##fileformat=VCFv4.1
##LabTestID=8497
##reference=NCBIb38
##INFO=<ID=GENE_REGION,Number=.,Type=String,Description="Gene region containing variant,Header=Gene Region">
##INFO=<ID=GENE_SYMBOL,Number=.,Type=String,Description="Gene containing variant,Header=Gene Symbol">
##INFO=<ID=TRANSCRIPT_ID,Number=.,Type=String,Description="Transcript containing variant,Header=Transcript ID">
##INFO=<ID=HGVS_TRANSCRIPT,Number=.,Type=String,Description="HGVS transcript variant,Header=Transcript Variant">
##INFO=<ID=HGVS_PROTEIN,Number=.,Type=String,Description="HGVS protein variant,Header=Protein Variant">
##INFO=<ID=TRANSLATION_IMPACT,Number=.,Type=String,Description="Translation impact,Header=Translation Impact">
##INFO=<ID=SIFT_FUNCTION,Number=.,Type=String,Description="SIFT functional prediction,Source=SIFT,Version=2016-02-23,Header=SIFT Function Prediction">
##INFO=<ID=POLYPHEN_FUNCTION,Number=.,Type=String,Description="PolyPhen-2 functional prediction,Source=Polyphen-2,Version=v2.2.2 (HumVar),Header=PolyPhen-2 Function Prediction">
##INFO=<ID=BLOSUM50,Number=.,Type=Float,Description="BLOSUM50 biochemical conservation score">
##INFO=<ID=PHYLOP,Number=.,Type=Float,Description="PhyloP vertebrate conservation p-value,Source=PhyloP,Version=NCBI36 (hg18) 2009-11, GRCh37 (hg19) 2014-02, GRCh38 2015-05,Header=Conservation phyloP p-value">
##INFO=<ID=ING_FINDINGS,Number=.,Type=Float,Description="Ingenuity variant findings,Source=Ingenuity Knowledge Base,Version=H-release">
##INFO=<ID=ING_CLASSIFICATION,Number=.,Type=String,Description="Ingenuity computed clinical classification,Header=Classification">
##INFO=<ID=ING_PHENOTYPE,Number=.,Type=String,Description="Phenotype for variant assessment">
##INFO=<ID=AFC_AF,Number=.,Type=Float,Description="AFC allele frequency (percent),Source=QIAGEN,Version=2019-09-25,Header=AFC Frequency">
##INFO=<ID=AFC_AF_EAS,Number=.,Type=Float,Description="AFC East Asian allele frequency (percent),Source=QIAGEN,Version=2019-09-25,Header=AFC East Asian Frequency">
##INFO=<ID=AFC_AF_SAS,Number=.,Type=Float,Description="AFC South Asian allele frequency (percent),Source=QIAGEN,Version=2019-09-25,Header=AFC South Asian Frequency">
##INFO=<ID=AFC_AF_AFR,Number=.,Type=Float,Description="AFC African American allele frequency (percent),Source=QIAGEN,Version=2019-09-25,Header=AFC African Frequency">
##INFO=<ID=AFC_AF_EUR,Number=.,Type=Float,Description="AFC European allele frequency (percent),Source=QIAGEN,Version=2019-09-25,Header=AFC European Frequency">
##INFO=<ID=AFC_AF_LAT,Number=.,Type=Float,Description="AFC Latino allele frequency (percent),Source=QIAGEN,Version=2019-09-25,Header=AFC Latino Frequency">
##INFO=<ID=AFC_AF_AJ,Number=.,Type=Float,Description="AFC Ashkenazi Jewish allele frequency (percent),Source=QIAGEN,Version=2019-09-25,Header=AFC Ashkenazi Jewish Frequency">
##INFO=<ID=DBSNP,Number=.,Type=String,Description="dbSNP identifiers,Source=dbSNP,Version=NCBI36 (hg18) 151, GRCh37 (hg19) 154, GRCh38 154,Header=dbSNP ID">
##INFO=<ID=1000G_AF,Number=.,Type=Float,Description="1000 Genomes project allele frequency (percent),Source=1000 Genomes,Version=phase3v5b,Header=1000 Genomes Frequency">
##INFO=<ID=ESP_AF,Number=.,Type=Float,Description="Exome Server Project allele frequency (percent),Source=EVS,Version=ESP6500SI-V2,Header=NHLBI ESP Frequency">
##INFO=<ID=ESP_AF_AA,Number=.,Type=Float,Description="Exome Server Project African American allele frequency (percent),Source=EVS,Version=ESP6500SI-V2,Header=NHLBI ESP African Frequency">
##INFO=<ID=ESP_AF_EA,Number=.,Type=Float,Description="Exome Server Project European American allele frequency (percent),Source=EVS,Version=ESP6500SI-V2,Header=NHLBI ESP European Frequency">
##INFO=<ID=MITOMAP,Number=.,Type=Float,Description="MitoMap frequency (percent),Source=MitoMap,Header=MitoMap Frequency">
##INFO=<ID=ING_DRUGGED_GENE,Number=.,Type=String,Description="Does an approved drug target this gene?,Source=Ingenuity Knowledge Base,Version=H-release">
##INFO=<ID=ING_PGX_DRUGS,Number=.,Type=String,Description="Approved drug(s) with a pharmacogenetic effect,Source=Ingenuity Knowledge Base,Version=H-release">
##INFO=<ID=ESP_PUBLIC_HOMOZYGOTES,Number=.,Type=Float,Description="Exome Server Project homozygotes,Source=EVS,Version=ESP6500SI-V2">
##INFO=<ID=ING_MIN_PROTEIN_LENGTH,Number=.,Type=Float,Description="Minimal functional protein length">
##INFO=<ID=ING_COMPLEX_VARIANT,Number=.,Type=String,Description="Do any variant findings indicate variant contributes to complex genetics,Source=Ingenuity Knowledge Base,Version=H-release">
##INFO=<ID=CLINVAR_OBSERVATIONS,Number=.,Type=Float,Description="Number of individuals reported with this variant in ClinVar,Source=ClinVar,Version=2022-04-14">
##INFO=<ID=CLINVAR,Number=.,Type=String,Description="Reference ClinVar accession,Source=ClinVar,Version=09/10/2015">
##INFO=<ID=ING_AFFECTED,Number=.,Type=Float,Description="Number of affected individuals with variant reported in the literature,Source=Ingenuity Knowledge Base,Version=H-release">
##INFO=<ID=ING_AFFECTED_HOM,Number=.,Type=Float,Description="Number of affected homozygous individuals for variant reported in the literature,Source=Ingenuity Knowledge Base,Version=H-release">
##INFO=<ID=ING_UNAFFECTED,Number=.,Type=Float,Description="Number of unaffected individuals with variant reported in the literature,Source=Ingenuity Knowledge Base,Version=H-release">
##INFO=<ID=PUBMED,Number=.,Type=String,Description="PubMed identifiers for articles about this variant">
##INFO=<ID=ING_FUNCTIONAL_VALIDATION,Number=.,Type=String,Description="Type of functional validation observed">
##INFO=<ID=ING_DISCORDANT_FAMILIES,Number=.,Type=Float,Description="Number of families with affected individuals who lack claimed causal variant,Source=Ingenuity Knowledge Base,Version=H-release">
##INFO=<ID=CLI_ASSESSMENT,Number=.,Type=String,Description="Laboratory assessment of variant">
##INFO=<ID=CLI_REPORTABLE,Number=.,Type=String,Description="Whether and where variant should be included in report">
##INFO=<ID=END,Number=1,Type=Integer,Description="End position of the variant described in this record">
##INFO=<ID=SVLEN,Number=.,Type=Integer,Description="Difference in length between REF and ALT alleles">
##INFO=<ID=SVTYPE,Number=1,Type=String,Description="Type of structural variant">
##INFO=<ID=CADD,Number=.,Type=Float,Description="CADD PHRED Score,Header=CADD PHRED Score. For SNV variants having a CADD score below 10, two values will be used to represent the min, max">
##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
##FORMAT=<ID=CQ,Number=1,Type=Float,Description="Call Quality">
##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Read Depth">
##FORMAT=<ID=ING_AF,Number=1,Type=Float,Description="Ingenuity Computed Allele Fraction,Header=Allele Fraction (percent)">
##FORMAT=<ID=AD,Number=.,Type=Integer,Description="Allelic Depth, unfiltered count of all reads">
##FORMAT=<ID=CN,Number=.,Type=Integer,Description="Copy Number">
##FORMAT=<ID=FC,Number=1,Type=Float,Description="Fold Change">
##FORMAT=<ID=GQ,Number=1,Type=Float,Description="Genotype Quality">
##FORMAT=<ID=ING_CH,Number=1,Type=String,Description="Ingenuity Inferred Compound Heterozygous">
##FORMAT=<ID=ING_IA,Number=1,Type=String,Description="Ingenuity Inferred Activity">
#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	SAMPLEID
1	3815443	.	C	T	1000	PASS	INFO	GT:AD:DP:GQ	0/1:31,37:68:48
1	11109732	.	A	G	1000	PASS	INFO	GT:AD:DP:GQ	0/1:32,24:56:46
1	52374887	.	C	T	1000	PASS	INFO	GT:AD:DP:GQ	0/1:20,25:45:48
1	92264629	.	C	T	1000	PASS	INFO	GT:AD:DP:GQ	0/1:27,30:57:48
1	97679170	.	T	C	1000	PASS	INFO	GT:AD:DP:GQ	0/1:19,26:45:47
1	110198209	.	C	A	1000	PASS	INFO	GT:AD:DP:GQ	0/1:19,24:43:48
1	161210397	.	G	A	1000	PASS	INFO	GT:AD:DP:GQ	0/1:24,28:52:48
1	202748941	.	T	C	1000	PASS	INFO	GT:AD:DP:GQ	0/1:23,23:46:48
2	11767864	.	G	A	1000	PASS	INFO	GT:AD:DP:GQ	0/1:17,28:45:45
2	74100426	.	G	A	1000	PASS	INFO	GT:AD:DP:GQ	0/1:34,18:52:39
2	86089889	.	C	G	1000	PASS	INFO	GT:AD:DP:GQ	0/1:19,24:43:48
2	151619579	.	C	T	1000	PASS	INFO	GT:AD:DP:GQ	0/1:21,28:49:47
2	178550265	.	T	C	1000	PASS	INFO	GT:AD:DP:GQ	0/1:33,19:52:41
2	178573201	.	T	C	1000	PASS	INFO	GT:AD:DP:GQ	0/1:27,37:64:47
2	178748452	.	G	A	1000	PASS	INFO	GT:AD:DP:GQ	0/1:22,23:45:48
2	215386815	.	G	A	1000	PASS	INFO	GT:AD:DP:GQ	0/1:23,25:48:48
2	232486603	.	G	T	1000	PASS	INFO	GT:AD:DP:GQ	0/1:30,21:51:46
3	58146999	.	G	C	1000	PASS	INFO	GT:AD:DP:GQ	0/1:26,25:51:48
3	81499145	.	C	T	1000	PASS	INFO	GT:AD:DP:GQ	0/1:21,26:47:48
3	81642934	.	C	T	1000	PASS	INFO	GT:AD:DP:GQ	0/1:26,21:47:47
4	15479328	.	G	T	1000	PASS	INFO	GT:AD:DP:GQ	0/1:22,26:48:48
4	16202565	.	T	G	1000	PASS	INFO	GT:AD:DP:GQ	0/1:26,26:52:43
5	94471560	.	G	A	1000	PASS	INFO	GT:AD:DP:GQ	0/1:18,41:59:33
5	114475412	.	C	A	1000	PASS	INFO	GT:AD:DP:GQ	0/1:28,21:49:47
5	126825983	.	T	C	1000	PASS	INFO	GT:AD:DP:GQ	0/1:18,32:50:43
6	10410050	.	G	C	1000	PASS	INFO	GT:AD:DP:GQ	0/1:21,27:48:48
6	108049267	.	C	T	1000	PASS	INFO	GT:AD:DP:GQ	0/1:20,23:43:48
6	116125343	.	A	T	1000	PASS	INFO	GT:AD:DP:GQ	0/1:33,26:59:47
7	103498260	.	T	G	1000	PASS	INFO	GT:AD:DP:GQ	0/1:28,38:66:47
7	130400227	.	G	A	1000	PASS	INFO	GT:AD:DP:GQ	0/1:17,19:36:48
8	60856859	.	A	C	1000	PASS	INFO	GT:AD:DP:GQ	0/1:35,26:61:46
8	139732101	.	G	A	1000	PASS	INFO	GT:AD:DP:GQ	0/1:32,26:58:47
9	116698709	.	A	G	1000	PASS	INFO	GT:AD:DP:GQ	0/1:32,30:62:48
9	128582539	.	G	T	1000	PASS	INFO	GT:AD:DP:GQ	0/1:38,26:64:44
10	5456842	.	G	A	1000	PASS	INFO	GT:AD:DP:GQ	0/1:36,28:64:46
10	13278305	.	A	AGAT	1000	PASS	INFO	GT:AD:DP:GQ	0/1:34,28:62:47
10	17068640	.	T	C	1000	PASS	INFO	GT:AD:DP:GQ	0/1:21,24:45:48
10	26720339	.	A	G	1000	PASS	INFO	GT:AD:DP:GQ	0/1:35,33:68:48
10	98721718	.	C	T	1000	PASS	INFO	GT:AD:DP:GQ	0/1:22,21:43:48
11	20628088	.	G	A	1000	PASS	INFO	GT:AD:DP:GQ	0/1:19,27:46:47
11	47232807	.	G	A	1000	PASS	INFO	GT:AD:DP:GQ	0/1:36,24:60:43
11	47284983	.	G	A	1000	PASS	INFO	GT:AD:DP:GQ	0/1:25,23:48:48
11	57739266	.	T	C	1000	PASS	INFO	GT:AD:DP:GQ	0/1:24,19:43:48
11	78441084	.	T	C	1000	PASS	INFO	GT:AD:DP:GQ	0/1:15,36:51:32
12	31084608	.	G	A	1000	PASS	INFO	GT:AD:DP:GQ	0/1:22,13:35:40
12	32755340	.	T	G	1000	PASS	INFO	GT:AD:DP:GQ	0/1:14,27:41:40
12	79845398	.	G	A	1000	PASS	INFO	GT:AD:DP:GQ	0/1:34,28:62:47
13	110687729	.	G	A	1000	PASS	INFO	GT:AD:DP:GQ	0/1:16,19:35:48
14	58456689	.	T	C	1000	PASS	INFO	GT:AD:DP:GQ	0/1:29,31:60:48
15	57232394	.	C	A	1000	PASS	INFO	GT:AD:DP:GQ	0/1:27,23:50:48
15	78601993	.	G	A	1000	PASS	INFO	GT:AD:DP:GQ	0/1:29,26:55:47
16	552647	.	C	T	1000	PASS	INFO	GT:AD:DP:GQ	0/1:28,23:51:47
16	5078843	.	G	A	1000	PASS	INFO	GT:AD:DP:GQ	0/1:35,29:64:47
16	70894474	.	G	A	1000	PASS	INFO	GT:AD:DP:GQ	0/1:21,23:44:33
16	83915361	.	G	T	1000	PASS	INFO	GT:AD:DP:GQ	0/1:35,40:75:48
17	29534305	.	A	G	1000	PASS	INFO	GT:AD:DP:GQ	0/1:32,30:62:47
17	73197386	.	G	C	1000	PASS	INFO	GT:AD:DP:GQ	0/1:29,26:55:48
17	73206818	.	GTAAAGGC	G	1000	PASS	INFO	GT:AD:DP:GQ	0/1:17,22:39:48
17	80081892	.	C	T	1000	PASS	INFO	GT:AD:DP:GQ	0/1:16,14:30:48
18	70020730	.	C	A	1000	PASS	INFO	GT:AD:DP:GQ	0/1:29,27:56:48
19	41988514	.	G	A	1000	PASS	INFO	GT:AD:DP:GQ	0/1:16,21:37:48
19	47695033	.	C	T	1000	PASS	INFO	GT:AD:DP:GQ	0/1:24,27:51:48
20	10405666	.	T	A	1000	PASS	INFO	GT:AD:DP:GQ	0/1:22,17:39:47
20	32800145	.	C	T	1000	PASS	INFO	GT:AD:DP:GQ	0/1:45,16:61:19
20	63678268	.	T	C	1000	PASS	INFO	GT:AD:DP:GQ	0/1:17,28:45:45
21	43063074	.	A	ATGATCTGCAGAGGGCGCGGCTTCAGGGCTCAAGCCCAGCAAAAGCCCCACCTGGATGATCCACCCCAG	1000	PASS	INFO	GT:AD:DP:GQ	0/1:22,32:56:48
21	45455729	.	C	T	1000	PASS	INFO	GT:AD:DP:GQ	0/1:31,36:67:48
22	26625624	.	T	C	1000	PASS	INFO	GT:AD:DP:GQ	0/1:33,37:70:48
22	42640576	.	G	A	1000	PASS	INFO	GT:AD:DP:GQ	0/1:21,25:46:48