46,7 +50,7 @@
{
"id": "all_samples"
},
- "all_samples.transcript_lengths.tsv:md5,131952a97905469ab012f0f46e52405c"
+ "all_samples.transcript_tpm.tsv:md5,de458e1c2a579e53bd7671c5176f5d0c"
]
],
[
@@ -54,26 +58,532 @@
"versions.yml:md5,d5243289a32cde9e90e20f1a202bb566",
"versions.yml:md5,e9e7d18c3de83f1113fb1ff0c55d35ed",
"versions.yml:md5,ea39658f8685118d81d42acd451e66ea"
- ],
- "all_samples.SummarizedExperiment.rds",
- "all_samples.SummarizedExperiment.rds",
- "all_samples.SummarizedExperiment.rds",
- "all_samples.SummarizedExperiment.rds"
+ ]
+ ],
+ "meta": {
+ "nf-test": "0.8.4",
+ "nextflow": "24.04.2"
+ },
+ "timestamp": "2024-07-03T15:36:19.861809"
+ },
+ "salmon - stub": {
+ "content": [
+ {
+ "0": [
+ [
+ {
+ "id": "test"
+ },
+ [
+
+ ]
+ ]
+ ],
+ "1": [
+ [
+ {
+ "id": "test"
+ },
+ [
+
+ ]
+ ]
+ ],
+ "10": [
+ [
+ {
+ "id": "all_samples"
+ },
+ "all_samples.SummarizedExperiment.rds:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "11": [
+ [
+ {
+ "id": "all_samples"
+ },
+ "all_samples.SummarizedExperiment.rds:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "12": [
+ [
+ {
+ "id": "all_samples"
+ },
+ "all_samples.SummarizedExperiment.rds:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "13": [
+ [
+ {
+ "id": "all_samples"
+ },
+ "all_samples.SummarizedExperiment.rds:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "14": [
+ "versions.yml:md5,4c3564e1ba17d8ce2b0ee784251ddd87",
+ "versions.yml:md5,7afb76ee798ceb1e5dff5879d28ef85a",
+ "versions.yml:md5,d5243289a32cde9e90e20f1a202bb566",
+ "versions.yml:md5,e9e7d18c3de83f1113fb1ff0c55d35ed"
+ ],
+ "2": [
+ [
+ {
+ "id": "all_samples"
+ },
+ "all_samples.gene_tpm.tsv:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "3": [
+ [
+ {
+ "id": "all_samples"
+ },
+ "all_samples.gene_counts.tsv:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "4": [
+ [
+ {
+ "id": "all_samples"
+ },
+ "all_samples.gene_lengths.tsv:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "5": [
+ [
+ {
+ "id": "all_samples"
+ },
+ "all_samples.gene_counts_length_scaled.tsv:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "6": [
+ [
+ {
+ "id": "all_samples"
+ },
+ "all_samples.gene_counts_scaled.tsv:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "7": [
+ [
+ {
+ "id": "all_samples"
+ },
+ "all_samples.transcript_tpm.tsv:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "8": [
+ [
+ {
+ "id": "all_samples"
+ },
+ "all_samples.transcript_counts.tsv:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "9": [
+ [
+ {
+ "id": "all_samples"
+ },
+ "all_samples.transcript_lengths.tsv:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "counts_gene": [
+ [
+ {
+ "id": "all_samples"
+ },
+ "all_samples.gene_counts.tsv:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "counts_gene_length_scaled": [
+ [
+ {
+ "id": "all_samples"
+ },
+ "all_samples.gene_counts_length_scaled.tsv:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "counts_gene_scaled": [
+ [
+ {
+ "id": "all_samples"
+ },
+ "all_samples.gene_counts_scaled.tsv:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "counts_transcript": [
+ [
+ {
+ "id": "all_samples"
+ },
+ "all_samples.transcript_counts.tsv:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "lengths_gene": [
+ [
+ {
+ "id": "all_samples"
+ },
+ "all_samples.gene_lengths.tsv:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "lengths_transcript": [
+ [
+ {
+ "id": "all_samples"
+ },
+ "all_samples.transcript_lengths.tsv:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "merged_gene_rds": [
+ [
+ {
+ "id": "all_samples"
+ },
+ "all_samples.SummarizedExperiment.rds:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "merged_gene_rds_length_scaled": [
+ [
+ {
+ "id": "all_samples"
+ },
+ "all_samples.SummarizedExperiment.rds:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "merged_gene_rds_scaled": [
+ [
+ {
+ "id": "all_samples"
+ },
+ "all_samples.SummarizedExperiment.rds:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "merged_transcript_rds": [
+ [
+ {
+ "id": "all_samples"
+ },
+ "all_samples.SummarizedExperiment.rds:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "multiqc": [
+ [
+ {
+ "id": "test"
+ },
+ [
+
+ ]
+ ]
+ ],
+ "results": [
+ [
+ {
+ "id": "test"
+ },
+ [
+
+ ]
+ ]
+ ],
+ "tpm_gene": [
+ [
+ {
+ "id": "all_samples"
+ },
+ "all_samples.gene_tpm.tsv:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "tpm_transcript": [
+ [
+ {
+ "id": "all_samples"
+ },
+ "all_samples.transcript_tpm.tsv:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "versions": [
+ "versions.yml:md5,4c3564e1ba17d8ce2b0ee784251ddd87",
+ "versions.yml:md5,7afb76ee798ceb1e5dff5879d28ef85a",
+ "versions.yml:md5,d5243289a32cde9e90e20f1a202bb566",
+ "versions.yml:md5,e9e7d18c3de83f1113fb1ff0c55d35ed"
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.8.4",
+ "nextflow": "24.04.2"
+ },
+ "timestamp": "2024-07-03T15:36:55.281379"
+ },
+ "kallisto - stub": {
+ "content": [
+ {
+ "0": [
+ [
+ {
+ "id": "test"
+ },
+ [
+
+ ]
+ ]
+ ],
+ "1": [
+ [
+ {
+ "id": "test"
+ },
+ "test.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "10": [
+ [
+ {
+ "id": "all_samples"
+ },
+ "all_samples.SummarizedExperiment.rds:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "11": [
+ [
+ {
+ "id": "all_samples"
+ },
+ "all_samples.SummarizedExperiment.rds:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "12": [
+ [
+ {
+ "id": "all_samples"
+ },
+ "all_samples.SummarizedExperiment.rds:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "13": [
+ [
+ {
+ "id": "all_samples"
+ },
+ "all_samples.SummarizedExperiment.rds:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "14": [
+ "versions.yml:md5,7afb76ee798ceb1e5dff5879d28ef85a",
+ "versions.yml:md5,d5243289a32cde9e90e20f1a202bb566",
+ "versions.yml:md5,e9e7d18c3de83f1113fb1ff0c55d35ed",
+ "versions.yml:md5,ea39658f8685118d81d42acd451e66ea"
+ ],
+ "2": [
+ [
+ {
+ "id": "all_samples"
+ },
+ "all_samples.gene_tpm.tsv:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "3": [
+ [
+ {
+ "id": "all_samples"
+ },
+ "all_samples.gene_counts.tsv:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "4": [
+ [
+ {
+ "id": "all_samples"
+ },
+ "all_samples.gene_lengths.tsv:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "5": [
+ [
+ {
+ "id": "all_samples"
+ },
+ "all_samples.gene_counts_length_scaled.tsv:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "6": [
+ [
+ {
+ "id": "all_samples"
+ },
+ "all_samples.gene_counts_scaled.tsv:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "7": [
+ [
+ {
+ "id": "all_samples"
+ },
+ "all_samples.transcript_tpm.tsv:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "8": [
+ [
+ {
+ "id": "all_samples"
+ },
+ "all_samples.transcript_counts.tsv:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "9": [
+ [
+ {
+ "id": "all_samples"
+ },
+ "all_samples.transcript_lengths.tsv:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "counts_gene": [
+ [
+ {
+ "id": "all_samples"
+ },
+ "all_samples.gene_counts.tsv:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "counts_gene_length_scaled": [
+ [
+ {
+ "id": "all_samples"
+ },
+ "all_samples.gene_counts_length_scaled.tsv:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "counts_gene_scaled": [
+ [
+ {
+ "id": "all_samples"
+ },
+ "all_samples.gene_counts_scaled.tsv:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "counts_transcript": [
+ [
+ {
+ "id": "all_samples"
+ },
+ "all_samples.transcript_counts.tsv:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "lengths_gene": [
+ [
+ {
+ "id": "all_samples"
+ },
+ "all_samples.gene_lengths.tsv:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "lengths_transcript": [
+ [
+ {
+ "id": "all_samples"
+ },
+ "all_samples.transcript_lengths.tsv:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "merged_gene_rds": [
+ [
+ {
+ "id": "all_samples"
+ },
+ "all_samples.SummarizedExperiment.rds:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "merged_gene_rds_length_scaled": [
+ [
+ {
+ "id": "all_samples"
+ },
+ "all_samples.SummarizedExperiment.rds:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "merged_gene_rds_scaled": [
+ [
+ {
+ "id": "all_samples"
+ },
+ "all_samples.SummarizedExperiment.rds:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "merged_transcript_rds": [
+ [
+ {
+ "id": "all_samples"
+ },
+ "all_samples.SummarizedExperiment.rds:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "multiqc": [
+ [
+ {
+ "id": "test"
+ },
+ "test.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "results": [
+ [
+ {
+ "id": "test"
+ },
+ [
+
+ ]
+ ]
+ ],
+ "tpm_gene": [
+ [
+ {
+ "id": "all_samples"
+ },
+ "all_samples.gene_tpm.tsv:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "tpm_transcript": [
+ [
+ {
+ "id": "all_samples"
+ },
+ "all_samples.transcript_tpm.tsv:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "versions": [
+ "versions.yml:md5,7afb76ee798ceb1e5dff5879d28ef85a",
+ "versions.yml:md5,d5243289a32cde9e90e20f1a202bb566",
+ "versions.yml:md5,e9e7d18c3de83f1113fb1ff0c55d35ed",
+ "versions.yml:md5,ea39658f8685118d81d42acd451e66ea"
+ ]
+ }
],
"meta": {
"nf-test": "0.8.4",
- "nextflow": "23.10.1"
+ "nextflow": "24.04.2"
},
- "timestamp": "2024-05-28T12:54:12.855884"
+ "timestamp": "2024-07-03T15:37:29.239014"
},
"salmon": {
"content": [
+ "all_samples.SummarizedExperiment.rds",
+ "all_samples.SummarizedExperiment.rds",
+ "all_samples.SummarizedExperiment.rds",
+ "all_samples.SummarizedExperiment.rds",
[
[
{
"id": "all_samples"
},
- "all_samples.gene_tpm.tsv:md5,9711ed8364c3a1ea4fc87bd5e0780835"
+ "all_samples.gene_counts.tsv:md5,865a4706b8bf47f476d8298fdd344902"
]
],
[
@@ -81,7 +591,7 @@
{
"id": "all_samples"
},
- "all_samples.gene_counts.tsv:md5,865a4706b8bf47f476d8298fdd344902"
+ "all_samples.gene_counts_length_scaled.tsv:md5,46194b28815747fe3c3d5a619fa994a7"
]
],
[
@@ -97,15 +607,17 @@
{
"id": "all_samples"
},
- "all_samples.gene_counts_length_scaled.tsv:md5,46194b28815747fe3c3d5a619fa994a7"
+ "all_samples.transcript_lengths.tsv:md5,f39a15fea56a5a8e5776dcdda0c8f102"
]
],
+ null,
+ null,
[
[
{
"id": "all_samples"
},
- "all_samples.transcript_tpm.tsv:md5,e0c16bf083ebb88bcfaf27cfba12d3e9"
+ "all_samples.gene_tpm.tsv:md5,9711ed8364c3a1ea4fc87bd5e0780835"
]
],
[
@@ -113,26 +625,20 @@
{
"id": "all_samples"
},
- "all_samples.transcript_lengths.tsv:md5,f39a15fea56a5a8e5776dcdda0c8f102"
+ "all_samples.transcript_tpm.tsv:md5,e0c16bf083ebb88bcfaf27cfba12d3e9"
]
],
- null,
- null,
[
"versions.yml:md5,4c3564e1ba17d8ce2b0ee784251ddd87",
"versions.yml:md5,b44caeec65491d47e098c7ddaf024b96",
"versions.yml:md5,d5243289a32cde9e90e20f1a202bb566",
"versions.yml:md5,e9e7d18c3de83f1113fb1ff0c55d35ed"
- ],
- "all_samples.SummarizedExperiment.rds",
- "all_samples.SummarizedExperiment.rds",
- "all_samples.SummarizedExperiment.rds",
- "all_samples.SummarizedExperiment.rds"
+ ]
],
"meta": {
"nf-test": "0.8.4",
- "nextflow": "23.10.1"
+ "nextflow": "24.04.2"
},
- "timestamp": "2024-05-28T12:53:39.46319"
+ "timestamp": "2024-07-03T15:35:48.954002"
}
}
\ No newline at end of file
diff --git a/tests/default.nf.test b/tests/default.nf.test
index b086c6db3..fb4fc2f29 100644
--- a/tests/default.nf.test
+++ b/tests/default.nf.test
@@ -14,24 +14,41 @@ nextflow_pipeline {
then {
assertAll(
{ assert workflow.success },
- { assert snapshot(UTILS.removeNextflowVersion("$outputDir/pipeline_info/nf_core_rnaseq_software_mqc_versions.yml")).match("software_versions") },
{ assert snapshot(
- path("${params.outdir}/salmon/salmon.merged.transcript_counts.tsv"),
- path("${params.outdir}/custom/out/genome_gfp.fasta"),
- path("${params.outdir}/custom/out/genome_gfp.gtf"),
- path("${params.outdir}/star_salmon/bigwig/RAP1_IAA_30M_REP1.forward.bigWig"),
- path("${params.outdir}/star_salmon/bigwig/RAP1_IAA_30M_REP1.reverse.bigWig"),
- path("${params.outdir}/star_salmon/bigwig/RAP1_UNINDUCED_REP1.forward.bigWig"),
- path("${params.outdir}/star_salmon/bigwig/RAP1_UNINDUCED_REP1.reverse.bigWig"),
- path("${params.outdir}/star_salmon/bigwig/RAP1_UNINDUCED_REP2.forward.bigWig"),
- path("${params.outdir}/star_salmon/bigwig/RAP1_UNINDUCED_REP2.reverse.bigWig"),
- path("${params.outdir}/star_salmon/bigwig/WT_REP1.forward.bigWig"),
- path("${params.outdir}/star_salmon/bigwig/WT_REP1.reverse.bigWig"),
- path("${params.outdir}/star_salmon/bigwig/WT_REP2.forward.bigWig"),
- path("${params.outdir}/star_salmon/bigwig/WT_REP2.reverse.bigWig")
- ).match("output_files")
+ UTILS.removeNextflowVersion("$outputDir/pipeline_info/nf_core_rnaseq_software_mqc_versions.yml"),
+ path("${params.outdir}/custom/out/genome_gfp.fasta"),
+ path("${params.outdir}/custom/out/genome_gfp.gtf"),
+ path("${params.outdir}/salmon/salmon.merged.transcript_counts.tsv"),
+ path("${params.outdir}/star_salmon/bigwig/RAP1_IAA_30M_REP1.forward.bigWig"),
+ path("${params.outdir}/star_salmon/bigwig/RAP1_IAA_30M_REP1.reverse.bigWig"),
+ path("${params.outdir}/star_salmon/bigwig/RAP1_UNINDUCED_REP1.forward.bigWig"),
+ path("${params.outdir}/star_salmon/bigwig/RAP1_UNINDUCED_REP1.reverse.bigWig"),
+ path("${params.outdir}/star_salmon/bigwig/RAP1_UNINDUCED_REP2.forward.bigWig"),
+ path("${params.outdir}/star_salmon/bigwig/RAP1_UNINDUCED_REP2.reverse.bigWig"),
+ path("${params.outdir}/star_salmon/bigwig/WT_REP1.forward.bigWig"),
+ path("${params.outdir}/star_salmon/bigwig/WT_REP1.reverse.bigWig"),
+ path("${params.outdir}/star_salmon/bigwig/WT_REP2.forward.bigWig"),
+ path("${params.outdir}/star_salmon/bigwig/WT_REP2.reverse.bigWig")).match()
}
)
}
}
+
+ test("Params: default - stub") {
+
+ options "-stub"
+
+ when {
+ params {
+ outdir = "$outputDir"
+ }
+ }
+
+ then {
+ assertAll(
+ { assert workflow.success },
+ { assert snapshot(UTILS.removeNextflowVersion("$outputDir/pipeline_info/nf_core_rnaseq_software_mqc_versions.yml")).match() }
+ )
+ }
+ }
}
diff --git a/tests/default.nf.test.snap b/tests/default.nf.test.snap
index 83b22815a..7371218e8 100644
--- a/tests/default.nf.test.snap
+++ b/tests/default.nf.test.snap
@@ -1,9 +1,20 @@
{
- "output_files": {
+ "Params: default - stub": {
"content": [
- "salmon.merged.transcript_counts.tsv:md5,ff0f5be09ca7a322672c0074ba35da17",
+ "{BBMAP_BBSPLIT={bbmap=39.01}, CAT_FASTQ={cat=8.3}, CUSTOM_CATADDITIONALFASTA={python=null}, CUSTOM_GETCHROMSIZES={getchromsizes=1.2}, FASTQC={fastqc=0.12.1}, GTF2BED={perl=5.26.2}, GTF_FILTER={python=3.9.5}, GUNZIP_ADDITIONAL_FASTA={gunzip=1.1}, GUNZIP_GTF={gunzip=1.1}, STAR_GENOMEGENERATE={star=2.7.10a, samtools=1.18, gawk=5.1.0}, TRIMGALORE={trimgalore=0.6.7, cutadapt=3.4}, UNTAR_SALMON_INDEX={untar=1.34}, Workflow={nf-core/rnaseq=v3.15.0dev}}"
+ ],
+ "meta": {
+ "nf-test": "0.8.4",
+ "nextflow": "24.04.3"
+ },
+ "timestamp": "2024-07-12T16:33:33.623985"
+ },
+ "Params: default": {
+ "content": [
+ "{BBMAP_BBSPLIT={bbmap=39.01}, BEDTOOLS_GENOMECOV_FW={bedtools=2.31.1}, CAT_FASTQ={cat=8.3}, CUSTOM_CATADDITIONALFASTA={python=3.9.5}, CUSTOM_GETCHROMSIZES={getchromsizes=1.2}, CUSTOM_TX2GENE={python=3.9.5}, DESEQ2_QC_PSEUDO={r-base=4.0.3, bioconductor-deseq2=1.28.0}, DESEQ2_QC_STAR_SALMON={r-base=4.0.3, bioconductor-deseq2=1.28.0}, DUPRADAR={bioconductor-dupradar=1.32.0}, FASTQC={fastqc=0.12.1}, FQ_SUBSAMPLE={fq=0.9.1 (2022-02-22)}, GTF2BED={perl=5.26.2}, GTF_FILTER={python=3.9.5}, GUNZIP_ADDITIONAL_FASTA={gunzip=1.1}, GUNZIP_GTF={gunzip=1.1}, MULTIQC_CUSTOM_BIOTYPE={python=3.9.5}, PICARD_MARKDUPLICATES={picard=3.1.1}, QUALIMAP_RNASEQ={qualimap=2.3}, RSEQC_BAMSTAT={rseqc=5.0.2}, RSEQC_INFEREXPERIMENT={rseqc=5.0.2}, RSEQC_INNERDISTANCE={rseqc=5.0.2}, RSEQC_JUNCTIONANNOTATION={rseqc=5.0.2}, RSEQC_JUNCTIONSATURATION={rseqc=5.0.2}, RSEQC_READDISTRIBUTION={rseqc=5.0.2}, RSEQC_READDUPLICATION={rseqc=5.0.2}, SALMON_QUANT={salmon=1.10.1}, SAMTOOLS_FLAGSTAT={samtools=1.2}, SAMTOOLS_IDXSTATS={samtools=1.2}, SAMTOOLS_INDEX={samtools=1.2}, SAMTOOLS_SORT={samtools=1.2}, SAMTOOLS_STATS={samtools=1.2}, SE_GENE={bioconductor-summarizedexperiment=1.32.0}, STAR_ALIGN={star=2.7.10a, samtools=1.18, gawk=5.1.0}, STAR_GENOMEGENERATE={star=2.7.10a, samtools=1.18, gawk=5.1.0}, STRINGTIE_STRINGTIE={stringtie=2.2.1}, SUBREAD_FEATURECOUNTS={subread=2.0.1}, TRIMGALORE={trimgalore=0.6.7, cutadapt=3.4}, TXIMETA_TXIMPORT={bioconductor-tximeta=1.20.1}, UCSC_BEDCLIP={ucsc=377}, UCSC_BEDGRAPHTOBIGWIG={ucsc=445}, UNTAR_SALMON_INDEX={untar=1.34}, Workflow={nf-core/rnaseq=v3.15.0dev}}",
"genome_gfp.fasta:md5,e23e302af63736a199985a169fdac055",
"genome_gfp.gtf:md5,c98b12c302f15731bfc36bcf297cfe28",
+ "salmon.merged.transcript_counts.tsv:md5,ff0f5be09ca7a322672c0074ba35da17",
"RAP1_IAA_30M_REP1.forward.bigWig:md5,0abafd7a9f9035469c003fd3dabd73e8",
"RAP1_IAA_30M_REP1.reverse.bigWig:md5,0f1e9ac71fc0b99785f06ecb860ef00e",
"RAP1_UNINDUCED_REP1.forward.bigWig:md5,09e8d65e21ac92e9a3b78afe3acdf28b",
@@ -17,18 +28,8 @@
],
"meta": {
"nf-test": "0.8.4",
- "nextflow": "24.04.1"
- },
- "timestamp": "2024-06-27T15:38:12.586958"
- },
- "software_versions": {
- "content": [
- "{BBMAP_BBSPLIT={bbmap=39.01}, BEDTOOLS_GENOMECOV_FW={bedtools=2.31.1}, CAT_FASTQ={cat=8.3}, CUSTOM_CATADDITIONALFASTA={python=3.9.5}, CUSTOM_GETCHROMSIZES={getchromsizes=1.2}, CUSTOM_TX2GENE={python=3.9.5}, DESEQ2_QC_PSEUDO={r-base=4.0.3, bioconductor-deseq2=1.28.0}, DESEQ2_QC_STAR_SALMON={r-base=4.0.3, bioconductor-deseq2=1.28.0}, DUPRADAR={bioconductor-dupradar=1.32.0}, FASTQC={fastqc=0.12.1}, FQ_SUBSAMPLE={fq=0.9.1 (2022-02-22)}, GTF2BED={perl=5.26.2}, GTF_FILTER={python=3.9.5}, GUNZIP_ADDITIONAL_FASTA={gunzip=1.1}, GUNZIP_GTF={gunzip=1.1}, MULTIQC_CUSTOM_BIOTYPE={python=3.9.5}, PICARD_MARKDUPLICATES={picard=3.1.1}, QUALIMAP_RNASEQ={qualimap=2.3}, RSEQC_BAMSTAT={rseqc=5.0.2}, RSEQC_INFEREXPERIMENT={rseqc=5.0.2}, RSEQC_INNERDISTANCE={rseqc=5.0.2}, RSEQC_JUNCTIONANNOTATION={rseqc=5.0.2}, RSEQC_JUNCTIONSATURATION={rseqc=5.0.2}, RSEQC_READDISTRIBUTION={rseqc=5.0.2}, RSEQC_READDUPLICATION={rseqc=5.0.2}, SALMON_QUANT={salmon=1.10.1}, SAMTOOLS_FLAGSTAT={samtools=1.2}, SAMTOOLS_IDXSTATS={samtools=1.2}, SAMTOOLS_INDEX={samtools=1.2}, SAMTOOLS_SORT={samtools=1.2}, SAMTOOLS_STATS={samtools=1.2}, SE_GENE={bioconductor-summarizedexperiment=1.32.0}, STAR_ALIGN={star=2.7.10a, samtools=1.18, gawk=5.1.0}, STAR_GENOMEGENERATE={star=2.7.10a, samtools=1.18, gawk=5.1.0}, STRINGTIE_STRINGTIE={stringtie=2.2.1}, SUBREAD_FEATURECOUNTS={subread=2.0.1}, TRIMGALORE={trimgalore=0.6.7, cutadapt=3.4}, TXIMETA_TXIMPORT={bioconductor-tximeta=1.20.1}, UCSC_BEDCLIP={ucsc=377}, UCSC_BEDGRAPHTOBIGWIG={ucsc=445}, UNTAR_SALMON_INDEX={untar=1.3}, Workflow={nf-core/rnaseq=v3.15.0dev}}"
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.04.1"
+ "nextflow": "24.04.3"
},
- "timestamp": "2024-06-27T15:38:12.576022"
+ "timestamp": "2024-07-12T16:32:22.039132"
}
-}
\ No newline at end of file
+}