Is it possible to extract kmers in bubbles?

[zeeev]

Greetings,

I was wondering is it possible to extract kmers that are in bubbles? I see the bubbles command generates only the variable bases, not fixed width kmers. In otherwords, I want all kmers that, lead into and out of a bubble, for both paths. I should mention this is a diploid.

I was also wondering about the view command. I couldn't find documentation about the format. I'm guessing it's kmer,count,???

GAGCTGCCAACAGCAGAGGTAAA 24 a....C..
AAATCACCGTGAAAATATAATTC 35 a......T
ATCATTATGTATTTAATTACACA 22 ...t...T

[winni2k]

I can't help you with your first question, but if nothing else works, you could try using cortexpy to load the graph into python and do your own bubble search and kmer identification. Disclaimer: I am an author and maintainer of cortexpy. Unfortunately, cortexpy does not have an algorithm for bubble search at the moment and contributions would be welcome.

Regarding your second question: The output format of mccortex view --kmers is canonical kmer, [coverage for each color] [edge set for each color]. There is a cortex spec at the cortexjdk repo and the edge set description can be found there

[iqbal-lab]

for the first question @noporpoise will know. It's not much help, but cortex can consume mccortex binary graphs, and i know cortex bubble calling does output exactly what you want in fasta format

[zeeev]

@iqbal-lab I'd like to try cortex for kmer extraction. Can you point me to the repo, I've briefly searched, but didn't find it? Wasn't cortex earlier than McCortex?

[winni2k]

Is this the correct web page for cortex?

[iqbal-lab]

Dammit I need to close the source forge page. Sorry. Current page is https://github.com/iqbal-lab/cortex