diff --git a/bootstrap.py b/bootstrap.py index c31c71e4409e8..ec421731891d4 100755 --- a/bootstrap.py +++ b/bootstrap.py @@ -52,7 +52,7 @@ # TODO: this mimics the override in the "common" job in .circleci/config.yaml with open('.circleci/common.sh', 'w') as fout: - fout.write("MINICONDA_VER=4.5.4\nBIOCONDA_UTILS_TAG=cb3-migration\n") + fout.write("MINICONDA_VER=4.5.4\nBIOCONDA_UTILS_TAG=master\n") local_config_path = os.path.expanduser('~/.config/bioconda/activate') diff --git a/build-fail-blacklist b/build-fail-blacklist index 7cc0a3fecd99d..b01b60c035c27 100644 --- a/build-fail-blacklist +++ b/build-fail-blacklist @@ -144,18 +144,6 @@ recipes/spingo # https://gcc.gnu.org/gcc-4.5/cxx0x_status.html # And https://gcc.gnu.org/gcc-4.8/cxx0x_status.html -# From a verbose make log, it may actually be that the CXX command is not propgating the args properly: -# make[2]: Entering directory `/opt/conda/conda-bld/twopaco_1529606958569/work/build' -#[ 7%] Building CXX object graphdump/CMakeFiles/graphdump.dir/graphdump.cpp.o -#cd /opt/conda/conda-bld/twopaco_1529606958569/work/build/graphdump && /opt/rh/devtoolset-2/root/usr/bin/g++ -I/opt/conda/conda-bld/twopaco_1529606958569/work/src/graphdump/../common -DBOOST_MATH_DISABLE_FLOAT128 -m64 -fPIC;-std=c++0x -O3 -DNDEBUG -o CMakeFiles/graphdump.dir/graphdump.cpp.o -c /opt/conda/conda-bld/twopaco_1529606958569/work/src/graphdump/graphdump.cpp -#g++: fatal error: no input files - -recipes/twopaco - - -# deteclaunch.h:27:19: fatal error: fftw3.h: No such file or directory -recipes/tadarida-d - # CMake Error: The source directory "/opt/conda/conda-bld/sqlitebrowser_1529759350498/work" does not appear to contain CMakeLists.txt. recipes/sqlitebrowser @@ -244,8 +232,6 @@ recipes/brass recipes/fwdpp recipes/fwdpp/0.5.3 recipes/fwdpp/0.5.4 -# libgl missing -recipes/estmapper # test segfaults recipes/kat/2.3.1 @@ -338,10 +324,6 @@ recipes/pasta/0.2 # - qiime -> numpy=1.12 recipes/koeken -#conda_build.exceptions.CondaBuildException: Found a build.sh script and a build/script sectioninside meta.yaml. Either remove the build.sh script or remove the build/script section in meta.yaml. -recipes/metaseq - - # RuntimeError: Setuptools downloading is disabled in conda build. Be sure to add all dependencies in the meta.yaml url=https://files.pythonhosted.org/packages/source/c/certifi/certifi-2016.9.26.tar.gz#md5=baa81e951a29958563689d868ef1064d recipes/nucleoatac/0.3.1 @@ -642,12 +624,10 @@ recipes/jali recipes/intervalstats # failing -recipes/igblast recipes/igblast/1.4.0 # missing fortran lib, will fix this upstream recipes/ig-checkfcs -recipes/kfoots # I got far with desmon but not it fails inside Docker with a missing perl module recipes/desman diff --git a/recipes/Drop-seq_tools/build.sh b/recipes/Drop-seq_tools/build.sh index 9b7e0f216d405..2b01f36d22470 100644 --- a/recipes/Drop-seq_tools/build.sh +++ b/recipes/Drop-seq_tools/build.sh @@ -2,26 +2,32 @@ set -eu -o pipefail declare -a PROGRAMS=( - 'BAMTagHistogram' - 'BAMTagofTagCounts' + 'BamTagHistogram' + 'BamTagOfTagCounts' 'BaseDistributionAtReadPosition' 'CollapseBarcodesInPlace' 'CollapseTagWithContext' + 'CompareDropSeqAlignments' 'ConvertToRefFlat' 'CreateIntervalsFiles' + 'DetectBeadSubstitutionErrors' 'DetectBeadSynthesisErrors' 'DigitalExpression' - 'FilterBAM' - 'FilterBAMByTag' + 'FilterBam' + 'FilterBamByTag' + 'FilterGtf' 'GatherGeneGCLength' 'GatherMolecularBarcodeDistributionByGene' 'GatherReadQualityMetrics' + 'MaskReferenceSequence' + 'MergeDgeSparse' 'PolyATrimmer' - 'ReduceGTF' + 'ReduceGtf' 'SelectCellsByNumTranscripts' 'SingleCellRnaSeqMetricsCollector' 'TagBamWithReadSequenceExtended' - 'TagReadWithGeneExon' + 'TagReadWithGeneExonFunction' + 'TagReadWithGeneFunction' 'TagReadWithInterval' 'TrimStartingSequence' 'ValidateReference' diff --git a/recipes/Drop-seq_tools/meta.yaml b/recipes/Drop-seq_tools/meta.yaml index 446a80d2e967e..1e5e9549ad8df 100644 --- a/recipes/Drop-seq_tools/meta.yaml +++ b/recipes/Drop-seq_tools/meta.yaml @@ -1,13 +1,13 @@ {% set name = "Drop-seq_tools" %} -{% set version = "1.13" %} -{% set versiongrep = "1.13(7bed8f4_1513008033)" %} +{% set version = "2.0.0" %} +{% set versiongrep = "2.0.0(1ef3a59_1539205128)" %} about: home: http://mccarrolllab.com/dropseq/ license: MIT License license_family: MIT summary: | - Package fot the analysis of Drop-seq data developed by Jim Nemesh in the McCarroll Lab + Package for the analysis of Drop-seq data developed by Jim Nemesh in the McCarroll Lab package: name: dropseq_tools version: {{ version }} @@ -16,39 +16,45 @@ build: number: 0 source: - url: http://mccarrolllab.com/download/1276/{{ name }}-{{ version }}.zip - md5: 28533edd82867ed75867b05785cf8834 + url: https://github.com/broadinstitute/Drop-seq/releases/download/v{{ version }}/{{ name }}-{{ version }}.zip + md5: 3032444ec1c747181c6e9394d1e2a914 requirements: run: - - openjdk >=7 + - openjdk >=8 test: commands: - - 'BAMTagHistogram -- --help 2>&1 | grep "{{ versiongrep }}"' - - 'BAMTagofTagCounts -- --help 2>&1 | grep "{{ versiongrep }}"' + - 'BamTagHistogram -- --help 2>&1 | grep "{{ versiongrep }}"' + - 'BamTagOfTagCounts -- --help 2>&1 | grep "{{ versiongrep }}"' - 'BaseDistributionAtReadPosition -- --help 2>&1 | grep "{{ versiongrep }}"' - 'CollapseBarcodesInPlace -- --help 2>&1 | grep "{{ versiongrep }}"' - 'CollapseTagWithContext -- --help 2>&1 | grep "{{ versiongrep }}"' + - 'CompareDropSeqAlignments -- --help 2>&1 | grep "{{ versiongrep }}"' - 'ConvertToRefFlat -- --help 2>&1 | grep "{{ versiongrep }}"' - 'CreateIntervalsFiles -- --help 2>&1 | grep "{{ versiongrep }}"' + - 'DetectBeadSubstitutionErrors -- --help 2>&1 | grep "{{ versiongrep }}"' - 'DetectBeadSynthesisErrors -- --help 2>&1 | grep "{{ versiongrep }}"' - 'DigitalExpression -- --help 2>&1 | grep "{{ versiongrep }}"' - - 'FilterBAM -- --help 2>&1 | grep "{{ versiongrep }}"' - - 'FilterBAMByTag -- --help 2>&1 | grep "{{ versiongrep }}"' + - 'FilterBam -- --help 2>&1 | grep "{{ versiongrep }}"' + - 'FilterBamByTag -- --help 2>&1 | grep "{{ versiongrep }}"' + - 'FilterGtf -- --help 2>&1 | grep "{{ versiongrep }}"' - 'GatherGeneGCLength -- --help 2>&1 | grep "{{ versiongrep }}"' - 'GatherMolecularBarcodeDistributionByGene -- --help 2>&1 | grep "{{ versiongrep }}"' - 'GatherReadQualityMetrics -- --help 2>&1 | grep "{{ versiongrep }}"' + - 'MaskReferenceSequence -- --help 2>&1 | grep "{{ versiongrep }}"' + - 'MergeDgeSparse -- --help 2>&1 | grep "{{ versiongrep }}"' - 'PolyATrimmer -- --help 2>&1 | grep "{{ versiongrep }}"' - - 'ReduceGTF -- --help 2>&1 | grep "{{ versiongrep }}"' + - 'ReduceGtf -- --help 2>&1 | grep "{{ versiongrep }}"' - 'SelectCellsByNumTranscripts -- --help 2>&1 | grep "{{ versiongrep }}"' - 'SingleCellRnaSeqMetricsCollector -- --help 2>&1 | grep "{{ versiongrep }}"' - 'TagBamWithReadSequenceExtended -- --help 2>&1 | grep "{{ versiongrep }}"' - - 'TagReadWithGeneExon -- --help 2>&1 | grep "{{ versiongrep }}"' + - 'TagReadWithGeneExonFunction -- --help 2>&1 | grep "{{ versiongrep }}"' + - 'TagReadWithGeneFunction -- --help 2>&1 | grep "{{ versiongrep }}"' - 'TagReadWithInterval -- --help 2>&1 | grep "{{ versiongrep }}"' - 'TrimStartingSequence -- --help 2>&1 | grep "{{ versiongrep }}"' - 'ValidateReference -- --help 2>&1 | grep "{{ versiongrep }}"' extra: notes: | - Drop-seq_tools utilities are wrapper shell scripts. To get help on individual tool, use e.g. `PolyATrimmer -- --help` \ No newline at end of file + Drop-seq_tools utilities are wrapper shell scripts. To get help on individual tool, use e.g. `PolyATrimmer -- --help` diff --git a/recipes/abeona/meta.yaml b/recipes/abeona/meta.yaml index 49f4872e5be09..c8378700b77ca 100644 --- a/recipes/abeona/meta.yaml +++ b/recipes/abeona/meta.yaml @@ -1,5 +1,5 @@ -{% set version = "0.26.0" %} -{% set sha256 = "0f9d2edf6e59ff94bf3f58e08d37ec4623553f02aa4877de76dc8465f1101802" %} +{% set version = "0.36.0" %} +{% set sha256 = "1f48f6b83e66393da24e9774f17edc03703994c7f721bc09b17db8d089277f91" %} package: name: abeona @@ -22,12 +22,13 @@ requirements: - python run: - mccortex ==1.0 - - nextflow ==0.31.1 + - nextflow ==0.32.0 - cortexpy ==0.44.0 - kallisto ==0.44.0 + - bwa - pandas - progressbar2 - - python + - python >=3.6 test: imports: diff --git a/recipes/abricate/meta.yaml b/recipes/abricate/meta.yaml index 11838fc19657b..a1fe500243525 100644 --- a/recipes/abricate/meta.yaml +++ b/recipes/abricate/meta.yaml @@ -1,6 +1,6 @@ -{% set version = "0.8.7" %} +{% set version = "0.8.10" %} {% set name = "abricate" %} -{% set sha256 = "6eb3f8e77c6bcbeb30a1b36ac5d65f44cb53f26935373f56ec83a611b378be83" %} +{% set sha256 = "b6724df558e5ee68c48696356035ba2c5911eb5f0176c42ffb129be1941b6b68" %} package: name: {{ name }} diff --git a/recipes/admixtools/build.sh b/recipes/admixtools/build.sh index a0b55d7cfb90c..bcac766840ee9 100644 --- a/recipes/admixtools/build.sh +++ b/recipes/admixtools/build.sh @@ -4,7 +4,4 @@ make clobber make CFLAGS="-Wno-unused-comparison -Wno-return-type -I$PREFIX/include" LDFLAGS="-L$PREFIX/lib" all -# Install -mkdir -p $PREFIX/bin -cp {qp3Pop,qpDstat,qpF4ratio,qpAdm,qpWave,dowtjack,expfit.sh,qpBound,qpGraph,qpreroot} $PREFIX/bin/ -cp {qpff3base,qpDpart,qp4diff,qpF4ratio,qpgbug,grabpars,rolloff,rolloffp,convertf,mergeit} $PREFIX/bin/ \ No newline at end of file +make install TOP=$PREFIX/bin diff --git a/recipes/admixtools/meta.yaml b/recipes/admixtools/meta.yaml index a8ffa6884adaf..74a36aa3f4cde 100644 --- a/recipes/admixtools/meta.yaml +++ b/recipes/admixtools/meta.yaml @@ -1,10 +1,10 @@ package: name: admixtools - version: '5.0' + version: '5.1' source: - url: https://github.com/DReichLab/AdmixTools/archive/v5.0.tar.gz - sha256: 9f00637eac84c1ca152b65313d803616ee62c4156c7c737a33f5b31aeeac1367 + url: https://github.com/DReichLab/AdmixTools/archive/v5.1.tar.gz + sha256: 42b584cc785abfdfa9f39a341bdf81f800639737feaf3d07702de4a2e373557e build: number: 0 diff --git a/recipes/agfusion/meta.yaml b/recipes/agfusion/meta.yaml index 5f88f88e9eb2e..478a1bd175bee 100644 --- a/recipes/agfusion/meta.yaml +++ b/recipes/agfusion/meta.yaml @@ -1,5 +1,5 @@ -{% set version = "1.2" %} -{% set sha256 = "62733254ceaba970a018f16d36bfb1907e0505cc98eaf2dc49ee4938aaf4fd4d" %} +{% set version = "1.23" %} +{% set sha256 = "b11225f03c24b130a148abef08d516da35c1a55a038b826550ddade14eafa222" %} @@ -13,7 +13,7 @@ source: build: noarch: python - number: 2 + number: 0 script: python -m pip install --no-deps --ignore-installed . requirements: diff --git a/recipes/alfred/meta.yaml b/recipes/alfred/meta.yaml index 760ca949484ce..430d3bbc993c2 100644 --- a/recipes/alfred/meta.yaml +++ b/recipes/alfred/meta.yaml @@ -1,5 +1,5 @@ -{% set version = "0.1.12" %} -{% set sha256 = "9e4702279aacb350eafe709925d7c2f651b5622b8fa1fb90d0c8320e1c093dbe" %} +{% set version = "0.1.13" %} +{% set sha256 = "5ef66a11f74c97c4dc9e20f1c9982d3881d64e50b8d2ece2fc240c3429940120" %} package: name: alfred @@ -8,11 +8,11 @@ package: source: url: https://github.com/tobiasrausch/alfred/archive/v{{ version }}.tar.gz sha256: '{{ sha256 }}' - patches: - - Makefile.patch +# patches: +# - Makefile.patch build: - number: 1 + number: 0 skip: True # [osx] requirements: diff --git a/recipes/alignstats/meta.yaml b/recipes/alignstats/meta.yaml index 30d9527b1477a..2cae5d49d3152 100644 --- a/recipes/alignstats/meta.yaml +++ b/recipes/alignstats/meta.yaml @@ -1,5 +1,5 @@ -{% set version = "0.3" %} -{% set sha256 = "faf5860757dbbfecd180c97e5246e11721a620176e968312950990b81af6a298" %} +{% set version = "0.5" %} +{% set sha256 = "9edd4e99fcf40403afa806eaa7d8dc5e62d4a405e1c920e3d73b7fc192272018" %} package: name: alignstats @@ -10,7 +10,7 @@ source: sha256: {{ sha256 }} build: - number: 1 + number: 0 skip: False requirements: diff --git a/recipes/angsd/meta.yaml b/recipes/angsd/meta.yaml index 3c71b4e7ed9f8..c071576ecb50e 100644 --- a/recipes/angsd/meta.yaml +++ b/recipes/angsd/meta.yaml @@ -1,5 +1,5 @@ -{% set version = "0.921" %} -{% set sha256 = "8892d279ce1804f9e17fe2fc65a47e5498e78fc1c1cb84d2ca2527fd5c198772" %} +{% set version = "0.923" %} +{% set sha256 = "5144c16c901faa9dd9310c04f391df2ef2a5f7ddfcded4d9fba609279715c9c6" %} package: name: angsd @@ -10,7 +10,7 @@ source: sha256: {{ sha256 }} build: - number: 2 + number: 0 skip: True # [osx] requirements: diff --git a/recipes/anndata/meta.yaml b/recipes/anndata/meta.yaml index 573dbde2c2465..cf3a50899a2a5 100644 --- a/recipes/anndata/meta.yaml +++ b/recipes/anndata/meta.yaml @@ -1,5 +1,5 @@ -{% set version = "0.6.10" %} -{% set sha256 = "39c6c33edee1505865d1e6400952c5fdb342478cb5777e6e4eb480f2f46e7084" %} +{% set version = "0.6.11" %} +{% set sha256 = "21bc16ea08c0f46e9c7139ba9762cd26329fe7f30a4c5159f85389c9a3626407" %} package: name: anndata diff --git a/recipes/antarna/meta.yaml b/recipes/antarna/meta.yaml index 7bf97e1705546..a4fd664ad40f6 100644 --- a/recipes/antarna/meta.yaml +++ b/recipes/antarna/meta.yaml @@ -1,5 +1,5 @@ -{% set version = "2.0.1.2" %} -{% set sha256 = "537d8e7cf94adf0d58ea3e381e21d9ff2fedc03a745abd4fbf4e48250cf2b4f3" %} +{% set version = "2.0.6" %} +{% set sha256 = "f9d31bdddb58340faeef06afe51ce831358a37e08cdaf03d0be5bbf0163c223d" %} package: name: antarna @@ -10,7 +10,7 @@ source: sha256: {{ sha256 }} build: - number: 1 + number: 0 skip: True # [osx or py3k] requirements: diff --git a/recipes/anvio-minimal/meta.yaml b/recipes/anvio-minimal/meta.yaml index d80fff13448e7..a5284c7d6d87d 100644 --- a/recipes/anvio-minimal/meta.yaml +++ b/recipes/anvio-minimal/meta.yaml @@ -1,17 +1,17 @@ {% set version = "5.2.0" %} -{% set ver = "5.2" %} -{% set sha256 = "c7a178ef52e9230a36b1daca66d05a1bdd91ee61dbfa112b0643a04123fd7b2c" %} +{% set sha256 = "2b74ec5977a2c0a047def37fb814e9cfc380f65c312cf9df95a2c75d271c7182" %} +{% set url = "https://files.pythonhosted.org/packages/e0/15/a57179e855d4185e36bb83e982718260acf1334ac892e856cc18950d368a/anvio-5.2.tar.gz" %} package: name: anvio-minimal version: {{ version }} source: - url: https://github.com/merenlab/anvio/archive/v{{ ver }}.tar.gz + url: {{ url }} sha256: {{ sha256 }} build: - number: 0 + number: 1 script: python -m pip install --no-deps --ignore-installed . requirements: diff --git a/recipes/any2fasta/build.sh b/recipes/any2fasta/build.sh new file mode 100644 index 0000000000000..014a584102513 --- /dev/null +++ b/recipes/any2fasta/build.sh @@ -0,0 +1,4 @@ +#!/bin/sh + +mkdir -p ${PREFIX}/bin +cp any2fasta ${PREFIX}/bin diff --git a/recipes/any2fasta/meta.yaml b/recipes/any2fasta/meta.yaml new file mode 100644 index 0000000000000..193a994687d88 --- /dev/null +++ b/recipes/any2fasta/meta.yaml @@ -0,0 +1,30 @@ +{% set version = "0.4.2" %} +{% set name = "any2fasta" %} +{% set sha256 = "e4cb2ddccda6298f5b0aee0c10184a75307a08b584d2abbfbf0d59d37b197e73" %} +{% set user = "tseemann" %} + +package: + name: {{ name }} + version: {{ version }} + +source: + url: https://github.com/{{ user }}/{{ name }}/archive/v{{ version }}.tar.gz + sha256: {{ sha256 }} + +build: + number: 1 + +requirements: + build: + + run: + - perl + +test: + commands: + - any2fasta -h + +about: + home: https://github.com/{{ user }}/{{ name }} + license: GPL-3.0 + summary: Convert various sequence formats to FASTA diff --git a/recipes/assembly-scan/build.sh b/recipes/assembly-scan/build.sh new file mode 100644 index 0000000000000..10715b92b250f --- /dev/null +++ b/recipes/assembly-scan/build.sh @@ -0,0 +1,5 @@ +#!/bin/bash + +mkdir -p $PREFIX/bin +chmod 755 assembly-scan.py +cp -f assembly-scan.py $PREFIX/bin/assembly-scan diff --git a/recipes/assembly-scan/meta.yaml b/recipes/assembly-scan/meta.yaml new file mode 100644 index 0000000000000..db8b747127f76 --- /dev/null +++ b/recipes/assembly-scan/meta.yaml @@ -0,0 +1,33 @@ +{% set name="assembly-scan" %} +{% set version = "0.2" %} +{% set sha256 = "25356e763b79dbb01b88fa773ac991dfa8da8bd0ae69237699f304e8647cd5fd" %} + +package: + name: {{ name }} + version: {{ version }} + +source: + url: https://github.com/rpetit3/assembly-scan/archive/v{{ version }}.tar.gz + sha256: {{ sha256 }} + +build: + number: 0 + skip: True # [py27] + +requirements: + build: + - python + run: + - python + +test: + commands: + - assembly-scan + - assembly-scan --version + - assembly-scan -h + +about: + home: https://github.com/rpetit3/assembly-scan + license: MIT + license_file: LICENSE + summary: Assembly summary statistics in JSON format diff --git a/recipes/bam2fastx/meta.yaml b/recipes/bam2fastx/meta.yaml index 43bc1be56e5af..6c6f33dec5d28 100644 --- a/recipes/bam2fastx/meta.yaml +++ b/recipes/bam2fastx/meta.yaml @@ -26,7 +26,7 @@ build: requirements: build: - {{ compiler('cxx') }} - - meson ==0.46* + - meson >=0.48.1 - ninja - pkg-config host: diff --git a/recipes/batvi/build.sh b/recipes/batvi/build.sh new file mode 100644 index 0000000000000..c2a0e9a9ebd14 --- /dev/null +++ b/recipes/batvi/build.sh @@ -0,0 +1,17 @@ +export C_INCLUDE_PATH=$C_INCLUDE_PATH:${PREFIX}/include +export CPLUS_INCLUDE_PATH=$CPLUS_INCLUDE_PATH:${PREFIX}/include +export LIBRARY_PATH=$LIBRARY_PATH:${PREFIX}/lib +export CFLAGS="-I$PREFIX/include" +export LDFLAGS="-L$PREFIX/lib" +mkdir -p $PREFIX/bin/msapipeline/msa +mkdir -p $PREFIX/bin/bin +mkdir -p $PREFIX/bin/BatMis-3.00/bin +mkdir -p $PREFIX/bin/batindel/src +./build.sh +cp *.{sh,pl} $PREFIX/bin +cp bin/*.{sh,pl} $PREFIX/bin/bin +cp bin/cluster_bp $PREFIX/bin/bin +cp msapipeline/*.{sh,pl} $PREFIX/bin/msapipeline +cp msapipeline/msa/*.class $PREFIX/bin/msapipeline/msa +cp BatMis-3.00/bin/* $PREFIX/bin/BatMis-3.00/bin +cp batindel/src/penguin $PREFIX/bin/batindel/src diff --git a/recipes/batvi/meta.yaml b/recipes/batvi/meta.yaml new file mode 100644 index 0000000000000..6dd79b4d64b6c --- /dev/null +++ b/recipes/batvi/meta.yaml @@ -0,0 +1,38 @@ +package: + name: batvi + version: "1.04" + + +source: + url: https://github.com/22noon/BatVI/archive/master.zip + path: src + sha256: 0072a56055998d0d67822d66128de1e84ea9d34770fd3752192ca1f93bf6569d + +requirements: + run: + - samtools + - blast + - bedtools + - picard + - bwa + - zlib + - openjdk + + host: + - zlib + - openjdk + + build: + - {{ compiler('c') }} + +build: + number: 1 + string: cond +about: + home: https://www.comp.nus.edu.sg/~bioinfo/batvi/ + license: GPLv3+ + summary: Detect viral integrations + +test: + commands: + - echo "Run test data on the website.. " diff --git a/recipes/bax2bam/meta.yaml b/recipes/bax2bam/meta.yaml index cce975ef3a3fd..b0d2c1e22710a 100644 --- a/recipes/bax2bam/meta.yaml +++ b/recipes/bax2bam/meta.yaml @@ -26,7 +26,7 @@ build: requirements: build: - {{ compiler('cxx') }} - - meson + - meson >=0.48.1 - ninja - pkg-config host: diff --git a/recipes/bcalm/CMakeLists.patch b/recipes/bcalm/CMakeLists.patch new file mode 100644 index 0000000000000..f6601b296b512 --- /dev/null +++ b/recipes/bcalm/CMakeLists.patch @@ -0,0 +1,31 @@ +--- bcalm-2.2.0/CMakeLists.txt 2017-12-20 15:51:42.000000000 +0100 ++++ CMakeLists.txt 2018-10-13 19:05:16.067524264 +0200 +@@ -25,7 +25,7 @@ + ARGS "rev-parse --short HEAD" + OUTPUT_VARIABLE VERSION_SHA1 ) + +-add_definitions( -DGIT_SHA1="${VERSION_SHA1}" ) ++add_definitions( -DGIT_SHA1="c8ac60252fa0b2abf511f7363cff7c4342dac2ee" ) + + + ################################################################################ +@@ -84,7 +84,7 @@ + SET (CPACK_PACKAGE_VERSION "") + + # We have to tell what is the server name +-SET (CPACK_GFORGE_PROJECT_NAME "gatb-tools") ++#SET (CPACK_GFORGE_PROJECT_NAME "gatb-tools") + + # We set the kind of archive + SET (CPACK_GENERATOR "TGZ") +@@ -104,8 +104,8 @@ + + # We copy the project binary to the 'bin' directory + INSTALL (TARGETS ${PROJECT_NAME} DESTINATION bin) +-INSTALL (DIRECTORY "${PROJECT_SOURCE_DIR}/example/" DESTINATION example) +-INSTALL (FILES LICENSE README.md DESTINATION bin/..) ++#INSTALL (DIRECTORY "${PROJECT_SOURCE_DIR}/example/" DESTINATION example) ++#INSTALL (FILES LICENSE README.md DESTINATION bin/..) + + # cmake_system_name for mac is Darwin, i want to change that + if (${CMAKE_SYSTEM_NAME} MATCHES "Linux") diff --git a/recipes/bcalm/build.sh b/recipes/bcalm/build.sh new file mode 100644 index 0000000000000..e9ff73ba59ed8 --- /dev/null +++ b/recipes/bcalm/build.sh @@ -0,0 +1,25 @@ +#!/bin/bash + +export CPATH=${PREFIX}/include +export LIBRARY_PATH=${PREFIX}/lib + +# we can't build bcalm with avaible gatb, link trouble +rm -rf gatb-core +wget https://github.com/GATB/gatb-core/archive/v1.4.1.tar.gz +tar xvfz v1.4.1.tar.gz +mv gatb-core-1.4.1 gatb-core + +# avoid gatb example install +if [ "$(uname)" == "Darwin" ]; then + sed -i '' -e "s/.*INSTALL.*examples.*/#&/" gatb-core/gatb-core/CMakeLists.txt +else + sed -i'' -e "s/.*INSTALL.*examples.*/#&/" gatb-core/gatb-core/CMakeLists.txt +fi + +# build +mkdir build +cd build + +cmake -DCMAKE_INSTALL_PREFIX:PATH=$PREFIX -DKSIZE_LIST="32 64 96 128 160 192 224 256" .. +make -j 4 +make install diff --git a/recipes/bcalm/meta.yaml b/recipes/bcalm/meta.yaml new file mode 100644 index 0000000000000..1fa296b928b18 --- /dev/null +++ b/recipes/bcalm/meta.yaml @@ -0,0 +1,35 @@ +{% set version = "2.2.0" %} +{% set md5 = "846a44263e289b922ec42247c70318a6" %} + + +package: + name: bcalm + version: '{{version}}' + +source: + url: "https://github.com/GATB/bcalm/archive/v{{version}}.zip" + md5: '{{md5}}' + patches: + - CMakeLists.patch +build: + number: 3 + +requirements: + build: + - {{ compiler('c') }} + - {{ compiler('cxx') }} + host: + - cmake + - zlib + - gnu-wget + run: + - zlib + +test: + commands: + - bcalm --help + +about: + home: https://github.com/GATB/bcalm + license: MIT License + summary: BCALM 2 is a bioinformatics tool for constructing the compacted de Bruijn graph from sequencing data. diff --git a/recipes/bcbio-nextgen/meta.yaml b/recipes/bcbio-nextgen/meta.yaml index 86dde3e437f90..00548de786e81 100644 --- a/recipes/bcbio-nextgen/meta.yaml +++ b/recipes/bcbio-nextgen/meta.yaml @@ -3,13 +3,13 @@ package: version: '1.1.1a' build: - number: 11 + number: 12 skip: true # [not py27] source: #url: https://pypi.io/packages/source/b/bcbio-nextgen/bcbio-nextgen-1.1.0.tar.gz - url: https://github.com/bcbio/bcbio-nextgen/archive/3f436af.tar.gz - sha256: d445fbc9a46bb8d3e6a6d06893154b6cdba0239d12e5aa691ae78ed6d1480807 + url: https://github.com/bcbio/bcbio-nextgen/archive/b84fc4e.tar.gz + sha256: 5ae203bbbdc7181397fff34a4de9c9f42aaa3aafb32fa7b3048c06576ad01024 requirements: host: diff --git a/recipes/binsanity/meta.yaml b/recipes/binsanity/meta.yaml index dd74b62a0dbf3..6ca1b0ffda721 100644 --- a/recipes/binsanity/meta.yaml +++ b/recipes/binsanity/meta.yaml @@ -1,5 +1,5 @@ -{% set version = "0.2.6.3" %} -{% set sha256 = "df192b10a7a8697a7819193e227fbda0f9ca0efe9cc0564f5f016d1634b5b4cb" %} +{% set version = "0.2.7.1" %} +{% set sha256 = "c1160bc23275fb33a824ebcc2ad8a9b285db0123a6736442071d136226917fd8" %} package: name: binsanity diff --git a/recipes/biobb_model/build.sh b/recipes/biobb_model/build.sh new file mode 100644 index 0000000000000..4b2f81a4b0d0e --- /dev/null +++ b/recipes/biobb_model/build.sh @@ -0,0 +1,11 @@ +#!/usr/bin/env bash + +python3 setup.py install --single-version-externally-managed --record=record.txt + +mkdir -p $PREFIX/bin + +chmod u+x $SP_DIR/biobb_model/model/mutate.py +cp $SP_DIR/biobb_model/model/mutate.py $PREFIX/bin/mutate + +chmod u+x $SP_DIR/biobb_model/model/fix_side_chain.py +cp $SP_DIR/biobb_model/model/fix_side_chain.py $PREFIX/bin/fix_side_chain diff --git a/recipes/biobb_model/meta.yaml b/recipes/biobb_model/meta.yaml new file mode 100644 index 0000000000000..783ac3cc1ad98 --- /dev/null +++ b/recipes/biobb_model/meta.yaml @@ -0,0 +1,61 @@ +{% set name = "biobb_model" %} +{% set version = "0.0.6" %} +{% set file_ext = "tar.gz" %} +{% set hash_type = "sha256" %} +{% set hash_value = "08a65063de45b6fafe1ccbc85197688c1571aacf1250c9f3a288a3885a2840f0" %} + +package: + name: '{{ name|lower }}' + version: '{{ version }}' + +source: + url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.{{ file_ext }} + '{{ hash_type }}': '{{ hash_value }}' + +build: + number: 0 + noarch: python + +requirements: + host: + - python >=3.5 + - setuptools + - mistune ==0.7.4 + - jsonschema ==2.6.0 + - biobb_common + - biopython + run: + - python >=3.5 + - mistune ==0.7.4 + - jsonschema ==2.6.0 + - biobb_common + - biopython + +test: + imports: + - biobb_model + - biobb_model.model + - biobb_model.pycompss + - biobb_model.pycompss.model + - biobb_model.structure_checking + - biobb_model.structure_manager + - biobb_model.test + +about: + home: https://github.com/bioexcel/biobb_model + license: Apache Software License + license_family: APACHE + license_file: '' + summary: biobb_model is the Biobb module collection to fetch data to be consumed by the rest of the Biobb building blocks. + description: "[![Documentation Status](https://readthedocs.org/projects/biobb-model/badge/?version=latest)](https://biobb-model.readthedocs.io/en/latest/?badge=latest)\n[![Codacy Badge](https://api.codacy.com/project/badge/Grade/f98ed1286f244616bf39352e1877d310)](https://www.codacy.com/app/andriopau/biobb_model?utm_source=github.com&utm_medium=referral&utm_content=bioexcel/biobb_model&utm_campaign=Badge_Grade)\n\ + \n# biobb_model\n\n### Introduction\nBiobb_model is the Biobb module collection to check and model 3d structures,\ncreate mutations or reconstruct missing atoms.\nBiobb (BioExcel building blocks) packages\ + \ are Python building blocks that\ncreate new layer of compatibility and interoperability over popular\nbioinformatics tools.\nThe latest documentation of this package can be found in our readthedocs\ + \ site:\n[latest API documentation](http://biobb_model.readthedocs.io/en/latest/).\n\n### Version\nThis software is in Alpha version.\n\n### Copyright & Licensing\nThis software has been developed in\ + \ the MMB group (http://mmb.irbbarcelona.org) at the\nBSC (http://www.bsc.es/) & IRB (https://www.irbbarcelona.org/) for the European BioExcel (http://bioexcel.eu/), funded by the European Commission\n\ + (EU H2020 [675728](http://cordis.europa.eu/projects/675728)).\n\n* (c) 2015-2018 [Barcelona Supercomputing Center](https://www.bsc.es/)\n* (c) 2015-2018 [Institute for Research in Biomedicine](https://www.irbbarcelona.org/)\n\ + \nLicensed under the\n[Apache License 2.0](https://www.apache.org/licenses/LICENSE-2.0), see the file\n[LICENSE](LICENSE) for details.\n\n![](docs/source/_static/bioexcel_logo.png \"Bioexcel\")\n\n\n" + doc_url: '' + dev_url: '' + +extra: + recipe-maintainers: '' diff --git a/recipes/bioconda-utils/meta.yaml b/recipes/bioconda-utils/meta.yaml index 5b4c94a5e2b59..cea1a83e24b96 100644 --- a/recipes/bioconda-utils/meta.yaml +++ b/recipes/bioconda-utils/meta.yaml @@ -1,5 +1,5 @@ -{% set version = "0.14.3" %} -{% set sha256 = "e7adde87955240b5963c808e77d8166fe85b3068d30d7aac08aca835047f6514" %} +{% set version = "0.14.9" %} +{% set sha256 = "b23f1836f40bcde939dadd3d5ff43af596cb9835c9fffddd9e6d70ec392db4af" %} package: name: bioconda-utils diff --git a/recipes/bioconductor-chromvar/build.sh b/recipes/bioconductor-chromvar/build.sh new file mode 100644 index 0000000000000..da43ce2168312 --- /dev/null +++ b/recipes/bioconductor-chromvar/build.sh @@ -0,0 +1,4 @@ +#!/bin/bash +mv DESCRIPTION DESCRIPTION.old +grep -v '^Priority: ' DESCRIPTION.old > DESCRIPTION +$R CMD INSTALL --build . \ No newline at end of file diff --git a/recipes/bioconductor-chromvar/meta.yaml b/recipes/bioconductor-chromvar/meta.yaml new file mode 100644 index 0000000000000..a473ebd08e3e2 --- /dev/null +++ b/recipes/bioconductor-chromvar/meta.yaml @@ -0,0 +1,76 @@ +{% set version = "1.2.0" %} +{% set name = "chromVAR" %} +{% set bioc = "3.7" %} + +package: + name: 'bioconductor-{{ name|lower }}' + version: '{{ version }}' +source: + url: + - 'http://bioconductor.org/packages/{{ bioc }}/bioc/src/contrib/{{ name }}_{{ version }}.tar.gz' + - 'https://depot.galaxyproject.org/software/{{ name }}/{{ name }}_{{ version }}_src_all.tar.gz' + sha256: 484a08055f35c6c9fbe7963e3e265058664dae8328afd55ccd432912872a627c +build: + number: 0 + rpaths: + - lib/R/lib/ + - lib/ +requirements: + host: + - bioconductor-iranges + - bioconductor-genomicranges + - bioconductor-genomeinfodb + - bioconductor-biocparallel + - bioconductor-biocgenerics + - bioconductor-biostrings + - bioconductor-tfbstools + - bioconductor-rsamtools + - bioconductor-s4vectors + - bioconductor-summarizedexperiment + - bioconductor-bsgenome + - r-essentials + - r-base + - r-ggplot2 + - r-rcpp + - r-rcpparmadillo + - r-rtsne + - r-plotly + - r-shiny + - r-miniui + - r-dt + - r-nabor + run: + - bioconductor-iranges + - bioconductor-genomicranges + - bioconductor-genomeinfodb + - bioconductor-biocparallel + - bioconductor-biocgenerics + - bioconductor-biostrings + - bioconductor-tfbstools + - bioconductor-rsamtools + - bioconductor-s4vectors + - bioconductor-summarizedexperiment + - bioconductor-bsgenome + - r-essentials + - r-base + - r-ggplot2 + - r-rcpp + - r-rcpparmadillo + - r-rtsne + - r-plotly + - r-shiny + - r-miniui + - r-dt + - r-nabor + +test: + commands: + - '$R -e "library(''{{ name }}'')"' +about: + home: 'http://bioconductor.org/packages/{{ bioc }}/bioc/html/{{ name }}.html' + license: GPL-2 + summary: 'Determine variation in chromatin accessibility across sets of annotations or peaks. Designed primarily for single-cell or sparse chromatin accessibility data, e.g. from scATAC-seq or sparse bulk ATAC or DNAse-seq experiments.' + +extra: + identifiers: + - biotools:chromvar diff --git a/recipes/bioconductor-purecn/meta.yaml b/recipes/bioconductor-purecn/meta.yaml index 19769921d3e39..6e01406e1ef97 100644 --- a/recipes/bioconductor-purecn/meta.yaml +++ b/recipes/bioconductor-purecn/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "1.11.13" %} +{% set version = "1.11.20" %} {% set name = "PureCN" %} {% set bioc = "3.7" %} @@ -6,11 +6,11 @@ package: name: 'bioconductor-{{ name|lower }}' version: '{{ version }}' source: - url: https://github.com/lima1/PureCN/archive/3f5ad5e.tar.gz + url: https://github.com/lima1/PureCN/archive/cdd2df3.tar.gz #url: https://depot.galaxyproject.org/software/bioconductor-purecn/bioconductor-purecn_{{ version }}_src_all.tar.gz - sha256: b84b4c7a98afe66bdde2987505dbae4a7b4ca9c0c21171879b319104545283b4 + sha256: 711861830f36d74f3db8d43aad7dd6e9c3aaaceaec28677cf29ad72643730863 build: - number: 1 + number: 2 rpaths: - lib/R/lib/ - lib/ diff --git a/recipes/bioconductor-rnaseqsamplesize/build.sh b/recipes/bioconductor-rnaseqsamplesize/build.sh new file mode 100644 index 0000000000000..da43ce2168312 --- /dev/null +++ b/recipes/bioconductor-rnaseqsamplesize/build.sh @@ -0,0 +1,4 @@ +#!/bin/bash +mv DESCRIPTION DESCRIPTION.old +grep -v '^Priority: ' DESCRIPTION.old > DESCRIPTION +$R CMD INSTALL --build . \ No newline at end of file diff --git a/recipes/bioconductor-rnaseqsamplesize/meta.yaml b/recipes/bioconductor-rnaseqsamplesize/meta.yaml new file mode 100644 index 0000000000000..82a5600e9ad30 --- /dev/null +++ b/recipes/bioconductor-rnaseqsamplesize/meta.yaml @@ -0,0 +1,42 @@ +{% set version = "1.12.0" %} +{% set name = "RnaSeqSampleSize" %} +{% set bioc = "3.6" %} + +package: + name: 'bioconductor-{{ name|lower }}' + version: '{{ version }}' +source: + url: + - 'https://bioconductor.org/packages/release/bioc/src/contrib/RnaSeqSampleSize_{{ version }}.tar.gz' + - 'https://bioarchive.galaxyproject.org/{{ name }}_{{ version }}.tar.gz' + - 'https://depot.galaxyproject.org/software/bioconductor-{{ name|lower }}/bioconductor-{{ name|lower }}_{{ version }}_src_all.tar.gz' + sha256: 60a3afc79a4ca2531adab6ea712a6ff6d5336ac24205036ffabfe8124a8b6202 +build: + number: 2 + rpaths: + - lib/R/lib/ + - lib/ +requirements: + host: + - bioconductor-edgeR + - bioconductor-rnaseqsamplesizedata + - bioconductor-biomart + - r-heatmap3 + - r-matlab + - bioconductor-keggrest + - r-base + run: + - bioconductor-edgeR + - bioconductor-rnaseqsamplesizedata + - bioconductor-biomart + - r-heatmap3 + - r-matlab + - bioconductor-keggrest + - r-base +test: + commands: + - '$R -e "library(''{{ name }}'')"' +about: + home: 'http://bioconductor.org/packages/{{ bioc }}/bioc/html/{{ name }}.html' + license: 'GPL-2' + summary: 'RnaSeqSampleSize package provides a sample size calculation method based on negative binomial model and the exact test for assessing differential expression analysis of RNA-seq data.' diff --git a/recipes/bioconductor-rnaseqsamplesizedata/build.sh b/recipes/bioconductor-rnaseqsamplesizedata/build.sh new file mode 100644 index 0000000000000..da43ce2168312 --- /dev/null +++ b/recipes/bioconductor-rnaseqsamplesizedata/build.sh @@ -0,0 +1,4 @@ +#!/bin/bash +mv DESCRIPTION DESCRIPTION.old +grep -v '^Priority: ' DESCRIPTION.old > DESCRIPTION +$R CMD INSTALL --build . \ No newline at end of file diff --git a/recipes/bioconductor-rnaseqsamplesizedata/meta.yaml b/recipes/bioconductor-rnaseqsamplesizedata/meta.yaml new file mode 100644 index 0000000000000..8d91f97281f0c --- /dev/null +++ b/recipes/bioconductor-rnaseqsamplesizedata/meta.yaml @@ -0,0 +1,32 @@ +{% set version = "1.12.0" %} +{% set name = "RnaSeqSampleSizeData" %} +{% set bioc = "3.6" %} + +package: + name: 'bioconductor-{{ name|lower }}' + version: '{{ version }}' +source: + url: + - 'http://bioconductor.org/packages/release/data/experiment/src/contrib/RnaSeqSampleSizeData_{{ version }}.tar.gz' + - 'https://bioarchive.galaxyproject.org/{{ name }}_{{ version }}.tar.gz' + - 'https://depot.galaxyproject.org/software/bioconductor-{{ name|lower }}/bioconductor-{{ name|lower }}_{{ version }}_src_all.tar.gz' + sha256: 1ee146d3992f06e442aad427bc8c0fd8b10991c2763dbed1638094832c2b0fcb +build: + number: 1 + rpaths: + - lib/R/lib/ + - lib/ +requirements: + host: + - bioconductor-edgeR + - r-base + run: + - bioconductor-edgeR + - r-base +test: + commands: + - '$R -e "library(''{{ name }}'')"' +about: + home: 'http://bioconductor.org/packages/{{ bioc }}/bioc/html/{{ name }}.html' + license: 'GPLv2' + summary: 'RnaSeqSampleSizeData: Read counts and dispersion distribution from real data for sample size estimation of RNA-seq experiments' diff --git a/recipes/bioconductor-sc3-scripts/build.sh b/recipes/bioconductor-sc3-scripts/build.sh index 1ea13716f2880..0bb9dc2aa294d 100644 --- a/recipes/bioconductor-sc3-scripts/build.sh +++ b/recipes/bioconductor-sc3-scripts/build.sh @@ -3,3 +3,4 @@ mkdir -p $PREFIX/bin cp *.R $PREFIX/bin cp *.sh $PREFIX/bin +cp *.bats $PREFIX/bin diff --git a/recipes/bioconductor-sc3-scripts/meta.yaml b/recipes/bioconductor-sc3-scripts/meta.yaml index 443f1430b933c..fe27e9f2a5bc6 100644 --- a/recipes/bioconductor-sc3-scripts/meta.yaml +++ b/recipes/bioconductor-sc3-scripts/meta.yaml @@ -9,18 +9,22 @@ source: sha256: 933cfb14c0a98251dab7eb2214f5c49b75b450240b88a5863fb1c1f1b062f4e7 build: - number: 0 + number: 1 noarch: generic requirements: + host: + - r-base 3.4.1 run: - - r-base + - r-base 3.4.1 - r-optparse - r-workflowscriptscommon - bioconductor-biobase - - bioconductor-scater=1.6.0 + - bioconductor-scater 1.6.0 - bioconductor-singlecellexperiment-scripts - bioconductor-scater-scripts + - bioconductor-sc3 1.7.6 + test: commands: - sc3-sc3-prepare.R --help diff --git a/recipes/bioconductor-scater-scripts/build.sh b/recipes/bioconductor-scater-scripts/build.sh index 1ea13716f2880..0bb9dc2aa294d 100644 --- a/recipes/bioconductor-scater-scripts/build.sh +++ b/recipes/bioconductor-scater-scripts/build.sh @@ -3,3 +3,4 @@ mkdir -p $PREFIX/bin cp *.R $PREFIX/bin cp *.sh $PREFIX/bin +cp *.bats $PREFIX/bin diff --git a/recipes/bioconductor-scater-scripts/meta.yaml b/recipes/bioconductor-scater-scripts/meta.yaml index b4defbb6e64e7..a2702ed146784 100644 --- a/recipes/bioconductor-scater-scripts/meta.yaml +++ b/recipes/bioconductor-scater-scripts/meta.yaml @@ -10,15 +10,15 @@ source: requirements: run: - - r-base + - r-base 3.4.1 - r-optparse - r-workflowscriptscommon - bioconductor-biobase - - bioconductor-scater>=1.6.0 + - bioconductor-scater 1.6.0 - bioconductor-singlecellexperiment-scripts build: - number: 0 + number: 1 noarch: generic test: diff --git a/recipes/bioconductor-snpstats/build.sh b/recipes/bioconductor-snpstats/build.sh index da43ce2168312..32bc29aa16362 100644 --- a/recipes/bioconductor-snpstats/build.sh +++ b/recipes/bioconductor-snpstats/build.sh @@ -1,4 +1,6 @@ #!/bin/bash + mv DESCRIPTION DESCRIPTION.old grep -v '^Priority: ' DESCRIPTION.old > DESCRIPTION -$R CMD INSTALL --build . \ No newline at end of file + +$R CMD INSTALL --build . diff --git a/recipes/bioconductor-snpstats/meta.yaml b/recipes/bioconductor-snpstats/meta.yaml index 11bb61239371e..254d4206a503f 100644 --- a/recipes/bioconductor-snpstats/meta.yaml +++ b/recipes/bioconductor-snpstats/meta.yaml @@ -1,21 +1,24 @@ {% set version = "1.30.0" %} {% set name = "snpStats" %} {% set bioc = "3.7" %} +{% set sha256 = "7a2d19beee640bba9f48f8c13d9ca69f5be3085c2b280c0ce2711450ad7bcd47" %} package: name: 'bioconductor-{{ name|lower }}' version: '{{ version }}' + source: url: - 'http://bioconductor.org/packages/{{ bioc }}/bioc/src/contrib/{{ name }}_{{ version }}.tar.gz' - - 'https://bioarchive.galaxyproject.org/{{ name }}_{{ version }}.tar.gz' - - 'https://depot.galaxyproject.org/software/bioconductor-{{ name|lower }}/bioconductor-{{ name|lower }}_{{ version }}_src_all.tar.gz' - sha256: 7a2d19beee640bba9f48f8c13d9ca69f5be3085c2b280c0ce2711450ad7bcd47 + - 'https://depot.galaxyproject.org/software/{{ name }}/{{ name }}_{{ version }}_src_all.tar.gz' + sha256: {{ sha256 }} + build: number: 0 rpaths: - lib/R/lib/ - lib/ + requirements: host: - 'bioconductor-biocgenerics >=0.26.0,<0.28.0' diff --git a/recipes/bioconductor-tissueenrich/conda_build_config.yaml b/recipes/bioconductor-tissueenrich/conda_build_config.yaml new file mode 100644 index 0000000000000..d3da287204f8d --- /dev/null +++ b/recipes/bioconductor-tissueenrich/conda_build_config.yaml @@ -0,0 +1,2 @@ +r_base: + - 3.5.1 diff --git a/recipes/bioconductor-titancna/build.sh b/recipes/bioconductor-titancna/build.sh index da43ce2168312..3deb50a9e84ed 100644 --- a/recipes/bioconductor-titancna/build.sh +++ b/recipes/bioconductor-titancna/build.sh @@ -1,4 +1,22 @@ #!/bin/bash mv DESCRIPTION DESCRIPTION.old grep -v '^Priority: ' DESCRIPTION.old > DESCRIPTION -$R CMD INSTALL --build . \ No newline at end of file +$R CMD INSTALL --build . + +outdir=$PREFIX/share/$PKG_NAME-$PKG_VERSION-$PKG_BUILDNUM +mkdir -p $outdir/scripts/R_scripts +mkdir -p $outdir/data +mkdir -p $PREFIX/bin + +perl -pi -e 'print "#!/opt/anaconda1anaconda2anaconda3/bin/Rscript\n" if $. == 1' scripts/R_scripts/selectSolution.R +sed -i.bak 's:/usr/bin/env Rscript:/opt/anaconda1anaconda2anaconda3/bin/Rscript:' scripts/R_scripts/titanCNA.R + +mv scripts/R_scripts/selectSolution.R $outdir/scripts/R_scripts/titanCNA_selectSolution.R +mv scripts/R_scripts/titanCNA.R $outdir/scripts/R_scripts/titanCNA.R + +chmod a+x $outdir/scripts/R_scripts/*.R +ln -s $outdir/scripts/R_scripts/titanCNA.R $PREFIX/bin +ln -s $outdir/scripts/R_scripts/titanCNA_selectSolution.R $PREFIX/bin + +# Retrieve external data we want to link into the run +wget --no-check-certificate -O $outdir/data/cytoBand_hg38.txt https://raw.githubusercontent.com/broadinstitute/ichorCNA/master/inst/extdata/cytoBand_hg38.txt diff --git a/recipes/bioconductor-titancna/meta.yaml b/recipes/bioconductor-titancna/meta.yaml index b3057639b1d14..e0065357c55e1 100644 --- a/recipes/bioconductor-titancna/meta.yaml +++ b/recipes/bioconductor-titancna/meta.yaml @@ -1,41 +1,43 @@ -{% set version = "1.18.0" %} -{% set name = "TitanCNA" %} -{% set bioc = "3.7" %} +{% set version="1.19.1" %} +{% set name="TitanCNA" %} +{% set bioc="3.6" %} package: name: 'bioconductor-{{ name|lower }}' version: '{{ version }}' source: - url: - - 'http://bioconductor.org/packages/{{ bioc }}/bioc/src/contrib/{{ name }}_{{ version }}.tar.gz' - - 'https://bioarchive.galaxyproject.org/{{ name }}_{{ version }}.tar.gz' - - 'https://depot.galaxyproject.org/software/bioconductor-{{ name|lower }}/bioconductor-{{ name|lower }}_{{ version }}_src_all.tar.gz' - sha256: 2f74aa30f125b2b3e52774964d3da6fdf374eae2c7e419e80fa9d5fd1a19e677 + url: https://github.com/gavinha/TitanCNA/archive/eb288ea.tar.gz + # - 'http://bioconductor.org/packages/{{ bioc }}/bioc/src/contrib/{{ name }}_{{ version }}.tar.gz' + # - 'https://bioarchive.galaxyproject.org/{{ name }}_{{ version }}.tar.gz' + # - 'https://depot.galaxyproject.org/software/{{ name }}/{{ name }}_{{ version }}_src_all.tar.gz' + sha256: 6cb5349fedb9d6ab70b2c13b46eb9d83b12604f2b7d0ae0d8d91e62e6543897d build: - number: 0 + number: 2 rpaths: - lib/R/lib/ - lib/ requirements: host: - - 'bioconductor-genomeinfodb >=1.16.0,<1.18.0' - - 'bioconductor-genomicranges >=1.32.7,<1.34.0' - - 'bioconductor-iranges >=2.14.12,<2.16.0' - - 'bioconductor-rsamtools >=1.32.3,<1.34.0' - - 'bioconductor-variantannotation >=1.26.1,<1.28.0' - - r-base - - 'r-data.table >=1.10.4' - - 'r-dplyr >=0.5.0' + - perl # for adding in correct path references to scripts + - 'bioconductor-genomeinfodb >=1.8.7' + - 'bioconductor-genomicranges >=1.24.3' + - 'bioconductor-iranges >=2.6.1' + - 'bioconductor-rsamtools >=1.20.4' + - 'bioconductor-variantannotation >=1.18.7' - 'r-foreach >=1.4.3' + - r-data.table + - r-dplyr + - r-optparse + - r-domc + - bioconductor-snpchip + - r-stringr run: - - 'bioconductor-genomeinfodb >=1.16.0,<1.18.0' - - 'bioconductor-genomicranges >=1.32.7,<1.34.0' - - 'bioconductor-iranges >=2.14.12,<2.16.0' - - 'bioconductor-rsamtools >=1.32.3,<1.34.0' - - 'bioconductor-variantannotation >=1.26.1,<1.28.0' - - r-base - - 'r-data.table >=1.10.4' - - 'r-dplyr >=0.5.0' + - r-base 3.4.1 + - 'bioconductor-genomeinfodb >=1.8.7' + - 'bioconductor-genomicranges >=1.24.3' + - 'bioconductor-iranges >=2.6.1' + - 'bioconductor-rsamtools >=1.24.0' + - 'bioconductor-variantannotation >=1.18.7' - 'r-foreach >=1.4.3' build: - {{ compiler('c') }} diff --git a/recipes/biopet-bamstats/1.0.1/biopet-bamstats.py b/recipes/biopet-bamstats/1.0.1/biopet-bamstats.py new file mode 100755 index 0000000000000..b79e237aa9e48 --- /dev/null +++ b/recipes/biopet-bamstats/1.0.1/biopet-bamstats.py @@ -0,0 +1,107 @@ +#!/usr/bin/env python +# +# Wrapper script for starting the biopet-bamstats JAR package +# +# This script is written for use with the Conda package manager and is copied +# from the peptide-shaker wrapper. Only the parameters are changed. +# (https://github.com/bioconda/bioconda-recipes/blob/master/recipes/peptide-shaker/peptide-shaker.py) +# +# This file was automatically generated by the sbt-bioconda plugin. + +import os +import subprocess +import sys +import shutil + +from os import access +from os import getenv +from os import X_OK + +jar_file = 'BamStats-assembly-1.0.1.jar' + +default_jvm_mem_opts = [] + +# !!! End of parameter section. No user-serviceable code below this line !!! + + +def real_dirname(path): + """Return the symlink-resolved, canonicalized directory-portion of path.""" + return os.path.dirname(os.path.realpath(path)) + + +def java_executable(): + """Return the executable name of the Java interpreter.""" + java_home = getenv('JAVA_HOME') + java_bin = os.path.join('bin', 'java') + + if java_home and access(os.path.join(java_home, java_bin), X_OK): + return os.path.join(java_home, java_bin) + else: + return 'java' + + +def jvm_opts(argv): + """Construct list of Java arguments based on our argument list. + + The argument list passed in argv must not include the script name. + The return value is a 3-tuple lists of strings of the form: + (memory_options, prop_options, passthrough_options) + """ + mem_opts = [] + prop_opts = [] + pass_args = [] + exec_dir = None + + for arg in argv: + if arg.startswith('-D'): + prop_opts.append(arg) + elif arg.startswith('-XX'): + prop_opts.append(arg) + elif arg.startswith('-Xm'): + mem_opts.append(arg) + elif arg.startswith('--exec_dir='): + exec_dir = arg.split('=')[1].strip('"').strip("'") + if not os.path.exists(exec_dir): + shutil.copytree(real_dirname(sys.argv[0]), exec_dir, symlinks=False, ignore=None) + else: + pass_args.append(arg) + + # In the original shell script the test coded below read: + # if [ "$jvm_mem_opts" == "" ] && [ -z ${_JAVA_OPTIONS+x} ] + # To reproduce the behaviour of the above shell code fragment + # it is important to explictly check for equality with None + # in the second condition, so a null envar value counts as True! + + if mem_opts == [] and getenv('_JAVA_OPTIONS') is None: + mem_opts = default_jvm_mem_opts + + return (mem_opts, prop_opts, pass_args, exec_dir) + + +def main(): + """ + PeptideShaker updates files relative to the path of the jar file. + In a multiuser setting, the option --exec_dir="exec_dir" + can be used as the location for the peptide-shaker distribution. + If the exec_dir dies not exist, + we copy the jar file, lib, and resources to the exec_dir directory. + """ + java = java_executable() + (mem_opts, prop_opts, pass_args, exec_dir) = jvm_opts(sys.argv[1:]) + jar_dir = exec_dir if exec_dir else real_dirname(sys.argv[0]) + + if pass_args != [] and pass_args[0].startswith('eu'): + jar_arg = '-cp' + else: + jar_arg = '-jar' + + jar_path = os.path.join(jar_dir, jar_file) + + java_args = [java] + mem_opts + prop_opts + [jar_arg] + [jar_path] + pass_args + + sys.exit(subprocess.call(java_args)) + + +if __name__ == '__main__': + main() + diff --git a/recipes/biopet-bamstats/1.0.1/build.sh b/recipes/biopet-bamstats/1.0.1/build.sh new file mode 100644 index 0000000000000..1ddf61f912e20 --- /dev/null +++ b/recipes/biopet-bamstats/1.0.1/build.sh @@ -0,0 +1,12 @@ +#!/usr/bin/env bash +# Build file is copied from VarScan +# https://github.com/bioconda/bioconda-recipes/blob/master/recipes/varscan/build.sh +# This file was automatically generated by the sbt-bioconda plugin. + +outdir=$PREFIX/share/$PKG_NAME +mkdir -p $outdir +mkdir -p $PREFIX/bin +cp BamStats-assembly-1.0.1.jar $outdir/BamStats-assembly-1.0.1.jar +cp $RECIPE_DIR/biopet-bamstats.py $outdir/biopet-bamstats +ln -s $outdir/biopet-bamstats $PREFIX/bin + diff --git a/recipes/biopet-bamstats/1.0.1/meta.yaml b/recipes/biopet-bamstats/1.0.1/meta.yaml new file mode 100644 index 0000000000000..e1aeaba4e216d --- /dev/null +++ b/recipes/biopet-bamstats/1.0.1/meta.yaml @@ -0,0 +1,69 @@ +# !! THIS FILE WAS AUTOMATICALLY GENERATED BY THE SBT-BIOCONDA PLUGIN !! +# !! DO NOT EDIT MANUALLY !! + +package: + name: biopet-bamstats + version: 1.0.1 +source: + url: https://github.com/biopet/bamstats/releases/download/v1.0.1/BamStats-assembly-1.0.1.jar + sha256: ab1beffd8a5a51e2937cb5efa190d6e57fb8e63d6b19a92e8e83d7db2a9b839e +build: + noarch: generic + number: 0 +requirements: + run: + - openjdk >=8,<9 + - python +about: + home: https://github.com/biopet/bamstats + license: MIT + summary: BamStats is a package that contains tools to generate stats from a BAM file, merge those stats for multiple samples, and validate the generated stats files. + description: | + BamStats is a package that contains tools + to generate stats from a BAM file, + merge those stats for multiple samples, + and validate the generated stats files. + + + #### Mode - Generate + + Generate reports clipping stats, flag stats, insert size and mapping quality on a BAM file. It outputs + a JSON file, but can optionally also output in TSV format. + + The output of the JSON file is organized in a sample - library - readgroup tree structure. + If readgroups in the BAM file are not annotated with sample (`SM`) and library (`LB`) tags + an error will be thrown. + This can be fixed by using `samtools addreplacerg` or `picard AddOrReplaceReadGroups`. + + + #### Mode - Merge + + This module will merge bamstats files together and keep the sample/library/readgroup structure. + Values for the same readgroups will be added. + It will also validate the resulting file. + + + #### Mode - Validate + + Validates a BamStats file. + If aggregation values can not be regenerated the file is considered corrupt. + This should only happen when the file has been manually edited. + + For documentation and manuals visit our github.io page: https://biopet.github.io/bamstats +test: + commands: + - biopet-bamstats merge --help + - biopet-bamstats merge --version + - biopet-bamstats validate --help + - biopet-bamstats validate --version + - biopet-bamstats generate --help + - biopet-bamstats generate --version +extra: + notes: | + biopet-bamstats is a Java program that comes with a custom wrapper shell script. + By default 'no default java option' is set in the wrapper. + The command that runs the program is 'biopet-bamstats'. + If you want to overwrite it you can specify memory options directly after your binaries. + If you have _JAVA_OPTIONS set globally this will take precedence. + For example run it with 'biopet-bamstats -Xms512m -Xmx1g'. + diff --git a/recipes/biopet-bamstats/biopet-bamstats.py b/recipes/biopet-bamstats/biopet-bamstats.py index 3cc4bc65ed8c4..b79e237aa9e48 100755 --- a/recipes/biopet-bamstats/biopet-bamstats.py +++ b/recipes/biopet-bamstats/biopet-bamstats.py @@ -17,7 +17,7 @@ from os import getenv from os import X_OK -jar_file = 'BamStats-assembly-1.0.jar' +jar_file = 'BamStats-assembly-1.0.1.jar' default_jvm_mem_opts = [] diff --git a/recipes/biopet-bamstats/build.sh b/recipes/biopet-bamstats/build.sh index b56a722bf0e09..1ddf61f912e20 100644 --- a/recipes/biopet-bamstats/build.sh +++ b/recipes/biopet-bamstats/build.sh @@ -6,7 +6,7 @@ outdir=$PREFIX/share/$PKG_NAME mkdir -p $outdir mkdir -p $PREFIX/bin -cp BamStats-assembly-1.0.jar $outdir/BamStats-assembly-1.0.jar +cp BamStats-assembly-1.0.1.jar $outdir/BamStats-assembly-1.0.1.jar cp $RECIPE_DIR/biopet-bamstats.py $outdir/biopet-bamstats ln -s $outdir/biopet-bamstats $PREFIX/bin diff --git a/recipes/biopet-bamstats/meta.yaml b/recipes/biopet-bamstats/meta.yaml index 1ad4d63ce4843..e1aeaba4e216d 100644 --- a/recipes/biopet-bamstats/meta.yaml +++ b/recipes/biopet-bamstats/meta.yaml @@ -3,10 +3,10 @@ package: name: biopet-bamstats - version: '1.0' + version: 1.0.1 source: - url: https://github.com/biopet/bamstats/releases/download/v1.0/BamStats-assembly-1.0.jar - sha256: 5e4734aaef861779c8ce99b86b0e92e6103533f3c93fd2d22ef6bb08be26f97b + url: https://github.com/biopet/bamstats/releases/download/v1.0.1/BamStats-assembly-1.0.1.jar + sha256: ab1beffd8a5a51e2937cb5efa190d6e57fb8e63d6b19a92e8e83d7db2a9b839e build: noarch: generic number: 0 diff --git a/recipes/biopet-sampleconfig/0.3/biopet-sampleconfig.py b/recipes/biopet-sampleconfig/0.3/biopet-sampleconfig.py new file mode 100755 index 0000000000000..a9397631cd6d1 --- /dev/null +++ b/recipes/biopet-sampleconfig/0.3/biopet-sampleconfig.py @@ -0,0 +1,107 @@ +#!/usr/bin/env python +# +# Wrapper script for starting the biopet-sampleconfig JAR package +# +# This script is written for use with the Conda package manager and is copied +# from the peptide-shaker wrapper. Only the parameters are changed. +# (https://github.com/bioconda/bioconda-recipes/blob/master/recipes/peptide-shaker/peptide-shaker.py) +# +# This file was automatically generated by the sbt-bioconda plugin. + +import os +import subprocess +import sys +import shutil + +from os import access +from os import getenv +from os import X_OK + +jar_file = 'SampleConfig-assembly-0.3.jar' + +default_jvm_mem_opts = [] + +# !!! End of parameter section. No user-serviceable code below this line !!! + + +def real_dirname(path): + """Return the symlink-resolved, canonicalized directory-portion of path.""" + return os.path.dirname(os.path.realpath(path)) + + +def java_executable(): + """Return the executable name of the Java interpreter.""" + java_home = getenv('JAVA_HOME') + java_bin = os.path.join('bin', 'java') + + if java_home and access(os.path.join(java_home, java_bin), X_OK): + return os.path.join(java_home, java_bin) + else: + return 'java' + + +def jvm_opts(argv): + """Construct list of Java arguments based on our argument list. + + The argument list passed in argv must not include the script name. + The return value is a 3-tuple lists of strings of the form: + (memory_options, prop_options, passthrough_options) + """ + mem_opts = [] + prop_opts = [] + pass_args = [] + exec_dir = None + + for arg in argv: + if arg.startswith('-D'): + prop_opts.append(arg) + elif arg.startswith('-XX'): + prop_opts.append(arg) + elif arg.startswith('-Xm'): + mem_opts.append(arg) + elif arg.startswith('--exec_dir='): + exec_dir = arg.split('=')[1].strip('"').strip("'") + if not os.path.exists(exec_dir): + shutil.copytree(real_dirname(sys.argv[0]), exec_dir, symlinks=False, ignore=None) + else: + pass_args.append(arg) + + # In the original shell script the test coded below read: + # if [ "$jvm_mem_opts" == "" ] && [ -z ${_JAVA_OPTIONS+x} ] + # To reproduce the behaviour of the above shell code fragment + # it is important to explictly check for equality with None + # in the second condition, so a null envar value counts as True! + + if mem_opts == [] and getenv('_JAVA_OPTIONS') is None: + mem_opts = default_jvm_mem_opts + + return (mem_opts, prop_opts, pass_args, exec_dir) + + +def main(): + """ + PeptideShaker updates files relative to the path of the jar file. + In a multiuser setting, the option --exec_dir="exec_dir" + can be used as the location for the peptide-shaker distribution. + If the exec_dir dies not exist, + we copy the jar file, lib, and resources to the exec_dir directory. + """ + java = java_executable() + (mem_opts, prop_opts, pass_args, exec_dir) = jvm_opts(sys.argv[1:]) + jar_dir = exec_dir if exec_dir else real_dirname(sys.argv[0]) + + if pass_args != [] and pass_args[0].startswith('eu'): + jar_arg = '-cp' + else: + jar_arg = '-jar' + + jar_path = os.path.join(jar_dir, jar_file) + + java_args = [java] + mem_opts + prop_opts + [jar_arg] + [jar_path] + pass_args + + sys.exit(subprocess.call(java_args)) + + +if __name__ == '__main__': + main() + diff --git a/recipes/biopet-sampleconfig/0.3/build.sh b/recipes/biopet-sampleconfig/0.3/build.sh new file mode 100644 index 0000000000000..fb5f77d0eed99 --- /dev/null +++ b/recipes/biopet-sampleconfig/0.3/build.sh @@ -0,0 +1,12 @@ +#!/usr/bin/env bash +# Build file is copied from VarScan +# https://github.com/bioconda/bioconda-recipes/blob/master/recipes/varscan/build.sh +# This file was automatically generated by the sbt-bioconda plugin. + +outdir=$PREFIX/share/$PKG_NAME +mkdir -p $outdir +mkdir -p $PREFIX/bin +cp SampleConfig-assembly-0.3.jar $outdir/SampleConfig-assembly-0.3.jar +cp $RECIPE_DIR/biopet-sampleconfig.py $outdir/biopet-sampleconfig +ln -s $outdir/biopet-sampleconfig $PREFIX/bin + diff --git a/recipes/biopet-sampleconfig/0.3/meta.yaml b/recipes/biopet-sampleconfig/0.3/meta.yaml new file mode 100644 index 0000000000000..7d20894eb35a3 --- /dev/null +++ b/recipes/biopet-sampleconfig/0.3/meta.yaml @@ -0,0 +1,63 @@ +# !! THIS FILE WAS AUTOMATICALLY GENERATED BY THE SBT-BIOCONDA PLUGIN !! +# !! DO NOT EDIT MANUALLY !! + +package: + name: biopet-sampleconfig + version: '0.3' +source: + url: https://github.com/biopet/sampleconfig/releases/download/v0.3/SampleConfig-assembly-0.3.jar + sha256: f14655c26e5208a82d6a27fedef77b8961bc47eb3b9fdaa61ba67d60b282af7f +build: + noarch: generic + number: 0 +requirements: + run: + - openjdk >=8,<9 + - python +about: + home: https://github.com/biopet/sampleconfig + license: MIT + summary: '#### Tools - ExtractTsv This mean can extract samples, libraries and + readgroups from a sample config file.' + description: | + #### Tools - ExtractTsv + + This mean can extract samples, libraries and readgroups from a sample config file. This meant as a supporting tool inside wdl pipelines. + It can also output a single layer as tsv file. + + + #### Tools - ReadFromTsv + + This tool enables a user to create a full sample sheet in JSON format or + YAML format, suitable for all Biopet Queue pipelines, from TSV file(s). + + + #### Tools - CromwellArrays + + This tool will convert the sample configs to a array based format that can be used inside wdl pipelines. + This tool is only to support biowdl pipelines. + + + #### Tools - CaseControl + + This tool will extract the case-control pairs from a sample config file. + It will read the headers of the bam files to confirm that samples do exist. + + For documentation and manuals visit our github.io page: https://biopet.github.io/sampleconfig +test: + commands: + - biopet-sampleconfig ExtractTsv --version + - biopet-sampleconfig ExtractTsv --help + - biopet-sampleconfig ReadFromTsv --version + - biopet-sampleconfig ReadFromTsv --help + - biopet-sampleconfig CromwellArrays --version + - biopet-sampleconfig CromwellArrays --help +extra: + notes: | + biopet-sampleconfig is a Java program that comes with a custom wrapper shell script. + By default 'no default java option' is set in the wrapper. + The command that runs the program is 'biopet-sampleconfig'. + If you want to overwrite it you can specify memory options directly after your binaries. + If you have _JAVA_OPTIONS set globally this will take precedence. + For example run it with 'biopet-sampleconfig -Xms512m -Xmx1g'. + diff --git a/recipes/biopet-sampleconfig/biopet-sampleconfig.py b/recipes/biopet-sampleconfig/biopet-sampleconfig.py index 719741a852df7..a9397631cd6d1 100755 --- a/recipes/biopet-sampleconfig/biopet-sampleconfig.py +++ b/recipes/biopet-sampleconfig/biopet-sampleconfig.py @@ -17,7 +17,7 @@ from os import getenv from os import X_OK -jar_file = 'SampleConfig-assembly-0.2.jar' +jar_file = 'SampleConfig-assembly-0.3.jar' default_jvm_mem_opts = [] diff --git a/recipes/biopet-sampleconfig/build.sh b/recipes/biopet-sampleconfig/build.sh index 41b2504552679..fb5f77d0eed99 100644 --- a/recipes/biopet-sampleconfig/build.sh +++ b/recipes/biopet-sampleconfig/build.sh @@ -3,10 +3,10 @@ # https://github.com/bioconda/bioconda-recipes/blob/master/recipes/varscan/build.sh # This file was automatically generated by the sbt-bioconda plugin. -outdir=$PREFIX/share/$PKG_NAME-$PKG_VERSION-$PKG_BUILDNUM +outdir=$PREFIX/share/$PKG_NAME mkdir -p $outdir mkdir -p $PREFIX/bin -cp SampleConfig-assembly-0.2.jar $outdir/SampleConfig-assembly-0.2.jar +cp SampleConfig-assembly-0.3.jar $outdir/SampleConfig-assembly-0.3.jar cp $RECIPE_DIR/biopet-sampleconfig.py $outdir/biopet-sampleconfig ln -s $outdir/biopet-sampleconfig $PREFIX/bin diff --git a/recipes/biopet-sampleconfig/meta.yaml b/recipes/biopet-sampleconfig/meta.yaml index 4fdb9436a73f2..7d20894eb35a3 100644 --- a/recipes/biopet-sampleconfig/meta.yaml +++ b/recipes/biopet-sampleconfig/meta.yaml @@ -3,10 +3,10 @@ package: name: biopet-sampleconfig - version: '0.2' + version: '0.3' source: - url: https://github.com/biopet/sampleconfig/releases/download/v0.2/SampleConfig-assembly-0.2.jar - sha256: 2c5c3e9e865946cf6f3f41ce1b91ca2cb562c0a3eb08bec92a5a68402817c3ac + url: https://github.com/biopet/sampleconfig/releases/download/v0.3/SampleConfig-assembly-0.3.jar + sha256: f14655c26e5208a82d6a27fedef77b8961bc47eb3b9fdaa61ba67d60b282af7f build: noarch: generic number: 0 @@ -19,15 +19,31 @@ about: license: MIT summary: '#### Tools - ExtractTsv This mean can extract samples, libraries and readgroups from a sample config file.' - description: "#### Tools - ExtractTsv\n\nThis mean can extract samples, libraries\ - \ and readgroups from a sample config file. This meant as a supporting tool inside\ - \ wdl pipelines.\nIt can also output a single layer as tsv file.\n \n \ - \ \n\n#### Tools - ReadFromTsv\n\nThis tool enables a user to create a full\ - \ sample sheet in JSON format or\nYAML format, suitable for all Biopet Queue pipelines,\ - \ from TSV file(s).\n \n \n\n#### Tools - CromwellArrays\n\nThis tool\ - \ will convert the sample configs to a array based format that can be used inside\ - \ wdl pipelines.\nThis tool is only to support biowdl pipelines.\n\nFor documentation\ - \ and manuals visit our github.io page: https://biopet.github.io/sampleconfig" + description: | + #### Tools - ExtractTsv + + This mean can extract samples, libraries and readgroups from a sample config file. This meant as a supporting tool inside wdl pipelines. + It can also output a single layer as tsv file. + + + #### Tools - ReadFromTsv + + This tool enables a user to create a full sample sheet in JSON format or + YAML format, suitable for all Biopet Queue pipelines, from TSV file(s). + + + #### Tools - CromwellArrays + + This tool will convert the sample configs to a array based format that can be used inside wdl pipelines. + This tool is only to support biowdl pipelines. + + + #### Tools - CaseControl + + This tool will extract the case-control pairs from a sample config file. + It will read the headers of the bam files to confirm that samples do exist. + + For documentation and manuals visit our github.io page: https://biopet.github.io/sampleconfig test: commands: - biopet-sampleconfig ExtractTsv --version @@ -37,10 +53,11 @@ test: - biopet-sampleconfig CromwellArrays --version - biopet-sampleconfig CromwellArrays --help extra: - notes: 'biopet-sampleconfig is a Java program that comes with a custom wrapper shell - script. By default ''no default java option'' is set in the wrapper. The command - that runs the program is ''biopet-sampleconfig''. If you want to overwrite it - you can specify memory options directly after your binaries. If you have _JAVA_OPTIONS - set globally this will take precedence. For example run it with ''biopet-sampleconfig - -Xms512m -Xmx1g''. ' + notes: | + biopet-sampleconfig is a Java program that comes with a custom wrapper shell script. + By default 'no default java option' is set in the wrapper. + The command that runs the program is 'biopet-sampleconfig'. + If you want to overwrite it you can specify memory options directly after your binaries. + If you have _JAVA_OPTIONS set globally this will take precedence. + For example run it with 'biopet-sampleconfig -Xms512m -Xmx1g'. diff --git a/recipes/biopet-scatterregions/0.2/biopet-scatterregions.py b/recipes/biopet-scatterregions/0.2/biopet-scatterregions.py new file mode 100755 index 0000000000000..7bb58753e611f --- /dev/null +++ b/recipes/biopet-scatterregions/0.2/biopet-scatterregions.py @@ -0,0 +1,107 @@ +#!/usr/bin/env python +# +# Wrapper script for starting the biopet-scatterregions JAR package +# +# This script is written for use with the Conda package manager and is copied +# from the peptide-shaker wrapper. Only the parameters are changed. +# (https://github.com/bioconda/bioconda-recipes/blob/master/recipes/peptide-shaker/peptide-shaker.py) +# +# This file was automatically generated by the sbt-bioconda plugin. + +import os +import subprocess +import sys +import shutil + +from os import access +from os import getenv +from os import X_OK + +jar_file = 'ScatterRegions-assembly-0.2.jar' + +default_jvm_mem_opts = [] + +# !!! End of parameter section. No user-serviceable code below this line !!! + + +def real_dirname(path): + """Return the symlink-resolved, canonicalized directory-portion of path.""" + return os.path.dirname(os.path.realpath(path)) + + +def java_executable(): + """Return the executable name of the Java interpreter.""" + java_home = getenv('JAVA_HOME') + java_bin = os.path.join('bin', 'java') + + if java_home and access(os.path.join(java_home, java_bin), X_OK): + return os.path.join(java_home, java_bin) + else: + return 'java' + + +def jvm_opts(argv): + """Construct list of Java arguments based on our argument list. + + The argument list passed in argv must not include the script name. + The return value is a 3-tuple lists of strings of the form: + (memory_options, prop_options, passthrough_options) + """ + mem_opts = [] + prop_opts = [] + pass_args = [] + exec_dir = None + + for arg in argv: + if arg.startswith('-D'): + prop_opts.append(arg) + elif arg.startswith('-XX'): + prop_opts.append(arg) + elif arg.startswith('-Xm'): + mem_opts.append(arg) + elif arg.startswith('--exec_dir='): + exec_dir = arg.split('=')[1].strip('"').strip("'") + if not os.path.exists(exec_dir): + shutil.copytree(real_dirname(sys.argv[0]), exec_dir, symlinks=False, ignore=None) + else: + pass_args.append(arg) + + # In the original shell script the test coded below read: + # if [ "$jvm_mem_opts" == "" ] && [ -z ${_JAVA_OPTIONS+x} ] + # To reproduce the behaviour of the above shell code fragment + # it is important to explictly check for equality with None + # in the second condition, so a null envar value counts as True! + + if mem_opts == [] and getenv('_JAVA_OPTIONS') is None: + mem_opts = default_jvm_mem_opts + + return (mem_opts, prop_opts, pass_args, exec_dir) + + +def main(): + """ + PeptideShaker updates files relative to the path of the jar file. + In a multiuser setting, the option --exec_dir="exec_dir" + can be used as the location for the peptide-shaker distribution. + If the exec_dir dies not exist, + we copy the jar file, lib, and resources to the exec_dir directory. + """ + java = java_executable() + (mem_opts, prop_opts, pass_args, exec_dir) = jvm_opts(sys.argv[1:]) + jar_dir = exec_dir if exec_dir else real_dirname(sys.argv[0]) + + if pass_args != [] and pass_args[0].startswith('eu'): + jar_arg = '-cp' + else: + jar_arg = '-jar' + + jar_path = os.path.join(jar_dir, jar_file) + + java_args = [java] + mem_opts + prop_opts + [jar_arg] + [jar_path] + pass_args + + sys.exit(subprocess.call(java_args)) + + +if __name__ == '__main__': + main() + diff --git a/recipes/biopet-scatterregions/0.2/build.sh b/recipes/biopet-scatterregions/0.2/build.sh new file mode 100644 index 0000000000000..c65cd05a5c5b1 --- /dev/null +++ b/recipes/biopet-scatterregions/0.2/build.sh @@ -0,0 +1,12 @@ +#!/usr/bin/env bash +# Build file is copied from VarScan +# https://github.com/bioconda/bioconda-recipes/blob/master/recipes/varscan/build.sh +# This file was automatically generated by the sbt-bioconda plugin. + +outdir=$PREFIX/share/$PKG_NAME +mkdir -p $outdir +mkdir -p $PREFIX/bin +cp ScatterRegions-assembly-0.2.jar $outdir/ScatterRegions-assembly-0.2.jar +cp $RECIPE_DIR/biopet-scatterregions.py $outdir/biopet-scatterregions +ln -s $outdir/biopet-scatterregions $PREFIX/bin + diff --git a/recipes/biopet-scatterregions/0.2/meta.yaml b/recipes/biopet-scatterregions/0.2/meta.yaml new file mode 100644 index 0000000000000..b1eb4d7647333 --- /dev/null +++ b/recipes/biopet-scatterregions/0.2/meta.yaml @@ -0,0 +1,37 @@ +# !! THIS FILE WAS AUTOMATICALLY GENERATED BY THE SBT-BIOCONDA PLUGIN !! +# !! DO NOT EDIT MANUALLY !! + +package: + name: biopet-scatterregions + version: '0.2' +source: + url: https://github.com/biopet/scatterregions/releases/download/v0.2/ScatterRegions-assembly-0.2.jar + sha256: d7d50f498c00e70bfd45e271e70700f02a0abf0f7dd43392e9d13fa49a0250cd +build: + noarch: generic + number: 0 +requirements: + run: + - openjdk >=8,<9 + - python +about: + home: https://github.com/biopet/scatterregions + license: MIT + summary: This tool breaks a reference or bed file into smaller scatter regions of equal size. + description: | + This tool breaks a reference or bed file into smaller scatter regions of equal size. This can be used for processing inside a pipeline. + + For documentation and manuals visit our github.io page: https://biopet.github.io/scatterregions +test: + commands: + - biopet-scatterregions --version + - biopet-scatterregions --help +extra: + notes: | + biopet-scatterregions is a Java program that comes with a custom wrapper shell script. + By default 'no default java option' is set in the wrapper. + The command that runs the program is 'biopet-scatterregions'. + If you want to overwrite it you can specify memory options directly after your binaries. + If you have _JAVA_OPTIONS set globally this will take precedence. + For example run it with 'biopet-scatterregions -Xms512m -Xmx1g'. + diff --git a/recipes/biopet-scatterregions/biopet-scatterregions.py b/recipes/biopet-scatterregions/biopet-scatterregions.py index df4c0c6bdaf85..7bb58753e611f 100755 --- a/recipes/biopet-scatterregions/biopet-scatterregions.py +++ b/recipes/biopet-scatterregions/biopet-scatterregions.py @@ -17,7 +17,7 @@ from os import getenv from os import X_OK -jar_file = 'ScatterRegions-assembly-0.1.jar' +jar_file = 'ScatterRegions-assembly-0.2.jar' default_jvm_mem_opts = [] diff --git a/recipes/biopet-scatterregions/build.sh b/recipes/biopet-scatterregions/build.sh index 5be115361754c..c65cd05a5c5b1 100644 --- a/recipes/biopet-scatterregions/build.sh +++ b/recipes/biopet-scatterregions/build.sh @@ -3,10 +3,10 @@ # https://github.com/bioconda/bioconda-recipes/blob/master/recipes/varscan/build.sh # This file was automatically generated by the sbt-bioconda plugin. -outdir=$PREFIX/share/$PKG_NAME-$PKG_VERSION-$PKG_BUILDNUM +outdir=$PREFIX/share/$PKG_NAME mkdir -p $outdir mkdir -p $PREFIX/bin -cp ScatterRegions-assembly-0.1.jar $outdir/ScatterRegions-assembly-0.1.jar +cp ScatterRegions-assembly-0.2.jar $outdir/ScatterRegions-assembly-0.2.jar cp $RECIPE_DIR/biopet-scatterregions.py $outdir/biopet-scatterregions ln -s $outdir/biopet-scatterregions $PREFIX/bin diff --git a/recipes/biopet-scatterregions/meta.yaml b/recipes/biopet-scatterregions/meta.yaml index e7a851b155ba8..b1eb4d7647333 100644 --- a/recipes/biopet-scatterregions/meta.yaml +++ b/recipes/biopet-scatterregions/meta.yaml @@ -3,10 +3,10 @@ package: name: biopet-scatterregions - version: '0.1' + version: '0.2' source: - url: https://github.com/biopet/scatterregions/releases/download/v0.1/ScatterRegions-assembly-0.1.jar - sha256: cb1d9633da361c8c4a68118d54dc5801b04a8db9ef33dc681f4776149a478d43 + url: https://github.com/biopet/scatterregions/releases/download/v0.2/ScatterRegions-assembly-0.2.jar + sha256: d7d50f498c00e70bfd45e271e70700f02a0abf0f7dd43392e9d13fa49a0250cd build: noarch: generic number: 0 @@ -18,7 +18,7 @@ about: home: https://github.com/biopet/scatterregions license: MIT summary: This tool breaks a reference or bed file into smaller scatter regions of equal size. - description: |- + description: | This tool breaks a reference or bed file into smaller scatter regions of equal size. This can be used for processing inside a pipeline. For documentation and manuals visit our github.io page: https://biopet.github.io/scatterregions @@ -27,10 +27,11 @@ test: - biopet-scatterregions --version - biopet-scatterregions --help extra: - notes: 'biopet-scatterregions is a Java program that comes with a custom wrapper - shell script. By default ''no default java option'' is set in the wrapper. The - command that runs the program is ''biopet-scatterregions''. If you want to overwrite - it you can specify memory options directly after your binaries. If you have _JAVA_OPTIONS - set globally this will take precedence. For example run it with ''biopet-scatterregions - -Xms512m -Xmx1g''. ' + notes: | + biopet-scatterregions is a Java program that comes with a custom wrapper shell script. + By default 'no default java option' is set in the wrapper. + The command that runs the program is 'biopet-scatterregions'. + If you want to overwrite it you can specify memory options directly after your binaries. + If you have _JAVA_OPTIONS set globally this will take precedence. + For example run it with 'biopet-scatterregions -Xms512m -Xmx1g'. diff --git a/recipes/blasr/meta.yaml b/recipes/blasr/meta.yaml index 2b5ea90042d84..24861a679be6a 100644 --- a/recipes/blasr/meta.yaml +++ b/recipes/blasr/meta.yaml @@ -26,7 +26,7 @@ build: requirements: build: - {{ compiler('cxx') }} - - meson ==0.46* + - meson >=0.48.1 - ninja - pkg-config host: diff --git a/recipes/blasr_libcpp/meta.yaml b/recipes/blasr_libcpp/meta.yaml index 4a0724b5be462..dac5af25c5410 100644 --- a/recipes/blasr_libcpp/meta.yaml +++ b/recipes/blasr_libcpp/meta.yaml @@ -26,7 +26,7 @@ build: requirements: build: - {{ compiler('cxx') }} - - meson ==0.46* + - meson >=0.48.1 - ninja - pkg-config host: diff --git a/recipes/busco/meta.yaml b/recipes/busco/meta.yaml index 0930365fc55a7..832948f41dfa9 100644 --- a/recipes/busco/meta.yaml +++ b/recipes/busco/meta.yaml @@ -8,8 +8,8 @@ package: build: # The R dependencies on OSX needs to be rebuilt with conda-build 3 - skip: True # [py27 or osx] - number: 7 + skip: True # [osx] + number: 8 source: url: https://gitlab.com/ezlab/busco/-/archive/{{ version }}/busco-{{ version }}.tar.gz diff --git a/recipes/canu/meta.yaml b/recipes/canu/meta.yaml index 29a94dd4bc2ee..86374bbbdb9a8 100644 --- a/recipes/canu/meta.yaml +++ b/recipes/canu/meta.yaml @@ -1,5 +1,5 @@ -{% set version = "1.7.1" %} -{% set sha256 = "c314659c929ee05fd413274f391463a93f19b8337eabb7ee5de1ecfc061caafa" %} +{% set version = "1.8" %} +{% set sha256 = "30ecfe574166f54f79606038830f68927cf0efab33bdc3c6e43fd1448fa0b2e4" %} package: name: canu diff --git a/recipes/card_trick/meta.yaml b/recipes/card_trick/meta.yaml new file mode 100644 index 0000000000000..363bab40a6631 --- /dev/null +++ b/recipes/card_trick/meta.yaml @@ -0,0 +1,33 @@ +{% set version = "0.1.0" %} + +package: + name: card_trick + version: '{{ version }}' + +source: + url: https://pypi.io/packages/source/c/card-trick/card-trick-{{ version }}.tar.gz + sha256: ce42bde3570e19b459972b19f9c6a62d8714fd2f8cbb485d9e3e6d6af9260029 + +build: + noarch: python + number: 0 + script: $PYTHON -m pip install --no-deps --ignore-installed --no-cache-dir -vvv . + +requirements: + host: + - python >3 + - pip + run: + - python >3 + - pronto + - requests + +test: + imports: + - card_trick + +about: + home: https://gitlab.com/cgps/card_trick + license: MIT + license_family: MIT + summary: Utility package to find gene <-> drug relationships within CARD diff --git a/recipes/cgat-core/meta.yaml b/recipes/cgat-core/meta.yaml index 75c417bffa2df..095260f096c5c 100644 --- a/recipes/cgat-core/meta.yaml +++ b/recipes/cgat-core/meta.yaml @@ -1,5 +1,5 @@ {% set name = "cgatcore" %} -{% set version = "0.5.2" %} +{% set version = "0.5.4" %} package: name: {{ name|lower }} @@ -7,7 +7,7 @@ package: source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz - sha256: 4b05aaf6e9d17c4d6dc2de4fb3f4250d5a84210f7c589f140506871de3fbbd57 + sha256: 8471d328be0a74ffca0ec7441239673a284c883270fbf85d71e3d5ab4bba69e3 build: number: 0 diff --git a/recipes/cgpbigwig/build.sh b/recipes/cgpbigwig/build.sh new file mode 100644 index 0000000000000..32ae441111647 --- /dev/null +++ b/recipes/cgpbigwig/build.sh @@ -0,0 +1,7 @@ +#!/bin/bash + +mkdir -p $PREFIX/bin +make -C c clean +make -C c prefix=$PREFIX HTSLOC=$PREFIX/lib OPTINC="-I$PREFIX/include" LFLAGS="-L$PREFIX/lib" +cp bin/* $PREFIX/bin + diff --git a/recipes/cgpbigwig/meta.yaml b/recipes/cgpbigwig/meta.yaml new file mode 100644 index 0000000000000..649273e825b2e --- /dev/null +++ b/recipes/cgpbigwig/meta.yaml @@ -0,0 +1,50 @@ +{% set version = "1.0.2" %} +{% set sha256 = "1858d4f59e8a28b95080cfcc48d98571fb50466bb4e6cd20fac8207360910a61" %} + +package: + name: cgpbigwig + version: {{ version }} + +build: + number: 0 + skip: true # [not linux] + +source: + url: https://github.com/cancerit/cgpBigWig/archive/{{ version }}.tar.gz + sha256: {{ sha256 }} + +requirements: + build: + - {{ compiler('c') }} + host: + - zlib + - bzip2 + - xz + - gnutls + - gmp + - libtasn1 + - nettle + - p11-kit + - htslib + - libbigwig + run: + - zlib + - bzip2 + - xz + - gnutls + - gmp + - libtasn1 + - nettle + - p11-kit + - htslib + - libbigwig + +about: + home: https://github.com/cancerit/cgpBigWig + license: GPLv3 + summary: BigWig manpulation tools using libBigWig and htslib + +test: + commands: + - bam2bw -h + - detectExtremeDepth -h diff --git a/recipes/checkm-genome/meta.yaml b/recipes/checkm-genome/meta.yaml index 0fbaea2427dab..5473eb53e668b 100644 --- a/recipes/checkm-genome/meta.yaml +++ b/recipes/checkm-genome/meta.yaml @@ -1,5 +1,5 @@ -{% set version="1.0.11" %} -{% set hash="738a18d6d54e93a9771e07e207e84e4b2ca884b819ff8f42a1cc097363fe0b81" %} +{% set version="1.0.12" %} +{% set hash="4aca26d0ae903ed7567cfc6ec53dc1d2ea909d58a0c4c6e2318a1885abbcfd91" %} package: name: checkm-genome @@ -10,7 +10,7 @@ source: sha256: {{ hash }} build: - number: 1 + number: 0 skip: True # [not py27 or osx] requirements: diff --git a/recipes/drep/build.sh b/recipes/clust/build.sh similarity index 98% rename from recipes/drep/build.sh rename to recipes/clust/build.sh index 3786386a73c83..89481145a5291 100644 --- a/recipes/drep/build.sh +++ b/recipes/clust/build.sh @@ -1,3 +1,2 @@ #!/bin/bash - $PYTHON setup.py install --single-version-externally-managed --record=record.txt diff --git a/recipes/clust/meta.yaml b/recipes/clust/meta.yaml new file mode 100644 index 0000000000000..1f74aa6081db8 --- /dev/null +++ b/recipes/clust/meta.yaml @@ -0,0 +1,50 @@ +{% set name = "clust" %} +{% set version = "1.8.4" %} + +package: + name: "{{ name|lower }}" + version: "{{ version }}" + +source: + url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz + sha256: 1855b333fc18f7d788c640c678800bf032c466e565fe953bd7057f794a04adba + +build: + number: 0 + skip: True # [not py27] + +requirements: + host: + - joblib + - matplotlib + - numpy + - pandas + - pip + - portalocker + - python + - scipy + - scikit-learn + - sompy + run: + - joblib + - matplotlib + - numpy + - pandas + - portalocker + - python + - scipy + - scikit-learn + - sompy + +test: + imports: + - clust + +about: + home: https://github.com/baselabujamous/clust + license: University of Oxford Academic Use Licence + summary: Optimised consensus clustering of multiple heterogeneous datasets. + +extra: + identifiers: + - doi:10.1186/s13059-018-1536-8 diff --git a/recipes/concoct/concoct.patch b/recipes/concoct/concoct.patch index f9328c6475c40..a38093efbe2b4 100644 --- a/recipes/concoct/concoct.patch +++ b/recipes/concoct/concoct.patch @@ -1,11 +1,11 @@ ---- setup.py.bak 2017-02-12 23:39:14.000000000 +0100 -+++ setup.py 2017-02-12 23:39:35.000000000 +0100 +--- setup.py 2018-10-11 11:19:58.000000000 +0200 ++++ setup.py 2018-10-11 11:20:24.000000000 +0200 @@ -36,7 +36,7 @@ 'pandas>=0.11.0', 'biopython>=1.62b', 'scikit-learn>=0.13.1', -- 'nose==1.3.0', -+ 'nose', - 'sphinx-rtd-theme>=0.1.6', - 'Sphinx>=1.2.2'], +- 'nose==1.3.0'], ++ 'nose'], entry_points=""" + # -*- Entry points: -*- + """, diff --git a/recipes/concoct/meta.yaml b/recipes/concoct/meta.yaml index 2b96d347274e6..686c2fe4dd8b4 100644 --- a/recipes/concoct/meta.yaml +++ b/recipes/concoct/meta.yaml @@ -1,18 +1,21 @@ package: name: concoct - version: "0.4.0" + version: "0.4.1" source: - url: https://pypi.python.org/packages/4a/ca/66f48bf7480cc06a1b017a9713b5417ba30a24a5300db1f52fb8f4faeb7e/concoct-0.4.0.tar.gz - md5: 0e783d0e6dabbb7329ff07c11bfd7299 + url: https://github.com/BinPro/CONCOCT/archive/9f09f5385ce378406208b07b5102254aa6b61471.tar.gz + sha256: 3eff2a8d2188a9b42e686fcd49e8614b7c9e76daac8320971d276d4e5406b6d5 patches: - concoct.patch build: preserve_egg_dir: True - number: 2 + number: 0 requirements: + build: + - {{ compiler('c') }} + host: - python - setuptools @@ -56,3 +59,5 @@ about: extra: skip-lints: - uses_setuptools # concoct uses pkg_resources + identifiers: + - doi:10.1038/nmeth.3103 diff --git a/recipes/confindr/meta.yaml b/recipes/confindr/meta.yaml index 20bb623ad1856..51fef3a1d4c09 100644 --- a/recipes/confindr/meta.yaml +++ b/recipes/confindr/meta.yaml @@ -1,5 +1,5 @@ -{% set version = "0.4.2" %} -{% set sha256 = "17777e432a0f63c4612d3ea3f2dbe96395202f2e397a9f79efcc7ce8570cc532" %} +{% set version = "0.4.5" %} +{% set sha256 = "9207a3c2ffb50af78e5284584eacd151a5173e356cb02c5ef4d7a4ade3223ee0" %} package: name: confindr diff --git a/recipes/connectome-workbench/meta.yaml b/recipes/connectome-workbench/meta.yaml index 0f58bc61d1538..f749339eb0b55 100644 --- a/recipes/connectome-workbench/meta.yaml +++ b/recipes/connectome-workbench/meta.yaml @@ -1,6 +1,6 @@ {% set name = "connectome-workbench" %} -{% set version = "1.3.1" %} -{% set sha256 = "0359619ef7559cdd2e677c1c924153bb3534505ca9baf58d9c6281eae654e2c7" %} +{% set version = "1.3.2" %} +{% set sha256 = "5574da8fcba810f5de1a3f70691cd763f927413d73f3b107142041272bf4edc9" %} package: name: {{ name }} @@ -11,7 +11,7 @@ source: sha256: {{ sha256 }} build: - number: 1 + number: 0 skip: True # [osx] requirements: @@ -21,7 +21,7 @@ requirements: - cmake >=2.8 host: - - qt >=5.6 + - qt >=5.7 - libpng - zlib - openssl diff --git a/recipes/consan/build.sh b/recipes/consan/build.sh new file mode 100644 index 0000000000000..7da9fc9f23e50 --- /dev/null +++ b/recipes/consan/build.sh @@ -0,0 +1,18 @@ +#!/bin/bash +mkdir -p $PREFIX/bin + +make +make install + +binaries="\ +bstats \ +comppair \ +conus_compare \ +conus_train \ +pModel \ +scompare \ +sfold \ +strain_ml \ +" + +for i in $binaries; do cp bin/$i $PREFIX/bin/ && chmod +x $PREFIX/bin/$i; done diff --git a/recipes/consan/meta.yaml b/recipes/consan/meta.yaml new file mode 100644 index 0000000000000..298715b1cabb8 --- /dev/null +++ b/recipes/consan/meta.yaml @@ -0,0 +1,34 @@ +{% set version = "1.2" %} + +package: + name: consan + version: {{ version }} + +build: + number: 0 + skip: True # [osx] + +source: + url: http://eddylab.org/software/consan/consan-{{ version }}.tar.gz + sha256: c9bc9878927a2eaef54aee91be9edd6cf2d01819cba6b6165978cea08c308b24 + +requirements: + build: + - {{ compiler('c') }} + +test: + commands: + - comppair -h + - conus_compare -h + - conus_train -h + - pModel -h + - scompare -h + - sfold -h + - strain_ml -h + +about: + home: http://eddylab.org/software/consan/ + license: GPL-3.0 + license_file: LICENSE + summary: Pairwise RNA structural alignment, both unconstrained and constrained on alignment pins. + diff --git a/recipes/cortexpy/meta.yaml b/recipes/cortexpy/meta.yaml index 2219d3f2b09c6..4713a4e341f14 100644 --- a/recipes/cortexpy/meta.yaml +++ b/recipes/cortexpy/meta.yaml @@ -1,5 +1,5 @@ {% set name = "cortexpy" %} -{% set version = "0.44.0" %} +{% set version = "0.45.6" %} package: name: "{{ name|lower }}" @@ -7,7 +7,7 @@ package: source: url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz - sha256: d81cc9d903c03cdd37411123b4fd0af92b73b53400ec149a40c7e8a30f12247d + sha256: e70810bd10d8aad9c7f3ffc9bd1e6bd4af004aa9893da7ce0cc93a9c565e4f5e build: skip: True # [not py36] diff --git a/recipes/csvtk/meta.yaml b/recipes/csvtk/meta.yaml index 9fdd775cd91da..e5a685e29ba1c 100644 --- a/recipes/csvtk/meta.yaml +++ b/recipes/csvtk/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "0.14.0" %} +{% set version = "0.15.0" %} package: name: csvtk @@ -15,12 +15,12 @@ build: source: url: https://github.com/shenwei356/csvtk/releases/download/v{{ version }}/csvtk_darwin_amd64.tar.gz # [osx] - md5: f1d53434994a01d3a8c936ea57de6b75 # [osx] + md5: 3495d693bdc89b6df8aa0fc8e68d2357 # [osx] url: https://github.com/shenwei356/csvtk/releases/download/v{{ version }}/csvtk_linux_386.tar.gz # [linux] - md5: 2d3b636d10964dcf47bca7f88f1ab35c # [linux] + md5: 0d2902a47caff405d1ccb9478584b957 # [linux] url: https://github.com/shenwei356/csvtk/releases/download/v{{ version }}/csvtk_linux_amd64.tar.gz # [linux64] - md5: f5780d0a6f79a62088a32555ce467579 # [linux64] + md5: 870e4fc0472a4472ee81f72caa768186 # [linux64] test: commands: diff --git a/recipes/ctat-mutations/meta.yaml b/recipes/ctat-mutations/meta.yaml index 497b8dd84b4e6..48f04ee5c5187 100644 --- a/recipes/ctat-mutations/meta.yaml +++ b/recipes/ctat-mutations/meta.yaml @@ -1,15 +1,15 @@ {% set name = "ctat-mutations" %} -{% set version = "2.0.0" %} -{% set build = "4" %} +{% set version = "2.0.1" %} +{% set build = "0" %} package: name: {{ name }} version: {{ version }} source: - url: https://github.com/NCIP/ctat-mutations/releases/download/v{{ version }}/ctat-mutations-v{{ version }}.FULL.tar.gz + url: https://github.com/NCIP/ctat-mutations/releases/download/{{ version }}/ctat-mutations-v{{ version }}.FULL.tar.gz #recheck URL - md5: 8497925e59a6ed06a0dbc2972590d67e + md5: d1aa12b897ec03cd29fe0b10c482472e build: number: {{ build }} diff --git a/recipes/das_tool/build.sh b/recipes/das_tool/build.sh new file mode 100644 index 0000000000000..468af53d4bcfd --- /dev/null +++ b/recipes/das_tool/build.sh @@ -0,0 +1,17 @@ +#!/usr/bin/env bash + +# install DAStool R package +R CMD INSTALL "package/DASTool_${PKG_VERSION}.tar.gz" + +# unzip SCG marker database +unzip db.zip -d db + +# install DAS_Tool +DESTDIR=$PREFIX/share/$PKG_NAME-$PKG_VERSION-$PKG_BUILDNUM +mkdir -p $DESTDIR +cp DAS_Tool $DESTDIR +cp -r src db $DESTDIR +chmod +x $DESTDIR/DAS_Tool + +ln -s $DESTDIR/DAS_Tool $PREFIX/bin/ +ln -s $DESTDIR/src/Fasta_to_Scaffolds2Bin.sh $PREFIX/bin/ diff --git a/recipes/das_tool/meta.yaml b/recipes/das_tool/meta.yaml new file mode 100644 index 0000000000000..0bdd3be490e3f --- /dev/null +++ b/recipes/das_tool/meta.yaml @@ -0,0 +1,76 @@ +{% set name = "DAS_Tool" %} +{% set version = "1.1.1" %} +{% set sha256 = "2a55f67b5331251d8fd5adea867cc341363fbf7fa7ed5c3ce9c7679d8039f03a" %} + +package: + name: {{ name|lower }} + version: {{ version }} + +source: + url: https://github.com/cmks/{{ name }}/archive/{{ version }}.tar.gz + sha256: {{ sha256 }} + +build: + number: 1 + skip: True # [not linux] + rpaths: + - lib/R/lib/ + - lib/ + +requirements: + host: + - codeutils # [osx] + - unzip + - gawk + - r=3.5.1 + - python=3.6 + - numpy=1.15.0 + - r-data.table=1.11.4 + - r-domc=1.3.5 + - r-ggplot2=3.1 + - ruby=2.4.4 + - pullseq=1.0.2 + - prodigal=2.6.3 + - blast=2.7.1 + - diamond=0.9.22 + + run: + - codeutils # [osx] + - unzip + - gawk + - r=3.5.1 + - python=3.6 + - numpy=1.15.0 + - r-data.table=1.11.4 + - r-domc=1.3.5 + - r-ggplot2=3.1 + - ruby=2.4.4 + - pullseq=1.0.2 + - prodigal=2.6.3 + - blast=2.7.1 + - diamond=0.9.22 + +test: + commands: + - DAS_Tool --help || [[ $? == 1 ]] + - DAS_Tool --version || [[ $? == 1 ]] + - $R -e "library('DASTool')" + +about: + home: https://github.com/cmks/DAS_Tool + license: BSD + license_file: license.txt + summary: | + Recovery of genomes from metagenomes via a dereplication, + aggregation and scoring strategy. + description: | + DAS Tool is an automated method that integrates the results of a + flexible number of binning algorithms to calculate an optimized, + non-redundant set of bins from a single assembly. + +extra: + identifiers: + - doi:10.1038/s41564-018-0171-1 + recipe-maintainers: + - keuv-grvl + - silask diff --git a/recipes/das_tool/post-link.sh b/recipes/das_tool/post-link.sh new file mode 100644 index 0000000000000..8e307878d26f6 --- /dev/null +++ b/recipes/das_tool/post-link.sh @@ -0,0 +1,11 @@ +#!/usr/bin/env bash + +echo " +#################################################################################### +${PKG_NAME} version ${PKG_VERSION}-${PKG_BUILDNUM} has been successfully installed! + +This software by default runs with USEARCH. You can install it from the following links or use DIAMOND '--search_engine diamond' + + > Download: http://www.drive5.com/usearch/download.html + > Installation instruction: http://www.drive5.com/usearch/manual/install.html + " > $PREFIX/.messages.txt diff --git a/recipes/deblur/meta.yaml b/recipes/deblur/meta.yaml index f5c456593d399..bdbb5681b20ae 100644 --- a/recipes/deblur/meta.yaml +++ b/recipes/deblur/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "1.0.4" %} +{% set version = "1.1.0" %} package: name: deblur @@ -6,10 +6,10 @@ package: source: url: https://github.com/biocore/deblur/archive/{{ version }}.tar.gz - sha256: bb43fefbf9f01db53a1f3bdff755c006a22717f976c8fa3fa242f74cb85380f4 + sha256: 6bce57bb2400e29b45074794e33ce02a6c0b379eacbb2da299125deaed1faeb6 build: - number: 2 + number: 0 skip: True # [py27] extra: diff --git a/recipes/deepbinner/meta.yaml b/recipes/deepbinner/meta.yaml index df8c18b601673..c5d65b53c75bf 100644 --- a/recipes/deepbinner/meta.yaml +++ b/recipes/deepbinner/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "0.1.2" %} +{% set version = "0.2.0" %} package: name: deepbinner @@ -6,7 +6,7 @@ package: source: url: https://github.com/rrwick/Deepbinner/archive/v{{ version }}.tar.gz - sha256: 297ec118c094840c9095c09a8deb4808f0b9692f86062adc42b930614e2f47bb + sha256: 4dfc00392c0e3c0f5cbd40c03bb6fcaf51c5126e1042c71863939ede1de0120a build: number: 0 @@ -37,7 +37,7 @@ requirements: test: commands: - - deepbinner -h + - COLUMNS=80 deepbinner -h about: home: https://github.com/rrwick/Deepbinner diff --git a/recipes/dnp-diprofile/build.sh b/recipes/dnp-diprofile/build.sh index 7eea619acdf8e..4bea5decc0b49 100644 --- a/recipes/dnp-diprofile/build.sh +++ b/recipes/dnp-diprofile/build.sh @@ -1,5 +1,4 @@ #!/bin/bash - sed 's/CPROGNAME/diprofile/g' CMakeLists.template > CMakeLists.txt mkdir -p build @@ -7,8 +6,21 @@ cd build SEQAN_INCLUDE_PATH="$CONDA_DEFAULT_ENV/include/" CMAKE_PREFIX_PATH="$CONDA_DEFAULT_ENV/share/cmake/seqan" -cmake ../ -DCMAKE_PREFIX_PATH="$CMAKE_PREFIX_PATH" -DSEQAN_INCLUDE_PATH="$SEQAN_INCLUDE_PATH" - +cmake ../ -DCMAKE_PREFIX_PATH="$CMAKE_PREFIX_PATH" -DSEQAN_INCLUDE_PATH="$SEQAN_INCLUDE_PATH" -DCMAKE_BUILD_TYPE=Release make + +echo ">line1" > test.fasta +echo "AAAATGCGTAATGGTGGCAAACTCGTAGGCT" >> test.fasta +echo ">line2" >> test.fasta +echo "ctAAATGCtTAATGGTCGCAACGGAATTGCC" >> test.fasta +echo ">line3" >> test.fasta +echo "AAAATGCGTAATTGTGGCAGGGAATTCCGTA" >> test.fasta +echo ">line4" >> test.fasta +echo "GAaATGCGTAATGGTGGCAATTAAGCTAGTG" >> test.fasta +echo ">line5" >> test.fasta +echo "GGCaaTGCGTAATGGTAGTTATGGAATCGGT" >> test.fasta +# run on small fasta +./diprofile test.fasta -sl 30 -di AA +./diprofile test.fasta -sl 30 -c -di AA + cp diprofile $PREFIX/bin/dnp-diprofile - diff --git a/recipes/dnp-diprofile/meta.yaml b/recipes/dnp-diprofile/meta.yaml index daed7decdb879..f1e5ffbf8f489 100644 --- a/recipes/dnp-diprofile/meta.yaml +++ b/recipes/dnp-diprofile/meta.yaml @@ -7,7 +7,7 @@ source: sha256: 19c46d6bc6a1af70e5a2b4a051aab334026dc38c84b367ea9c445da3fdb21cfe build: - number: 0 + number: 1 requirements: build: diff --git a/recipes/domclust/meta.yaml b/recipes/domclust/meta.yaml index dcd4350cebe90..a28eb58622beb 100644 --- a/recipes/domclust/meta.yaml +++ b/recipes/domclust/meta.yaml @@ -1,6 +1,6 @@ package: name: domclust - version: "1.2.8a" + version: "1.2.8" about: home: http://mbgd.genome.ad.jp/domclust/ @@ -8,11 +8,11 @@ about: summary: Effective tool for orthologous grouping in multiple genomes build: - number: 1 + number: 0 source: - url: "https://depot.galaxyproject.org/software/DomClust/DomClust_1.2.8a_src_all.tar.gz" - sha256: 34b3724b05f42ec072c1e24a05a369e6c8a56ff51cd40a06002129fcd2b6a859 + url: "https://depot.galaxyproject.org/software/DomClust/DomClust_1.2.8_src_all.tar.gz" + sha256: ffe3dac8dee1ccd621556ed7e5818299ed167853dd4dcd9e42cde43eec4c40b2 requirements: build: diff --git a/recipes/drep/meta.yaml b/recipes/drep/meta.yaml index 1cc5b550b8a04..436b0a992f144 100644 --- a/recipes/drep/meta.yaml +++ b/recipes/drep/meta.yaml @@ -1,27 +1,23 @@ +{% set name = "drep" %} +{% set version = "2.2.3" %} + package: name: drep - version: "2.0.5" + version: '{{ version }}' source: - url: https://files.pythonhosted.org/packages/2d/66/a38de16d8a10b150c5a6742e6c82e7bcf0254333fa1f6bcd4f1e8b0ed640/drep-2.0.5.tar.gz - md5: 08492bb85a9bcfe2ee55e90cfbd7064f + url: https://pypi.io/packages/source/d/drep/drep-{{ version }}.tar.gz + sha256: b2d0d702829f4d1ce2ed99af0e20e1b07cbf0e15fd780bc4d77619c0dc7a1581 build: - number: 2 skip: True # [py27] + number: 0 + script: $PYTHON -m pip install --no-deps --ignore-installed --no-cache-dir -vvv . requirements: host: - python - - setuptools - - numpy - - pandas - - seaborn - - matplotlib - - biopython - - scikit-learn - - pytest - + - pip run: - python - numpy @@ -30,8 +26,6 @@ requirements: - matplotlib - biopython - scikit-learn - - pytest - - python-dateutil >=2.5.0 test: imports: @@ -43,5 +37,5 @@ test: about: home: https://github.com/MrOlm/drep license: MIT - summary: 'De-replication of microbial genomes assembled from multiple samples' license_family: MIT + summary: De-replication of microbial genomes assembled from multiple samples diff --git a/recipes/duphold/meta.yaml b/recipes/duphold/meta.yaml index 702bf02630961..7cef8c9dc144c 100644 --- a/recipes/duphold/meta.yaml +++ b/recipes/duphold/meta.yaml @@ -1,6 +1,6 @@ {% set name = "duphold" %} -{% set version = "0.0.6" %} -{% set sha256hash = "6bf68965393306e322afdf171da813e3fb331ca2a47226d6ab70e92fe6c7e523" %} +{% set version = "0.0.9" %} +{% set sha256hash = "6dbca07fce926d4252ce048dc79580068da5b21a7a8776e5a3098276fea72595" %} package: name: {{ name|lower }} diff --git a/recipes/elprep/meta.yaml b/recipes/elprep/meta.yaml index 872523c6c402a..16676b3276158 100644 --- a/recipes/elprep/meta.yaml +++ b/recipes/elprep/meta.yaml @@ -1,22 +1,22 @@ -{% set version = '3.04' %} +{% set version = '4.0.0' %} package: name: elprep version: {{ version }} source: - url: https://github.com/ExaScience/elprep/releases/download/v{{ version }}/elprep-v{{ version }}.tar.bz2 - md5: 087a933758adb72d83efc58ea73879cc + url: https://github.com/ExaScience/elprep/releases/download/v{{ version }}/elprep-v{{ version }}.tar.gz + sha256: ffde4f75e35e8772764a6432bb81e765226b7a32dce4967fa520dd1b6fd3b11d build: - number: 1 + number: 0 skip: True # [osx] test: commands: - elprep -h - + about: home: https://github.com/ExaScience/elprep - license: BSD 3 - summary: 'elPrep: a high-performance tool for preparing sequence alignment/map files in sequencing pipelines.' + license: GNU AFFERO GENERAL PUBLIC LICENSE + summary: 'elPrep is a high-performance tool for preparing .sam/.bam files for variant calling in sequencing pipelines. It can be used as a drop-in replacement for SAMtools/Picard/GATK4, and was extensively tested with different pipelines for variant analysis with GATK. The key advantage of elPrep is that it only performs a single-pass to process a .sam/.bam file, independent of the number of processing steps that need to be applied in a particular pipeline, greatly improving runtime performance.' diff --git a/recipes/ensembl-vep/meta.yaml b/recipes/ensembl-vep/meta.yaml index 57e0e3b1a63a2..aeb3f7f4830d7 100644 --- a/recipes/ensembl-vep/meta.yaml +++ b/recipes/ensembl-vep/meta.yaml @@ -1,4 +1,4 @@ -{% set version="94.0" %} +{% set version="94.4" %} package: name: ensembl-vep @@ -6,7 +6,7 @@ package: source: url: https://github.com/Ensembl/ensembl-vep/archive/release/{{ version }}.tar.gz - sha256: 194a3b6bd963758513c68fea019f937c6ee3572e4d36309905a930d60673e425 + sha256: 6bc9550190299e04435e99538292502fe385627687181cd6b7728aeea51582e6 build: number: 0 diff --git a/recipes/entrez-direct/build.sh b/recipes/entrez-direct/build.sh index 71986bda0335b..8eaaba1c9a786 100644 --- a/recipes/entrez-direct/build.sh +++ b/recipes/entrez-direct/build.sh @@ -1,16 +1,5 @@ #!/bin/bash -sed -i.bak 's|/usr/bin/perl -w|/usr/bin/env perl|' setup-deps.pl -sed -i.bak 's|/usr/bin/perl -w|/usr/bin/env perl|' asp-ls -sed -i.bak 's|/usr/bin/perl -w|/usr/bin/env perl|' run-ncbi-converter -sed -i.bak 's|/usr/bin/perl -w|/usr/bin/env perl|' ftp-cp -sed -i.bak 's|/usr/bin/perl -w|/usr/bin/env perl|' ftp-ls - -sed -i.bak 's|/usr/bin/perl|/usr/bin/env perl|' gbf2xml -sed -i.bak 's|/usr/bin/perl|/usr/bin/env perl|' nquire -sed -i.bak 's|/usr/bin/perl|/usr/bin/env perl|' edirect.pl -sed -i.bak 's|/usr/bin/perl|/usr/bin/env perl|' edirutil - mv * "$PREFIX/bin/" mkdir -p "$PREFIX/home" export HOME="$PREFIX/home" diff --git a/recipes/entrez-direct/ftp-cp.patch b/recipes/entrez-direct/ftp-cp.patch deleted file mode 100644 index 90d5f15a1bfc5..0000000000000 --- a/recipes/entrez-direct/ftp-cp.patch +++ /dev/null @@ -1,8 +0,0 @@ ---- ftp-cp 2017-06-06 20:00:25.000000000 +0200 -+++ ftp-cp 2017-08-10 09:57:27.271794263 +0200 -@@ -1,4 +1,4 @@ --#!/usr/bin/perl -w -+#!/usr/bin/env perl - # Usage: ftp-cp SERVER PATH FILE... - - use strict; diff --git a/recipes/entrez-direct/meta.yaml b/recipes/entrez-direct/meta.yaml index a84b74ba724bb..8813c9273e9a6 100644 --- a/recipes/entrez-direct/meta.yaml +++ b/recipes/entrez-direct/meta.yaml @@ -1,19 +1,18 @@ -{% set version = "7.70" %} -{% set date = "20180103" %} -{% set sha256 = "674ab325d0de96577455e8569f4d5451583b784df22e2c93d8c05d29488fae4a" %} +{% set version = "10.2" %} +{% set date = "20181018" %} +{% set sha256 = "27b2c777c8eab9a9716d167b71e2017edcf98c29d80a040d8c78ddffa2222e24" %} package: name: entrez-direct version: {{ version }} build: - number: 2 + number: 0 source: url: ftp://ftp.ncbi.nlm.nih.gov/entrez/entrezdirect/versions/{{ version }}.{{ date }}/edirect.tar.gz sha256: {{ sha256 }} patches: - - ftp-cp.patch - xtract.patch requirements: @@ -33,6 +32,7 @@ requirements: - perl-uri - perl-www-robotrules - perl-mozilla-ca + - perl-xml-simple run: - perl @@ -50,6 +50,7 @@ requirements: - perl-uri - perl-www-robotrules - perl-mozilla-ca + - perl-xml-simple test: commands: diff --git a/recipes/entrez-direct/xtract.patch b/recipes/entrez-direct/xtract.patch index f269e623e69cb..8be1e9fe225dd 100644 --- a/recipes/entrez-direct/xtract.patch +++ b/recipes/entrez-direct/xtract.patch @@ -1,12 +1,12 @@ ---- setup.sh 2017-04-26 23:25:19.000000000 +0200 -+++ setup.sh 2017-08-09 18:30:48.319400055 +0200 -@@ -41,7 +13,8 @@ - esac - if [ -f xtract."$osname" ] +--- setup.sh 2018-04-02 18:50:22.000000000 +0000 ++++ setup.sh.new 2018-10-17 18:30:39.708944760 +0000 +@@ -55,7 +55,8 @@ + + if [ -f xtract."$platform" ] then -- chmod +x xtract."$osname" +- chmod +x xtract."$platform" + mv xtract."$osname" xtract + chmod +x xtract else - echo "Unable to download a prebuilt xtract executable; attempting to" - echo "build one from xtract.go. A Perl fallback is also available, and" + echo "Unable to download xtract executable." + fi diff --git a/recipes/estmapper/Makefile.patch b/recipes/estmapper/Makefile.patch new file mode 100644 index 0000000000000..c397a2567dd28 --- /dev/null +++ b/recipes/estmapper/Makefile.patch @@ -0,0 +1,114 @@ +--- configure.sh 2015-04-24 13:42:52.000000000 -0500 ++++ configure.sh.new 2018-10-27 01:32:32.519958842 -0500 +@@ -168,11 +168,11 @@ + CC := $CC + SHLIB_FLAGS := -shared + CFLAGS_COMPILE := -O3 -fPIC -pthread -D_REENTRANT -Wall -Wno-char-subscripts -mtune=native -march=native -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer +-CLDFLAGS := -L/usr/local/lib ++CLDFLAGS := -L${PREFIX}/lib + CLIBS := -pthread -lthr + CXX := $CXX + CXXFLAGS_COMPILE := -O3 -fPIC -pthread -D_REENTRANT -Wall -Wno-char-subscripts -mtune=native -march=native -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer +-CXXLDFLAGS := -L/usr/local/lib ++CXXLDFLAGS := -L${PREFIX}/lib + CXXLIBS := -pthread -lthr + ARFLAGS := ruvs + INSTALL/ := $target/ +@@ -186,11 +186,11 @@ + CC := $CC + SHLIB_FLAGS := -shared + CFLAGS_COMPILE := -g -pthread -D_REENTRANT -fPIC -Wall -Wno-char-subscripts -Wshadow -Wpointer-arith -Wcast-qual -Wcast-align -Wwrite-strings -Wconversion -Wstrict-prototypes -Wmissing-prototypes -Wmissing-declarations -Wnested-externs +-CLDFLAGS := -L/usr/local/lib ++CLDFLAGS := -L${PREFIX}/lib + CLIBS := -pthread -lthr + CXX := $CXX + CXXFLAGS_COMPILE := -g -pthread -D_REENTRANT -fPIC -Wall -Wno-char-subscripts -Wshadow -Wpointer-arith -Wcast-qual -Wcast-align -Wwrite-strings -Wconversion +-CXXLDFLAGS := -L/usr/local/lib ++CXXLDFLAGS := -L${PREFIX}/lib + CXXLIBS := -pthread -lthr + ARFLAGS := ruvs + INSTALL/ := $target/ +@@ -204,11 +204,11 @@ + CC := $CC + SHLIB_FLAGS := -shared + CFLAGS_COMPILE := -pg -O3 -pthread -D_REENTRANT -fPIC -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions +-CLDFLAGS := -pg -L/usr/local/lib ++CLDFLAGS := -pg -L${PREFIX}/lib + CLIBS := -pthread -lthr + CXX := $CXX + CXXFLAGS_COMPILE := -pg -O3 -pthread -D_REENTRANT -fPIC -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions +-CXXLDFLAGS := -pg -L/usr/local/lib ++CXXLDFLAGS := -pg -L${PREFIX}/lib + CXXLIBS := -pthread -lthr + ARFLAGS := ruvs + INSTALL/ := $target/ +@@ -222,11 +222,11 @@ + CC := $CC + SHLIB_FLAGS := -shared + CFLAGS_COMPILE := -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer +-CLDFLAGS := -L/usr/local/lib ++CLDFLAGS := -L${PREFIX}/lib + CLIBS := -pthread -ldl + CXX := $CXX + CXXFLAGS_COMPILE := -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer +-CXXLDFLAGS := -L/usr/local/lib ++CXXLDFLAGS := -L${PREFIX}/lib + CXXLIBS := -pthread -ldl + ARFLAGS := ruvs + INSTALL/ := $target/ +@@ -240,11 +240,11 @@ + CC := $CC + SHLIB_FLAGS := -shared + CFLAGS_COMPILE := -m64 -fPIC -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer +-CLDFLAGS := -L/usr/local/lib ++CLDFLAGS := -L${PREFIX}/lib + CLIBS := -pthread -ldl + CXX := $CXX + CXXFLAGS_COMPILE := -m64 -fPIC -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer +-CXXLDFLAGS := -L/usr/local/lib ++CXXLDFLAGS := -L${PREFIX}/lib + CXXLIBS := -pthread -ldl + ARFLAGS := ruvs + INSTALL/ := $target/ +@@ -258,11 +258,11 @@ + CC := $CC + SHLIB_FLAGS := -shared + CFLAGS_COMPILE := -m64 -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -g -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer +-CLDFLAGS := -L/usr/local/lib ++CLDFLAGS := -L${PREFIX}/lib + CLIBS := -pthread -ldl + CXX := $CXX + CXXFLAGS_COMPILE := -m64 -fPIC -D_FILE_OFFSET_BITS=64 -D_LARGEFILE64_SOURCE -D_REENTRANT -g -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer +-CXXLDFLAGS := -L/usr/local/lib ++CXXLDFLAGS := -L${PREFIX}/lib + CXXLIBS := -pthread -ldl + ARFLAGS := ruvs + INSTALL/ := $target/ +@@ -276,11 +276,11 @@ + CC := $CC + SHLIB_FLAGS := -shared + CFLAGS_COMPILE := -pg -m64 -fPIC -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions +-CLDFLAGS := -L/usr/local/lib ++CLDFLAGS := -L${PREFIX}/lib + CLIBS := -pthread -ldl + CXX := $CXX + CXXFLAGS_COMPILE := -pg -m64 -fPIC -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions +-CXXLDFLAGS := -L/usr/local/lib ++CXXLDFLAGS := -L${PREFIX}/lib + CXXLIBS := -pthread -ldl + ARFLAGS := ruvs + INSTALL/ := $target/ +@@ -294,11 +294,11 @@ + CC := $CC + SHLIB_FLAGS := -shared + CFLAGS_COMPILE := -m64 -fPIC -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer +-CLDFLAGS := -L/usr/local/lib ++CLDFLAGS := -L${PREFIX}/lib + CLIBS := -pthread -ldl + CXX := $CXX + CXXFLAGS_COMPILE := -m64 -fPIC -D_REENTRANT -O3 -D_THREAD_SAFE -pthread -fmessage-length=0 -Wall -Wno-char-subscripts -funroll-loops -fexpensive-optimizations -finline-functions -fomit-frame-pointer +-CXXLDFLAGS := -L/usr/local/lib ++CXXLDFLAGS := -L${PREFIX}/lib + CXXLIBS := -pthread -ldl + ARFLAGS := ruvs + INSTALL/ := $target/ diff --git a/recipes/estmapper/build.sh b/recipes/estmapper/build.sh index ed473146fe02b..025d3c550f97c 100644 --- a/recipes/estmapper/build.sh +++ b/recipes/estmapper/build.sh @@ -1,13 +1,17 @@ +#!/bin/bash + +export LDFLAGS="-L${PREFIX}/lib" +export LD_LIBRARY_PATH="${PREFIX}/lib:${LD_LIBRARY_PATH}" + grep -l -r "/usr/bin/perl" . | xargs sed -i.bak -e 's/usr\/bin\/perl/usr\/bin\/env perl/g' make install -mkdir -p $PREFIX if [ `uname` == Darwin ]; then - cp Darwin-amd64/bin/* $PREFIX/bin/ - cp Darwin-amd64/include/* $PREFIX/include/ - cp Darwin-amd64/lib/* $PREFIX/lib/ + cp Darwin-amd64/bin/* ${PREFIX}/bin/ + cp Darwin-amd64/include/* ${PREFIX}/include/ + cp Darwin-amd64/lib/* ${PREFIX}/lib/ else - cp Linux-amd64/bin/* $PREFIX/bin/ - cp Linux-amd64/include/* $PREFIX/include/ - cp Linux-amd64/lib/* $PREFIX/lib/ -fi \ No newline at end of file + cp Linux-amd64/bin/* ${PREFIX}/bin/ + cp Linux-amd64/include/* ${PREFIX}/include/ + cp Linux-amd64/lib/* ${PREFIX}/lib/ +fi diff --git a/recipes/estmapper/meta.yaml b/recipes/estmapper/meta.yaml index cb0e6f44394d0..587d738650d82 100644 --- a/recipes/estmapper/meta.yaml +++ b/recipes/estmapper/meta.yaml @@ -1,35 +1,39 @@ -{% set name = "estmapper" %} +{% set name = "ESTmapper" %} {% set version = "2008" %} +{% set sha256 = "2ee66fe0708b01c7fcee8836019f2b648ccd7015a7f6bd7fee29d59967a6f341" %} package: - name: {{ name }} + name: {{ name|lower }} version: {{ version }} -about: - home: 'http://kmer.sourceforge.net/wiki/index.php/Getting_Started_with_ESTmapper' - license: "GPL" - summary: "software package for the high-throughput alignment of large cDNA (EST, mRNA) sequence sets to a large eukaryotic genome of the same species" - source: url: http://sourceforge.net/projects/kmer/files/ESTmapper-r2008.tar.bz2 - md5: 6d310460dec848fe057d0f51b1e4ccd9 + sha256: {{ sha256 }} + patches: + - Makefile.patch build: - number: 1 + number: 2 skip: True # [py3k] requirements: build: - {{ compiler('c') }} + - {{ compiler('cxx') }} host: - python - - bzip2 - perl - + - bzip2 run: - - perl - python + - perl + - bzip2 test: commands: - ESTmapper.pl 2>&1 | grep ESTmapper + +about: + home: http://kmer.sourceforge.net/wiki/index.php/Getting_Started_with_ESTmapper + license: GPL + summary: "Software package for the high-throughput alignment of large cDNA (EST, mRNA) sequence sets to a large eukaryotic genome of the same species." diff --git a/recipes/evofold2/EvoFoldV2.sh b/recipes/evofold2/EvoFoldV2.sh new file mode 100644 index 0000000000000..ac164500fbfe5 --- /dev/null +++ b/recipes/evofold2/EvoFoldV2.sh @@ -0,0 +1,3 @@ +#/bin/bash +DIR="$(cd "$(dirname "$0")" && pwd)" +$DIR/EvoFoldV2 -c $DIR/../include/EvoFoldConfig/ "$@" \ No newline at end of file diff --git a/recipes/evofold2/build.sh b/recipes/evofold2/build.sh new file mode 100644 index 0000000000000..f937989b4bab5 --- /dev/null +++ b/recipes/evofold2/build.sh @@ -0,0 +1,14 @@ +#!/bin/bash + +mkdir -p $PREFIX/bin/ +mkdir -p $PREFIX/lib/ +mkdir -p $PREFIX/include/ + +cp bin/* $PREFIX/bin/ +cp lib/* $PREFIX/lib/ +cp -R include/* $PREFIX/include/ +cp $RECIPE_DIR/EvoFoldV2.sh $PREFIX/bin + +chmod +x $PREFIX/bin/* + + diff --git a/recipes/evofold2/meta.yaml b/recipes/evofold2/meta.yaml new file mode 100644 index 0000000000000..8eb2eee510ba4 --- /dev/null +++ b/recipes/evofold2/meta.yaml @@ -0,0 +1,24 @@ +package: + name: evofold2 + version: '0.1' + +source: + url: ftp://biftp.informatik.uni-freiburg.de/pub/EvoFold2/Evofold2-static-x64.tar.gz + sha256: 3e4f564b5c902e496fbe49b3b89b346b9e2f19bfad0ed7c4f0349c50276cccd2 + +build: + number: 0 + skip: True # [osx] + +requirements: + build: + run: + +test: + commands: + - EvoFoldV2.sh -h 2>&1 | grep "Usage" > /dev/null + +about: + home: https://github.com/jakob-skou-pedersen/phy + license: GPL + summary: Identifies functional RNA-structure in multiple sequence alignments. diff --git a/recipes/expansionhunter/meta.yaml b/recipes/expansionhunter/meta.yaml index 9fc279761c6f1..fb16d95943c20 100644 --- a/recipes/expansionhunter/meta.yaml +++ b/recipes/expansionhunter/meta.yaml @@ -1,5 +1,5 @@ {% set name = "expansionhunter" %} -{% set version = "2.0.8" %} +{% set version = "2.5.5" %} package: @@ -11,7 +11,7 @@ build: source: url: https://github.com/Illumina/ExpansionHunter/archive/v{{ version }}.tar.gz - md5: 24d39d1f1c4b013f87a589932bc88976 + md5: 72363add70a6eba9e39435b6bd56da13 requirements: build: diff --git a/recipes/fast5seek/meta.yaml b/recipes/fast5seek/meta.yaml index 368568fe43527..b2c21ecd513bd 100644 --- a/recipes/fast5seek/meta.yaml +++ b/recipes/fast5seek/meta.yaml @@ -1,6 +1,6 @@ {% set name = "fast5seek" %} -{% set version = "0.1.0" %} -{% set hash_value = "aa005f2fff12c2d94e583a4c477fd5bbeddb1cb17ead24d1e7857024e5239747" %} +{% set version = "0.1.1" %} +{% set hash_value = "e78a7a6cf746ffa683779969bb6084ffe39d05af56283c63baf21dae77b02d50" %} package: name: '{{ name|lower }}' @@ -11,7 +11,7 @@ source: sha256: '{{ hash_value }}' build: - number: 1 + number: 0 entry_points: - fast5seek=fast5seek.cli:cli script: python -m pip install --no-deps --ignore-installed . diff --git a/recipes/fastq-scan/build.sh b/recipes/fastq-scan/build.sh new file mode 100644 index 0000000000000..19b56cc477096 --- /dev/null +++ b/recipes/fastq-scan/build.sh @@ -0,0 +1,6 @@ +#!/bin/bash +set -e -x +mkdir -p $PREFIX/bin + +make +cp ./fastq-scan $PREFIX/bin diff --git a/recipes/fastq-scan/meta.yaml b/recipes/fastq-scan/meta.yaml new file mode 100644 index 0000000000000..4047d0bd173c2 --- /dev/null +++ b/recipes/fastq-scan/meta.yaml @@ -0,0 +1,29 @@ +{% set name="fastq-scan" %} +{% set version = "0.2" %} +{% set sha256 = "0f5235fe6b358b29c7e9330e5db0ae5f25b01ddf6703426d6d8a529503d920cc" %} + +package: + name: {{ name }} + version: {{ version }} + +source: + url: https://github.com/rpetit3/fastq-scan/archive/v{{ version }}.tar.gz + sha256: {{ sha256 }} + +build: + number: 0 + +requirements: + build: + - {{ compiler('cxx') }} + +test: + commands: + - fastq-scan -v + - fastq-scan -h + +about: + home: https://github.com/rpetit3/fastq-scan + license: MIT + license_file: LICENSE + summary: FASTQ summary statistics in JSON format diff --git a/recipes/fastspar/meta.yaml b/recipes/fastspar/meta.yaml index 0bc0b85bca3eb..2777bc58f355b 100644 --- a/recipes/fastspar/meta.yaml +++ b/recipes/fastspar/meta.yaml @@ -1,6 +1,6 @@ {% set name = "fastspar" %} -{% set version = "0.0.6" %} -{% set sha256 = "07dc76479d4a8aa30ba6d69e20b50241bfbbcdd2f8fd2858b9f5b594bc2cba98" %} +{% set version = "0.0.7" %} +{% set sha256 = "af401ac1bc2894aa8aff136aa42066b8b309a40b1bca1bfe6ec119d46f5c7ddf" %} package: name: {{name}} @@ -11,7 +11,7 @@ source: sha256: {{sha256}} build: - number: 1 + number: 0 requirements: build: diff --git a/recipes/fgmp/build.sh b/recipes/fgmp/build.sh new file mode 100644 index 0000000000000..198f7133fdffb --- /dev/null +++ b/recipes/fgmp/build.sh @@ -0,0 +1,22 @@ +#!/bin/bash + +mkdir -p $PREFIX/src +mkdir -p $PREFIX/utils +mkdir -p $PREFIX/lib +mkdir -p $PREFIX/data +mkdir -p $PREFIX/sample +mkdir -p $PREFIX/bin + +cp $SRC_DIR/src/* $PREFIX/src +cp -r $SRC_DIR/utils/* $PREFIX/utils + +chmod 755 $PREFIX/src/* +chmod 755 $PREFIX/utils/* +chmod 755 $PREFIX/lib/* +chmod 755 $PREFIX/bin + +cp $SRC_DIR/README.md $PREFIX +cp $SRC_DIR/data/* $PREFIX/data +cp $SRC_DIR/fgmp.config $PREFIX +cp $SRC_DIR/lib/FGMP.pm $PREFIX/lib +cp $SRC_DIR/sample/* $PREFIX/sample diff --git a/recipes/fgmp/meta.yaml b/recipes/fgmp/meta.yaml new file mode 100644 index 0000000000000..cd3d1d41c708e --- /dev/null +++ b/recipes/fgmp/meta.yaml @@ -0,0 +1,48 @@ +package: + name: fgmp + version: 1.0.1 + +source: + url: https://github.com/stajichlab/FGMP/archive/v1.0.1.tar.gz + sha256: 18a95eacaa96ea24bfcd5b848355c4b1b6845ea1d1e86c014ffdf8927ecc6385 + +build: + number: 0 + +requirements: + build: + - perl >=5.10 + + host: + - perl >=5.10 + - perl-ipc-run + - perl-bioperl + - augustus >=3.0 + - blast ==2.2.31 + - emboss >=6.5.7 + - exonerate >=2.2.0 + - hmmer >=3.0 + + run: + - perl >=5.10 + - perl-ipc-run + - perl-bioperl + - perl-app-cpanminus + - augustus >=3.0 + - blast ==2.2.31 + - emboss >=6.5.7 + - exonerate >=2.2.0 + - hmmer >=3.0 + +test: + import: + - blast +about: + home: https://github.com/stajichlab/FGMP + license: 'MIT' + summary: 'FGMP: assessing fungal genome completeness and gene content.' + +extra: + identifiers: + - biotools:fgmp + - doi:10.1101/049619 diff --git a/recipes/fpa/build.sh b/recipes/fpa/build.sh new file mode 100644 index 0000000000000..7858a2c78684c --- /dev/null +++ b/recipes/fpa/build.sh @@ -0,0 +1,12 @@ +#!/bin/bash -euo + +if [ "$(uname)" == "Darwin" ]; then + # Apparently the Home variable isn't set correctly + export HOME="/Users/distiller" + + # According to https://github.com/rust-lang/cargo/issues/2422#issuecomment-198458960 remove circle ci default configuration solve cargo trouble + git config --global --unset url.ssh://git@github.com.insteadOf +fi + +# build statically linked binary with Rust +RUST_BACKTRACE=1 C_INCLUDE_PATH=$PREFIX/include LIBRARY_PATH=$PREFIX/lib cargo install --verbose --root $PREFIX diff --git a/recipes/fpa/meta.yaml b/recipes/fpa/meta.yaml new file mode 100644 index 0000000000000..4fa3bdef6c274 --- /dev/null +++ b/recipes/fpa/meta.yaml @@ -0,0 +1,39 @@ +{% set version = "0.3" %} +{% set sha256 = "0f8a70f160f4c7e16d6eeb0a992211a5f053c0926d4f72395aaa051a05fd5ed2" %} + +package: + name: fpa + version: '{{version}}' + +source: + url: https://github.com/natir/fpa/archive/v{{version}}.tar.gz + sha256: '{{sha256}}' + +build: + number: 0 + +requirements: + build: + - '{{ compiler("c") }}' + - rust + - gcc_impl_linux-64 #[linux] + - pkg-config #[osx] + host: + - xz + - zlib + - bzip2 + run: + - xz + - zlib + - bzip2 + +test: + commands: + - fpa -h + +about: + home: https://github.com/natir/yacrd + license: MIT + license_family: MIT + license_file: LICENSE + summary: Filter Pairwise Alignment filter long read mapping information to save disk space diff --git a/recipes/fqzcomp/build.sh b/recipes/fqzcomp/build.sh new file mode 100644 index 0000000000000..02e57b67a6e89 --- /dev/null +++ b/recipes/fqzcomp/build.sh @@ -0,0 +1,3 @@ +#! /bin/bash +make +cp fqz_comp $PREFIX/bin diff --git a/recipes/fqzcomp/meta.yaml b/recipes/fqzcomp/meta.yaml new file mode 100644 index 0000000000000..3c4f7da14909d --- /dev/null +++ b/recipes/fqzcomp/meta.yaml @@ -0,0 +1,33 @@ +{% set version = "4.6" %} + +package: + name: fqzcomp + version: {{ version }} + +build: + skip: True # [osx] + number: 0 + +source: + url: https://sourceforge.net/projects/fqzcomp/files/fqzcomp-{{ version }}.tar.gz + sha256: ff98f5a5e2c0351cdeacbd236aa25c7771ec8a4f547416c22a1b5c74a1875620 + +requirements: + build: + - {{ compiler('cxx') }} + + host: + - zlib + + run: + - zlib + +about: + home: https://sourceforge.net/projects/fqzcomp/ + license: BSD License + license_family: BSD + summary: Fqzcomp is a basic fastq compressor, designed primarily for high performance. + +test: + commands: + - "fqz_comp -h" diff --git a/recipes/fred2/build.sh b/recipes/fred2/build.sh new file mode 100644 index 0000000000000..8cfa4a6b3a75f --- /dev/null +++ b/recipes/fred2/build.sh @@ -0,0 +1,3 @@ +#Patch away the install requires, we're getting these through conda directly +sed -i 's/install_requires/#install_requires/g' setup.py +$PYTHON setup.py install \ No newline at end of file diff --git a/recipes/fred2/meta.yaml b/recipes/fred2/meta.yaml new file mode 100644 index 0000000000000..b41d0e8c2eb83 --- /dev/null +++ b/recipes/fred2/meta.yaml @@ -0,0 +1,49 @@ +{% set name = "fred2" %} +{% set version = "2.0.2" %} +{% set sha256 = "223f139b35357e25d98644eb2668b9140f1489f4befd1e337a83fa6253cc0d54" %} + +package: + name: {{ name|lower }} + version: {{ version }} + +source: + url: https://github.com/FRED-2/Fred2/archive/{{ version }}.tar.gz + sha256: '{{ sha256 }}' + +build: + noarch: python + number: 2 + + skip: True # [not py27] + +requirements: + host: + - python + - setuptools + - pyomo + - pandas + - pyvcf + - biopython + - mysql-python + run: + - python + - setuptools + - pyomo + - pandas + - pyvcf + - biopython + - mysql-python + +test: + commands: + - python -c "from Fred2.Core import Allele, Peptide, Protein,generate_peptides_from_proteins" + +about: + home: https://fred-2.github.io + license: BSD + summary: 'Python-based framework for computational immunomics.' + +extra: + container: + # extended-base generates en_US.UTF-8 locale and sets LC_ALL, LANG properly + extended-base: true diff --git a/recipes/gatb/1.4.1/build.sh b/recipes/gatb/1.4.1/build.sh index 69435a916f9ca..565cf0bb31836 100644 --- a/recipes/gatb/1.4.1/build.sh +++ b/recipes/gatb/1.4.1/build.sh @@ -15,6 +15,6 @@ ln -s ${PREFIX}/include ${PREFIX}/include/hdf5 mkdir build cd build -cmake -DCMAKE_INSTALL_PREFIX=$PREFIX .. -make +cmake -DCMAKE_INSTALL_PREFIX:PATH=$PREFIX -DZLIB_INCLUDE_DIR:PATH=$PREFIX"/include" .. +make VERBOSE=1 make install diff --git a/recipes/gb_taxonomy_tools/meta.yaml b/recipes/gb_taxonomy_tools/meta.yaml index 34f8ffd5d7e7f..e654c6ea1f621 100644 --- a/recipes/gb_taxonomy_tools/meta.yaml +++ b/recipes/gb_taxonomy_tools/meta.yaml @@ -4,9 +4,9 @@ about: license: GNU General Public License v2.0 package: name: gb_taxonomy_tools - version: 1.0.0 + version: 1.0.1 build: - number: 1 + number: 0 skip: True # [osx] requirements: build: @@ -15,5 +15,5 @@ test: commands: - which taxonomy-reader source: - url: https://github.com/spond/gb_taxonomy_tools/archive/1.0.0.tar.gz - sha256: d3a887ecf8f9d5f06341bec5babcbdbba0c71ef8f5cdd392e1825cdea30a2a0c + url: https://github.com/spond/gb_taxonomy_tools/archive/1.0.1.tar.gz + sha256: d9c0901a66db19fc0f77d02316f663200f739db998746037fcf23e36db9377f4 diff --git a/recipes/genenotebook/meta.yaml b/recipes/genenotebook/meta.yaml index c6176b94bfa5c..31494fe13b885 100644 --- a/recipes/genenotebook/meta.yaml +++ b/recipes/genenotebook/meta.yaml @@ -1,6 +1,6 @@ {% set name = 'GeneNoteBook' %} -{% set version = '0.1.4' %} -{% set sha256 = '556b01d6ff414a1f6b8433fecc294c6ad6c23ea9171c57bcaa98bc20831f6e74' %} +{% set version = '0.1.5' %} +{% set sha256 = '6196e6c8ad3aebbd356f291f641f5a698f13f36578497f6534e70aee900dde05' %} package: name: {{ name|lower }} @@ -13,16 +13,16 @@ source: requirements: host: - jq - - nodejs + - nodejs>=8.0 build: - {{ compiler('cxx') }} run: - blast - - nodejs - - mongodb + - nodejs>=8.0 + - mongodb>=3.4 build: - number: 0 + number: 1 test: commands: @@ -32,4 +32,4 @@ about: home: https://genenotebook.github.io license: AGPL-3.0 license_file: LICENSE - summary: A colleborative notebook for comparative genomics \ No newline at end of file + summary: A colleborative notebook for comparative genomics diff --git a/recipes/genomicconsensus/meta.yaml b/recipes/genomicconsensus/meta.yaml index 51946456d34e2..aeaf0964be524 100644 --- a/recipes/genomicconsensus/meta.yaml +++ b/recipes/genomicconsensus/meta.yaml @@ -22,21 +22,21 @@ extra: build: skip: True # [not py27 or osx] - number: 2 + number: 3 requirements: host: - python - setuptools - numpy >=1.15 - - pbcore >=1.5.1 + - pbcore >=1.6.5 - pbcommand >=1.1.1 - python-consensuscore >=1.1.1 - python-consensuscore2 >=3.1.0 run: - python - numpy >=1.15 - - pbcore >=1.5.1 + - pbcore >=1.6.5 - pbcommand >=1.1.1 - python-consensuscore >=1.1.1 - python-consensuscore2 >=3.1.0 diff --git a/recipes/gffcompare/meta.yaml b/recipes/gffcompare/meta.yaml index 20084e658ac38..2781c16b18ad2 100644 --- a/recipes/gffcompare/meta.yaml +++ b/recipes/gffcompare/meta.yaml @@ -1,13 +1,13 @@ {% set name = "gffcompare" %} -{% set version = "0.10.1" %} -{% set sha256hash = "32912f4d1394294203e055b2c1bb33a051d8a069d1046d79f543d1a028d7128d" %} +{% set version = "0.10.5" %} +{% set sha256hash = "fce3b8c469f6d9225552f9905f865306f302bb9edd466f7e2a94dff2db313583" %} package: name: {{ name }} version: {{ version }} build: - number: 1 + number: 0 skip: False source: diff --git a/recipes/gmap/2018.03.25/build.sh b/recipes/gmap/2018.03.25/build.sh new file mode 100644 index 0000000000000..fa8544a91e011 --- /dev/null +++ b/recipes/gmap/2018.03.25/build.sh @@ -0,0 +1,9 @@ +#!/bin/sh + +export C_INCLUDE_PATH=${PREFIX}/include +export LD_LIBRARY_PATH=${PREFIX}/lib +export LDFLAGS="-L${PREFIX}/lib" + +env MAX_READLENGTH=500 ./configure --prefix=${PREFIX} --with-simd-level=sse42 +make -j 2 +make install prefix=${PREFIX} diff --git a/recipes/gmap/2018.03.25/meta.yaml b/recipes/gmap/2018.03.25/meta.yaml new file mode 100644 index 0000000000000..f073cfcf930f4 --- /dev/null +++ b/recipes/gmap/2018.03.25/meta.yaml @@ -0,0 +1,54 @@ +package: + name: gmap + version: "2018.03.25" +source: + url: http://research-pub.gene.com/gmap/src/gmap-gsnap-2018-03-25.tar.gz + sha256: a65bae6115fc50916ad7425d0b5873b611c002690bf35026bfcfc41ee0c0265a +requirements: + build: + - {{ compiler('c') }} + host: + - perl + - zlib + - bzip2 + run: + - perl + - zlib + - bzip2 +about: + home: http://research-pub.gene.com/gmap/ + license: Non-commercial + summary: Genomic mapping and alignment program for mRNA and EST sequences +build: + number: 1 + binary_has_prefix_files: + - bin/atoiindex + - bin/cmetindex + - bin/get-genome + - bin/gmap.sse42 + - bin/gmap.nosimd + - bin/gmapl.sse42 + - bin/gmapl.nosimd + - bin/gsnap.sse42 + - bin/gsnap.nosimd + - bin/gsnapl.sse42 + - bin/gsnapl.nosimd + - bin/sam_sort + - bin/snpindex + - bin/uniqscan + - bin/uniqscanl + has_prefix_files: + - bin/gff3_introns + - bin/gff3_splicesites + - bin/gmap_build + - bin/gmap_uncompress + - bin/gtf_introns + - bin/gtf_splicesites +test: + commands: + - gmap --version + - gsnap --version + +extra: + identifiers: + - biotools:gmap diff --git a/recipes/gmap/build.sh b/recipes/gmap/build.sh index fa8544a91e011..210f0cbfa386c 100644 --- a/recipes/gmap/build.sh +++ b/recipes/gmap/build.sh @@ -4,6 +4,6 @@ export C_INCLUDE_PATH=${PREFIX}/include export LD_LIBRARY_PATH=${PREFIX}/lib export LDFLAGS="-L${PREFIX}/lib" -env MAX_READLENGTH=500 ./configure --prefix=${PREFIX} --with-simd-level=sse42 +./configure --prefix=${PREFIX} --with-simd-level=sse42 make -j 2 make install prefix=${PREFIX} diff --git a/recipes/gmap/meta.yaml b/recipes/gmap/meta.yaml index f073cfcf930f4..b2f25a36285cb 100644 --- a/recipes/gmap/meta.yaml +++ b/recipes/gmap/meta.yaml @@ -1,9 +1,9 @@ package: name: gmap - version: "2018.03.25" + version: "2018.07.04" source: - url: http://research-pub.gene.com/gmap/src/gmap-gsnap-2018-03-25.tar.gz - sha256: a65bae6115fc50916ad7425d0b5873b611c002690bf35026bfcfc41ee0c0265a + url: http://research-pub.gene.com/gmap/src/gmap-gsnap-2018-07-04.tar.gz + sha256: a9f8c1f0810df65b2a089dc10be79611026f4c95e4681dba98fea3d55d598d24 requirements: build: - {{ compiler('c') }} @@ -20,7 +20,7 @@ about: license: Non-commercial summary: Genomic mapping and alignment program for mRNA and EST sequences build: - number: 1 + number: 0 binary_has_prefix_files: - bin/atoiindex - bin/cmetindex diff --git a/recipes/gneiss/meta.yaml b/recipes/gneiss/meta.yaml new file mode 100644 index 0000000000000..3e5a60943d574 --- /dev/null +++ b/recipes/gneiss/meta.yaml @@ -0,0 +1,64 @@ +{% set version = "0.4.4" %} +{% set hash_value = "d6cda5a3b43d174bef3567ebc243ebf64c5ba64220ce8cc9bf04dc5c436c2292" %} + +package: + name: gneiss + version: '{{ version }}' + +source: + url: https://pypi.io/packages/source/g/gneiss/gneiss-{{ version }}.tar.gz + sha256: '{{ hash_value }}' + +build: + noarch: python + number: 0 + script: python setup.py install --single-version-externally-managed --record=record.txt + +requirements: + host: + - python >3 + - setuptools + - ipython >=3.2.0 + - matplotlib >=1.4.3 + - numpy >=1.9.2 + - pandas >=0.18.0 + - scipy >=0.15.1 + - nose >=1.3.7 + - scikit-bio >=0.5.1 + - statsmodels >=0.8.0 + - biom-format + - seaborn + - bokeh + + run: + - python >3 + - ipython >=3.2.0 + - matplotlib >=1.4.3 + - numpy >=1.9.2 + - pandas >=0.18.0 + - scipy >=0.15.1 + - nose >=1.3.7 + - scikit-bio >=0.5.1 + - statsmodels >=0.8.0 + - biom-format + - seaborn + - bokeh + +test: + imports: + - gneiss + - gneiss.cluster + - gneiss.cluster.tests + - gneiss.composition + - gneiss.plot + - gneiss.regression + - gneiss.regression.tests + - gneiss.sim + - gneiss.tests + +about: + home: https://biocore.github.io/gneiss/ + license: BSD + license_family: BSD + summary: Compositional data analysis tools and visualizations + diff --git a/recipes/goatools/meta.yaml b/recipes/goatools/meta.yaml index 4b538036d1500..cb3538b6aec7a 100644 --- a/recipes/goatools/meta.yaml +++ b/recipes/goatools/meta.yaml @@ -1,11 +1,11 @@ -{% set version = "0.8.4" %} +{% set version = "0.8.9" %} package: name: goatools version: '{{version}}' source: url: https://pypi.io/packages/source/g/goatools/goatools-{{version}}.tar.gz - sha256: 7d12be0acbc1515e139cd0f12ee9f8f2a7bf245367a75331a829ddbc608190ac + sha256: 846531b8c95aec1ffe952cceed9816524626f6fbfd4059a6d469e75cc6207f0e build: noarch: python diff --git a/recipes/goleft/meta.yaml b/recipes/goleft/meta.yaml index 3cfcf38afaf55..f5879ee3b39fc 100644 --- a/recipes/goleft/meta.yaml +++ b/recipes/goleft/meta.yaml @@ -1,17 +1,17 @@ -{% set version = "0.1.18" %} +{% set version = "0.2.0" %} package: name: goleft version: '{{ version }}' source: - url: https://github.com/brentp/goleft/releases/download/v{{ version }}/goleft_linux64 # [linux] - sha256: bd9049b67f9e176714f0dca5f4920738702899467dd3058d2e0712b77b7c3125 # [linux] - url: https://github.com/brentp/goleft/releases/download/v{{ version }}/goleft_osx # [osx] - sha256: 83766ef01804609b70f1fec65d45a182e573fe4f621f6fa25adc4bbd50e54d51 # [osx] + url: https://github.com/brentp/goleft/releases/download/v{{ version }}/goleft_linux64 # [linux] + sha256: 8b22b6a6340bf8801453886330b1f8ff7d455312124388e6dbaa902f4750baf2 # [linux] + url: https://github.com/brentp/goleft/releases/download/v{{ version }}/goleft_osx # [osx] + sha256: 1962312ad0aa546e9ee57daadaa509a12cc44bfbe8b377aaf5ff2ca2899ce537 # [osx] build: - number: 1 + number: 0 binary_relocation: false requirements: diff --git a/recipes/graphclust-wrappers/build.sh b/recipes/graphclust-wrappers/build.sh index 86c2d243d1654..0c2679a338cc6 100644 --- a/recipes/graphclust-wrappers/build.sh +++ b/recipes/graphclust-wrappers/build.sh @@ -2,5 +2,7 @@ #Copy binery file since there is no INSTALL part in the makefile chmod +x galaxy_wrappers/*/*.pl +chmod +x galaxy_wrappers/*/*.py cp galaxy_wrappers/*/*.pl $PREFIX/bin/ +cp galaxy_wrappers/*/*.py $PREFIX/bin/ diff --git a/recipes/graphclust-wrappers/meta.yaml b/recipes/graphclust-wrappers/meta.yaml index 044f99262d8ff..96b3b5a98c847 100644 --- a/recipes/graphclust-wrappers/meta.yaml +++ b/recipes/graphclust-wrappers/meta.yaml @@ -1,10 +1,10 @@ package: name: graphclust-wrappers - version: '0.5.2' + version: '0.6.0' source: - url: https://github.com/BackofenLab/GraphClust/archive/0.7.6-galaxy0.5.2.tar.gz - sha256: 1cd373dbf7636ba0f2fdd819374d8a6a745e1b47cc50ef7f5e54c78c386f9a9f + url: https://github.com/BackofenLab/GraphClust/archive/0.7.6-galaxy0.6.0.tar.gz + sha256: 4943fe63773a7aa152fd6332e5d89dbbdf0a4376df25cf72599fd45931840db6 build: number: 1 @@ -15,14 +15,21 @@ requirements: - perl >=5.22.0 - perl-math-round - perl-array-utils + - pandas =0.23.0 + - biopython =1.70.0 run: - perl >=5.22.0 - perl-math-round - perl-array-utils + - pandas =0.23.0 + - biopython =1.70.0 test: commands: + - gc_align_clusters.pl -help 2>&1 | grep -i 'usage' > /dev/null + - extract_conservation_metrics.py 2>&1 | grep "Format" > /dev/null + - aggregate_align_metrics.py --help | grep -i 'usage' > /dev/null - mloc2stockholm.pl --h 2>&1 | grep "USAGE" > /dev/null - fasta2shrep_gspan.pl --h 2>&1 | grep "Usage" > /dev/null - structure_2_gspan.pl --h 2>&1 | grep "Usage" > /dev/null diff --git a/recipes/graphicsmagick/1.3.23/build.sh b/recipes/graphicsmagick/1.3.23/build.sh deleted file mode 100644 index 568c7f4bae141..0000000000000 --- a/recipes/graphicsmagick/1.3.23/build.sh +++ /dev/null @@ -1,5 +0,0 @@ -#!/bin/env bash - -./configure --prefix=$PREFIX --enable-shared -make -make install diff --git a/recipes/graphicsmagick/1.3.23/meta.yaml b/recipes/graphicsmagick/1.3.23/meta.yaml deleted file mode 100644 index c85e873eefec3..0000000000000 --- a/recipes/graphicsmagick/1.3.23/meta.yaml +++ /dev/null @@ -1,44 +0,0 @@ -package: - name: graphicsmagick - version: 1.3.23 - -build: - number: 6 - -source: - url: ftp://ftp.graphicsmagick.org/pub/GraphicsMagick/1.3/GraphicsMagick-1.3.23.tar.gz - sha256: cb320e009173c66927041a675755fad454b8aadf1da2c6fd1d65eac298c556db - -requirements: - build: - - {{ compiler('c') }} - host: - - ghostscript - - libpng - - gnuplot - - xorg-libsm - - libwebp - - freetype - - xorg-libxext - - xorg-libxdmcp - - xorg-libxau - run: - - ghostscript - - libpng - - gnuplot - - xorg-libsm - - libwebp - - freetype - - xorg-libxext - - xorg-libxdmcp - - xorg-libxau - - xorg-libx11 - -test: - commands: - - gm -help | grep "Usage" - -about: - home: http://www.graphicsmagick.org/ - license: MIT - summary: GraphicsMagick is the swiss army knife of image processing diff --git a/recipes/graphicsmagick/1.3.26/build.sh b/recipes/graphicsmagick/1.3.26/build.sh deleted file mode 100644 index 39fa825f05292..0000000000000 --- a/recipes/graphicsmagick/1.3.26/build.sh +++ /dev/null @@ -1,5 +0,0 @@ -#!/bin/env bash - -./configure --prefix=$PREFIX --enable-shared --enable-symbol-prefix -make -make install diff --git a/recipes/graphicsmagick/1.3.26/meta.yaml b/recipes/graphicsmagick/1.3.26/meta.yaml deleted file mode 100644 index 0180ed0d2ed1b..0000000000000 --- a/recipes/graphicsmagick/1.3.26/meta.yaml +++ /dev/null @@ -1,48 +0,0 @@ -package: - name: graphicsmagick - version: 1.3.26 - -build: - number: 2 - -source: - url: https://sourceforge.net/projects/graphicsmagick/files/graphicsmagick/1.3.26/GraphicsMagick-1.3.26.tar.gz - sha256: ab06d07cda5181f7829714c9f5641c0a93a0c3af2dacd747ed48d534e1ed0b3a - -requirements: - build: - - {{ compiler('c') }} - - ghostscript - - libpng - - gnuplot - - xorg-libsm - - libwebp - - freetype - - xorg-libxext - - xorg-libxdmcp - - xorg-libxau - - libtiff - - jpeg - - run: - - ghostscript - - libpng - - gnuplot - - xorg-libsm - - libwebp - - freetype - - xorg-libxext - - xorg-libxdmcp - - xorg-libxau - - xorg-libx11 - - libtiff - - jpeg - -test: - commands: - - gm -help | grep "Usage" - -about: - home: http://www.graphicsmagick.org/ - license: MIT - summary: GraphicsMagick is the swiss army knife of image processing diff --git a/recipes/grid/build.sh b/recipes/grid/build.sh index 22d1e0eea23c6..be86c349b3d4d 100644 --- a/recipes/grid/build.sh +++ b/recipes/grid/build.sh @@ -7,7 +7,7 @@ mkdir -p $PREFIX/bin cd $SRC_DIR -cp grid GRiD*.R README.md update_database bowtie.txt check_R_libraries.R $outdir +cp grid GRiD*.R README.md update_database check_R_libraries.R $outdir cp -R blast_database $outdir chmod +x $outdir/grid $outdir/update_database ln -s $outdir/grid $PREFIX/bin/grid diff --git a/recipes/grid/meta.yaml b/recipes/grid/meta.yaml index 8989bbc07e6d8..edfa1b22ec8cb 100644 --- a/recipes/grid/meta.yaml +++ b/recipes/grid/meta.yaml @@ -1,23 +1,25 @@ package: name: grid - version: "1.0.6" - -source: - url: https://github.com/ohlab/GRiD/archive/1.0.6.tar.gz - sha256: 8a4f55124375b797189551ccebb4d28fa01d2d51316ce372ba9c3beab94736ae + version: "1.1" build: + number: 1 noarch: generic - + +source: + url: https://github.com/ohlab/GRiD/archive/1.1.tar.gz + sha256: cb2781d4b2d54da138042de9c4486d273f45282ad5f85c520a6e2087122784fd + requirements: run: + - parallel - pathoscope - r-dplyr - r-ggplot2 - r-gplots - r-getopt - r-gsubfn - - samtools=0.1.19 + - samtools - bamtools - bowtie2 - seqtk diff --git a/recipes/groot/meta.yaml b/recipes/groot/meta.yaml index b0d5f86267395..986d0ee4f48e0 100644 --- a/recipes/groot/meta.yaml +++ b/recipes/groot/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "0.7.1" %} +{% set version = "0.8.3" %} package: name: groot @@ -6,7 +6,7 @@ package: source: url: https://github.com/will-rowe/groot/archive/{{ version }}.tar.gz - sha256: ba5ea4b4504544f56d7f80c8179a917a7cbe740bb6673bc40c08256a2ef3a471 + sha256: 1a50c0e0a5a13f67758aa2c9b1daaee755f191749c7e98cef3ed9ade8ac250ce build: number: 1 diff --git a/recipes/gseapy/meta.yaml b/recipes/gseapy/meta.yaml index d3d4ffd7b4601..3d926585e3983 100644 --- a/recipes/gseapy/meta.yaml +++ b/recipes/gseapy/meta.yaml @@ -1,16 +1,16 @@ package: name: gseapy - version: "0.9.5" + version: "0.9.8" source: - url: https://files.pythonhosted.org/packages/f1/08/77fd8641e811f628cf9ba402c151b9242b52f2956543b9e7162e0f86da7e/gseapy-0.9.5.tar.gz - sha256: 1eb02f4056d089e26422105279546061629b8667307808297c3198d003b324b5 + url: https://files.pythonhosted.org/packages/6f/1c/ed8881ad80e7c1ff0e21a1ee73ea75b784524493ecd5e720323f619211c8/gseapy-0.9.8.tar.gz + sha256: af34016b763fbf7f05339be13c8002ec2fb164647389ff35de819412c3be6a24 build: - noarch: python + skip: True # [py27] entry_points: - gseapy = gseapy.__main__:main - number: 1 + number: 0 requirements: host: diff --git a/recipes/hapbin/meta.yaml b/recipes/hapbin/meta.yaml index 2d32a84ae703e..ca2a2375de356 100644 --- a/recipes/hapbin/meta.yaml +++ b/recipes/hapbin/meta.yaml @@ -1,14 +1,14 @@ package: name: hapbin - version: 1.0.0 + version: 1.3.0 build: - number: 1 + number: 0 skip: True # [osx] source: - url: https://github.com/evotools/hapbin/archive/v1.0.0.tar.gz - md5: e5990a38b1e3cdd3f2229cf1e9310804 + url: https://github.com/evotools/hapbin/archive/v1.3.0.tar.gz + sha256: 2443cb1783a5f40c042d02e84eece97220c38530e8d887b2d3c5e9354400f92d requirements: build: diff --git a/recipes/hicmatrix/meta.yaml b/recipes/hicmatrix/meta.yaml index 2f10084a241d0..6c3c3f4402498 100644 --- a/recipes/hicmatrix/meta.yaml +++ b/recipes/hicmatrix/meta.yaml @@ -1,13 +1,13 @@ package: name: hicmatrix - version: '2.2' + version: '3' source: - url: https://github.com/deeptools/HiCMatrix/archive/2.2.tar.gz - sha256: c26e659d6efa2f6ee6b35476c84798857563bea544b0ed77600d982d1474f534 + url: https://github.com/deeptools/HiCMatrix/archive/3.tar.gz + sha256: aa63dfda78779063b50af65a08d0bb8cba2d473a1caf10c28823ab868c838e48 build: - number: 1 + number: 0 noarch: python requirements: diff --git a/recipes/hlama/meta.yaml b/recipes/hlama/meta.yaml index 523bb2b787626..98e6f04518bcc 100644 --- a/recipes/hlama/meta.yaml +++ b/recipes/hlama/meta.yaml @@ -1,9 +1,9 @@ package: name: hlama - version: "0.3.1" + version: "3.0.1" build: - number: 2 + number: 0 # snakemake 3.7.1 is not available for python 3.6 # the snakemake dependency should be relaxed to allow for a newer version skip: True # [not py35 or osx] @@ -11,8 +11,8 @@ build: - hlama = hlama.app:main source: - url: https://github.com/bihealth/hlama/archive/v0.3.1.tar.gz - md5: be667006ccc332751ac6841da0db3e5c + url: https://github.com/bihealth/hlama/archive/v3.0.1.tar.gz + sha256: a304567d0a0fe544344d069444da2cb106c019deba6665b9cf11b1727546384e requirements: host: diff --git a/recipes/hmftools-cobalt/COBALT.sh b/recipes/hmftools-cobalt/COBALT.sh new file mode 100755 index 0000000000000..074b7655310ff --- /dev/null +++ b/recipes/hmftools-cobalt/COBALT.sh @@ -0,0 +1,69 @@ +#!/bin/bash +# hmftools COBALT executable shell script +# https://github.com/hartwigmedical/hmftools/tree/master/count-bam-lines +set -eu -o pipefail + +export LC_ALL=en_US.UTF-8 + +# Find original directory of bash script, resolving symlinks +# http://stackoverflow.com/questions/59895/can-a-bash-script-tell-what-directory-its-stored-in/246128#246128 +SOURCE="${BASH_SOURCE[0]}" +while [ -h "$SOURCE" ]; do # resolve $SOURCE until the file is no longer a symlink + DIR="$( cd -P "$( dirname "$SOURCE" )" && pwd )" + SOURCE="$(readlink "$SOURCE")" + [[ $SOURCE != /* ]] && SOURCE="$DIR/$SOURCE" # if $SOURCE was a relative symlink, we need to resolve it relative to the path where the symlink file was located +done +DIR="$( cd -P "$( dirname "$SOURCE" )" && pwd )" + +JAR_DIR=$DIR +ENV_PREFIX="$(dirname $(dirname $DIR))" +# Use Java installed with Anaconda to ensure correct version +java="$ENV_PREFIX/bin/java" + +# if JAVA_HOME is set (non-empty), use it. Otherwise keep "java" +if [ -n "${JAVA_HOME:=}" ]; then + if [ -e "$JAVA_HOME/bin/java" ]; then + java="$JAVA_HOME/bin/java" + fi +fi + +# extract memory and system property Java arguments from the list of provided arguments +# http://java.dzone.com/articles/better-java-shell-script +default_jvm_mem_opts="-Xms512m -Xmx1g" +jvm_mem_opts="" +jvm_prop_opts="" +pass_args="" +for arg in "$@"; do + case $arg in + '-D'*) + jvm_prop_opts="$jvm_prop_opts $arg" + ;; + '-XX'*) + jvm_prop_opts="$jvm_prop_opts $arg" + ;; + '-Xm'*) + jvm_mem_opts="$jvm_mem_opts $arg" + ;; + *) + if [[ ${pass_args} == '' ]] #needed to avoid preceeding space on first arg e.g. ' MarkDuplicates' + then + pass_args="$arg" + else + pass_args="$pass_args \"$arg\"" #quotes later arguments to avoid problem with ()s in MarkDuplicates regex arg + fi + ;; + esac +done + +if [ "$jvm_mem_opts" == "" ]; then + jvm_mem_opts="$default_jvm_mem_opts" +fi + +pass_arr=($pass_args) +if [[ ${pass_arr[0]:=} == org* ]] +then + eval "$java" $jvm_mem_opts $jvm_prop_opts -cp "$JAR_DIR/cobalt.jar" $pass_args +else + eval "$java" $jvm_mem_opts $jvm_prop_opts -jar "$JAR_DIR/cobalt.jar" $pass_args +fi +exit diff --git a/recipes/hmftools-cobalt/build.sh b/recipes/hmftools-cobalt/build.sh new file mode 100644 index 0000000000000..19c6d9c70f11c --- /dev/null +++ b/recipes/hmftools-cobalt/build.sh @@ -0,0 +1,12 @@ +#!/bin/bash + +TGT="$PREFIX/share/$PKG_NAME-$PKG_VERSION-$PKG_BUILDNUM" +[ -d "$TGT" ] || mkdir -p "$TGT" +[ -d "${PREFIX}/bin" ] || mkdir -p "${PREFIX}/bin" + +cd "${SRC_DIR}" +mv cobalt*.jar $TGT/cobalt.jar + +cp $RECIPE_DIR/COBALT.sh $TGT/COBALT +ln -s $TGT/COBALT $PREFIX/bin +chmod 0755 "${PREFIX}/bin/COBALT" diff --git a/recipes/hmftools-cobalt/meta.yaml b/recipes/hmftools-cobalt/meta.yaml new file mode 100644 index 0000000000000..de7bee91066f6 --- /dev/null +++ b/recipes/hmftools-cobalt/meta.yaml @@ -0,0 +1,29 @@ +{% set version = "1.5" %} +{% set sha256 = "f3faa2b0d63beab5a074f0cc9e3841c083c3ff7eb4b7d06fdff6f538148d18bb" %} + +package: + name: hmftools-cobalt + version: '{{ version }}' + +source: + url: https://github.com/hartwigmedical/hmftools/releases/download/cobalt-v{{ version|replace(".", "-") }}/cobalt-{{ version }}.jar + sha256: '{{ sha256 }}' + +build: + noarch: generic + number: 0 + +requirements: + run: + - openjdk >=8 + +test: + commands: + - 'COBALT 2>&1 | grep version' + - 'COBALT 2>&1 | grep usage' + +about: + home: https://github.com/hartwigmedical/hmftools/tree/master/count-bam-lines + license: MIT + license_family: MIT + summary: Count bam lines is designed to count the number of read starts within each 1000 base window of a tumor and reference bam. diff --git a/recipes/hmftools-purple/meta.yaml b/recipes/hmftools-purple/meta.yaml index 57264760c7a36..e79633ccd0ed0 100644 --- a/recipes/hmftools-purple/meta.yaml +++ b/recipes/hmftools-purple/meta.yaml @@ -1,5 +1,5 @@ -{% set version = "2.15" %} -{% set sha256 = "8846f6711e98c411ef4f42549d472c0b3f5c5535e2ee654f9ac19ba5ffc6faa9" %} +{% set version = "2.16" %} +{% set sha256 = "d6143fda59d10b9fcda6299bbe8a9180a1c1adb63e65cb1888166274f746c796" %} package: name: hmftools-purple @@ -11,11 +11,12 @@ source: build: noarch: generic - number: 0 + number: 1 requirements: run: - openjdk >=8 + - xorg-libxtst test: commands: diff --git a/recipes/umi_tools/build.sh b/recipes/hmmlearn/0.1.1/build.sh similarity index 98% rename from recipes/umi_tools/build.sh rename to recipes/hmmlearn/0.1.1/build.sh index 3786386a73c83..89481145a5291 100644 --- a/recipes/umi_tools/build.sh +++ b/recipes/hmmlearn/0.1.1/build.sh @@ -1,3 +1,2 @@ #!/bin/bash - $PYTHON setup.py install --single-version-externally-managed --record=record.txt diff --git a/recipes/hmmlearn/0.1.1/meta.yaml b/recipes/hmmlearn/0.1.1/meta.yaml new file mode 100644 index 0000000000000..c26245059cc97 --- /dev/null +++ b/recipes/hmmlearn/0.1.1/meta.yaml @@ -0,0 +1,37 @@ +package: + name: hmmlearn + version: '0.1.1' + +source: + url: https://github.com/hmmlearn/hmmlearn/archive/0.1.1.tar.gz + sha256: 307233053218a71fea714d6c9d160e6d6579752c6264200f411a17917add4d25 + +build: + number: 0 + skip: True # [osx] + +requirements: + host: + - python >=2.7,<3 + - setuptools + - cython + - numpy + - scipy + - scikit-learn <0.20 + + run: + - python >=2.7,<3 + - setuptools + - numpy + - scipy + - scikit-learn <0.20 + +test: + imports: + - hmmlearn.hmm + +about: + home: https://github.com/hmmlearn/hmmlearn + license: BSD + summary: Hidden Markov Models in Python, with scikit-learn like API + diff --git a/recipes/hotspot3d/meta.yaml b/recipes/hotspot3d/meta.yaml index 3ba5f6a0064dc..2ff1fc7fa29fa 100644 --- a/recipes/hotspot3d/meta.yaml +++ b/recipes/hotspot3d/meta.yaml @@ -1,7 +1,7 @@ {% set name = "hotspot3d" %} -{% set version = "0.6.0" %} +{% set version = "1.8.2" %} {% set hash_type = "sha256" %} -{% set hash_value = "572d8d954bfe46062d9361a9f84072608e90a10f1c553b3e913a93f7495647be" %} +{% set hash_value = "e8351925181d17dc990b65834ebb9878e1b5449d33cca0b022d9a263a940f868" %} package: name: '{{ name|lower }}' @@ -23,6 +23,8 @@ requirements: - perl-list-moreutils - perl-parallel-forkmanager - perl-app-cpanminus + - perl-json + - perl-archive-extract run: - perl @@ -31,6 +33,8 @@ requirements: - perl-list-util - perl-list-moreutils - perl-parallel-forkmanager + - perl-json + - perl-archive-extract test: commands: diff --git a/recipes/hulk/meta.yaml b/recipes/hulk/meta.yaml index d08516a814b0a..586fb35178b7a 100644 --- a/recipes/hulk/meta.yaml +++ b/recipes/hulk/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "0.1.0" %} +{% set version = "0.1.2" %} package: name: hulk @@ -6,7 +6,7 @@ package: source: url: https://github.com/will-rowe/hulk/archive/{{ version }}.tar.gz - sha256: 6ce970a030f419d2355c6f989e8556aa9be886fde31c9cfa6747ebe60dbfb200 + sha256: d27a5e862be461861e10a8c36835749b208d2b1c997e0d81e297525b592f5e64 build: number: 1 diff --git a/recipes/igblast/build.sh b/recipes/igblast/build.sh index 25d33a976b186..198ca081e843e 100644 --- a/recipes/igblast/build.sh +++ b/recipes/igblast/build.sh @@ -6,34 +6,27 @@ SHARE_DIR=$PREFIX/share/igblast mkdir -p $PREFIX/bin -# This is going to contain the igblastn and igblastp binaries. -# Only wrappers are installed into $PREFIX/bin/ . -mkdir -p $SHARE_DIR/bin - if [ $(uname) == Linux ]; then - # If on Linux, compile the tool ourselves because the distributed binaries - # link against libbz2.so, and the usual conda bzip2 package does not - # provide this. See https://github.com/bioconda/bioconda-recipes/pull/3020 - - cd c++ - ./configure --prefix=$PREFIX --with-sqlite3=$PREFIX - make -j2 - mv ReleaseMT/bin/{igblastn,igblastp} $SHARE_DIR/bin/ - mv ReleaseMT/bin/makeblastdb $PREFIX/bin/ -else - # On macOS, use the prebuilt binaries - mv bin/makeblastdb $PREFIX/bin/ - mv bin/igblastn bin/igblastp $SHARE_DIR/bin/ + # The binaries want libbz2.so.1, but the correct soname is libbz2.so.1.0 + for name in makeblastdb igblastn igblastp; do + patchelf --replace-needed libbz2.so.1 libbz2.so.1.0 bin/$name + done fi +# $SHARE_DIR contains the actual igblastn and igblastp binaries and also the +# required data files. Wrappers will be installed into $PREFIX/bin that set +# $IGDATA to point to those data files. +mkdir -p $SHARE_DIR/bin -# Since IgBLAST needs the environment variable IGDATA in order to find its -# data files (download below), the igblastn and igblastp binaries will be -# wrappers that set IGDATA to $SCRIPT_DIR/../share/igblast. -cp -f $RECIPE_DIR/igblastn.sh $PREFIX/bin/igblastn -sed 's/igblastn/igblastp/g' $PREFIX/bin/igblastn > $PREFIX/bin/igblastp -chmod +x $PREFIX/bin/igblastn $PREFIX/bin/igblastp +# Copy binaries and wrappers +for name in igblastn igblastp; do + mv bin/$name $SHARE_DIR/bin/ + sed "s/igblastn/$name/g" $RECIPE_DIR/igblastn.sh > $PREFIX/bin/$name + chmod +x $PREFIX/bin/$name +done +# No wrapper needed +mv bin/makeblastdb $PREFIX/bin/ wget $IGBLAST_ADDRESS/edit_imgt_file.pl # Replace the hardcoded perl shebang pointing to /opt with `#!/usr/bin/env perl`. @@ -48,5 +41,5 @@ mv edit_imgt_file.pl $PREFIX/bin/ for IGBLAST_DIR in internal_data optional_file; do mkdir -p $SHARE_DIR/$IGBLAST_DIR - wget -nv -r -nH --cut-dirs=5 -X Entries,Repository,Root -P $SHARE_DIR/$IGBLAST_DIR $IGBLAST_ADDRESS/$IGBLAST_DIR + wget -nv -r -nH --cut-dirs=5 -X Entries,Repository,Root,CVS -P $SHARE_DIR/$IGBLAST_DIR $IGBLAST_ADDRESS/$IGBLAST_DIR done diff --git a/recipes/igblast/meta.yaml b/recipes/igblast/meta.yaml index 08231408cdf39..cfe024abb9be1 100644 --- a/recipes/igblast/meta.yaml +++ b/recipes/igblast/meta.yaml @@ -1,6 +1,6 @@ package: name: igblast - version: "1.7.0" + version: "1.10.0" about: home: http://www.ncbi.nlm.nih.gov/projects/igblast/ @@ -8,31 +8,36 @@ about: summary: A tool for analyzing immunoglobulin (IG) and T cell receptor (TR) sequences. source: - # Use sources on Linux, binaries on macOS - md5: 238857cff5de770ac3fc93d96526a247 # [linux] - md5: a28c6cab4c9706c330e6496f3450da9e # [osx] - url: ftp://ftp.ncbi.nih.gov/blast/executables/igblast/release/1.7.0/ncbi-igblast-1.7.0-src.tar.gz # [linux] - url: ftp://ftp.ncbi.nih.gov/blast/executables/igblast/release/1.7.0/ncbi-igblast-1.7.0-x64-macosx.tar.gz # [osx] + sha256: a811a9b2487a8ea1f7162a4c338c1f5a898b6b0788bc30d36a3f11a77db14a76 # [linux] + sha256: c573299c2c99b6f5660b52e9e2d2ad80a404bfe2426c1f7870fd64269e7d40e9 # [osx] + url: ftp://ftp.ncbi.nih.gov/blast/executables/igblast/release/1.10.0/ncbi-igblast-1.10.0-x64-linux.tar.gz # [linux] + url: ftp://ftp.ncbi.nih.gov/blast/executables/igblast/release/1.10.0/ncbi-igblast-1.10.0-x64-macosx.tar.gz # [osx] build: - number: 1 + number: 0 requirements: build: - {{ compiler('c') }} - host: + - patchelf # [linux] - gnu-wget - - sqlite - - openssl + host: + - zlib + - bzip2 + - libidn11 + - libxml2 run: - - perl - zlib - - sqlite - - openssl - + - bzip2 + - libidn11 + - libxml2 + - perl + - gnutls # [osx] test: commands: - igblastn -h + - igblastp -h + - makeblastdb -h extra: identifiers: diff --git a/recipes/illumina-interop/meta.yaml b/recipes/illumina-interop/meta.yaml index 088908c36d799..9eb0523ee0a45 100644 --- a/recipes/illumina-interop/meta.yaml +++ b/recipes/illumina-interop/meta.yaml @@ -1,12 +1,12 @@ -{% set version = "1.1.4" %} -{% set sha256 = "875a63cea13dbdbf0a52ed84c0b0c97dc83280d0b8c3a62e3e3de516fd459692" %} +{% set version = "1.1.6" %} +{% set sha256 = "05784a5cb8be8d8a888e3b359e541f379b3463cabf246d7b9705a2f6eb741b5d" %} package: name: illumina-interop version: '{{version}}' build: - number: 3 + number: 0 skip: true # [osx] source: diff --git a/recipes/illumina-utils/meta.yaml b/recipes/illumina-utils/meta.yaml new file mode 100644 index 0000000000000..be046139a2b1c --- /dev/null +++ b/recipes/illumina-utils/meta.yaml @@ -0,0 +1,43 @@ +{% set version = "2.4.1" %} + +package: + name: 'illumina-utils' + version: '{{ version }}' + +source: + url: https://pypi.io/packages/source/i/illumina-utils/illumina-utils-{{ version }}.tar.gz + sha256: 'a006cb66279f526b1627954022f032a43fc6500904894c40a0c814ffafa2e5b4' + +build: + number: 0 + noarch: python + script: "{{ PYTHON }} -m pip install . --no-deps --ignore-installed --no-cache-dir -vvv" + +requirements: + host: + - python >=3 + - pip + run: + - python >=3 + - matplotlib + - python-levenshtein + - numpy + +test: + imports: + - IlluminaUtils + - IlluminaUtils.lib + - IlluminaUtils.utils + + commands: + - iu-merge-pairs -h + - iu-gen-configs -h + - iu-filter-quality-minoche -h + - iu-demultiplex -h + - iu-filter-merged-reads -h + +about: + home: https://github.com/meren/illumina-utils + license: GNU General Public v3 or later (GPLv3+) + license_family: GPL3 + summary: A library and collection of scripts to work with Illumina paired-end data (for CASAVA 1.8+). diff --git a/recipes/iqtree/meta.yaml b/recipes/iqtree/meta.yaml index 5829739db451f..aecbba556f79d 100644 --- a/recipes/iqtree/meta.yaml +++ b/recipes/iqtree/meta.yaml @@ -1,16 +1,16 @@ {% set name = "iqtree" %} -{% set version = "1.6.7" %} +{% set version = "1.6.8" %} package: name: {{ name|lower }} version: {{ version }} build: - number: 1 + number: 0 source: url: https://github.com/Cibiv/IQ-TREE/archive/v{{ version }}.tar.gz - sha256: 706278a133f194d7c07aa2d2429459c4d494029628dcd511dbf434d171131f01 + sha256: 77037032366d28c1e2c9d77e10e2b76e09495009518b5a3c546d7c1581b55b18 requirements: build: @@ -34,7 +34,7 @@ test: about: home: "http://www.iqtree.org/" license: "GPL-2.0" - summary: "Efficient phylogenomic software by maximum likelihood" + summary: "Efficient phylogenomic software by maximum likelihood." identifiers: - biotools:iq-tree - doi:10.1093/molbev/msu300 diff --git a/recipes/itero/meta.yaml b/recipes/itero/meta.yaml index 1de6fa4ccfb22..e55890fab07c9 100644 --- a/recipes/itero/meta.yaml +++ b/recipes/itero/meta.yaml @@ -1,16 +1,18 @@ -{% set version = "1.1.1" %} + {% set name = "itero" %} +{% set version = "1.1.2" %} +{% set sha256 = "1a9ee10bfc0b1146ad83f7537ab465f3be49ba3f48b6e7b80f2690d3dcd4d371" %} package: - name: {{ name }} - version: {{ version }} + name: '{{ name }}' + version: '{{ version }}' source: url: https://github.com/faircloth-lab/{{ name }}/archive/v{{ version }}.tar.gz - sha256: 6e4f1bf6aec78955216400e21074680a2072aa9a924ad34c8bccd2b9cbf69cec + sha256: '{{sha256}}' build: - number: 2 + number: 0 skip: True # [not py27] requirements: @@ -32,7 +34,7 @@ requirements: - gawk - grep - samtools - - spades + - spades 3.12.* test: imports: diff --git a/recipes/kaiju/meta.yaml b/recipes/kaiju/meta.yaml index 5a321ecc1b835..6eff2a1712f0c 100644 --- a/recipes/kaiju/meta.yaml +++ b/recipes/kaiju/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "1.6.2" %} +{% set version = "1.6.3" %} package: name: kaiju @@ -6,10 +6,10 @@ package: source: url: https://github.com/bioinformatics-centre/kaiju/archive/v{{ version }}.tar.gz - sha256: 474eb3d4cd619ce3dc456cb570f233d228154e64cce597eb8a294fa07b26b6cd + sha256: 4e2b0eccebc36307d561d713c558adb8f82414a1ea1ecf448c217812b12ef5ad build: - number: 1 + number: 0 no_link: - bin/makeDB.sh diff --git a/recipes/kodoja/meta.yaml b/recipes/kodoja/meta.yaml index 6b6656a8cf771..844b9028e459d 100644 --- a/recipes/kodoja/meta.yaml +++ b/recipes/kodoja/meta.yaml @@ -1,10 +1,10 @@ package: name: kodoja - version: "0.0.8" + version: "0.0.9" source: - url: https://github.com/abaizan/kodoja/archive/kodoja-v0.0.8.tar.gz - sha256: 4ce8fb43c6e64874ce5a35f37800c509b6dbfdf68d080286152c2322e1d9011e + url: https://github.com/abaizan/kodoja/archive/kodoja-v0.0.9.tar.gz + sha256: 282c8592aa75e68f5611b902cf4eb774facf6d5738ec3e08db192b7b2bea7806 build: noarch: python diff --git a/recipes/kraken2/Makefile.patch b/recipes/kraken2/Makefile.patch new file mode 100644 index 0000000000000..6f1c53f33b5cc --- /dev/null +++ b/recipes/kraken2/Makefile.patch @@ -0,0 +1,7 @@ +--- src/Makefile 2018-10-12 19:22:38.000000000 +0200 ++++ src/Makefile 2018-10-12 23:03:31.000000000 +0200 +@@ -1,4 +1,4 @@ +-CXX = g++ ++#CXX = g++ + CXXFLAGS = -fopenmp -Wall -std=c++11 -O3 + CXXFLAGS += -DLINEAR_PROBING diff --git a/recipes/kraken2/meta.yaml b/recipes/kraken2/meta.yaml index bdfac4a1ea427..04d945a25b670 100644 --- a/recipes/kraken2/meta.yaml +++ b/recipes/kraken2/meta.yaml @@ -9,10 +9,11 @@ package: source: url: https://github.com/DerrickWood/kraken2/archive/v2.0.7-beta.tar.gz sha256: {{ sha256 }} + patches: + - Makefile.patch build: number: 0 - skip: True # [osx] has_prefix_files: - libexec/kraken2 - libexec/kraken2-build @@ -31,7 +32,6 @@ requirements: - blast - libcxx >=4.0 # [osx] - openmp >=4.0 # [osx] - test: commands: - kraken2 --version diff --git a/recipes/krakenuniq/meta.yaml b/recipes/krakenuniq/meta.yaml index 94fe66eb8b951..c3b590ab3d28e 100644 --- a/recipes/krakenuniq/meta.yaml +++ b/recipes/krakenuniq/meta.yaml @@ -1,5 +1,5 @@ -{% set version = "0.5.2" %} -{% set sha256 = "45c639a082bfd925465784a7c8c294e1d36ba929213ed8eab4bd2e110018c126" %} +{% set version = "0.5.3" %} +{% set sha256 = "bc57fd4d5f50363aef640d61b2b111d9bef84a32e9a4eebfb977812cb8dc0250" %} package: name: krakenuniq diff --git a/recipes/krocus/meta.yaml b/recipes/krocus/meta.yaml index 3ff5da67ddbc0..61a85b92847ca 100644 --- a/recipes/krocus/meta.yaml +++ b/recipes/krocus/meta.yaml @@ -1,5 +1,5 @@ -{% set version = "1.0.0" %} -{% set sha256 = "486ff784d5225b9d747eaeda4494754d79a34924cddc148881e8e77f6d8567f7" %} +{% set version = "1.0.1" %} +{% set sha256 = "ec7a175d54190c0d0c29212d32e1bb93f9f687b2db26da4fc9f5e555312e879e" %} package: name: krocus diff --git a/recipes/loompy/meta.yaml b/recipes/loompy/meta.yaml index 3a303dd487f04..3c392b18480b8 100644 --- a/recipes/loompy/meta.yaml +++ b/recipes/loompy/meta.yaml @@ -1,5 +1,5 @@ -{% set version = "2.0.10" %} -{% set sha256 = "fc5d5e42e02fdbc073049db479ca8f2af6763230c8b5942dce6e128bb5359a3c" %} +{% set version = "2.0.16" %} +{% set sha256 = "5c5d9f60c410a91aadaf8f176a79d4427d7142af6be1f27309b3a689564665a5" %} package: name: loompy @@ -24,6 +24,7 @@ requirements: - numpy - scipy - typing + - pandas test: imports: diff --git a/recipes/maker/meta.yaml b/recipes/maker/meta.yaml index 06b30af4496ff..f9743ab0dc77d 100644 --- a/recipes/maker/meta.yaml +++ b/recipes/maker/meta.yaml @@ -10,7 +10,7 @@ source: - "mpi_init.patch" build: - number: 10 + number: 11 requirements: build: diff --git a/recipes/mapdamage2/meta.yaml b/recipes/mapdamage2/meta.yaml index 73ebe90d087fb..62cf4f47ce470 100644 --- a/recipes/mapdamage2/meta.yaml +++ b/recipes/mapdamage2/meta.yaml @@ -1,14 +1,14 @@ package: name: mapdamage2 - version: "2.0.6" + version: "2.0.8" build: noarch: python - number: 2 + number: 0 source: - url: https://github.com/ginolhac/mapDamage/archive/2.0.6.tar.gz - md5: f14e1ca52d68fd9c7e42e1f4e6f40f8c + url: https://github.com/ginolhac/mapDamage/archive/2.0.8.tar.gz + sha256: 69b8f0f6f41ef7f6f7c9d5451f5a647ea12f983464676e8e032efc3dcbc7392b patches: - makefile.patch - composition.patch diff --git a/recipes/mappy/meta.yaml b/recipes/mappy/meta.yaml index 4449dff093a50..080dc7563f308 100644 --- a/recipes/mappy/meta.yaml +++ b/recipes/mappy/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "2.12" %} +{% set version = "2.13" %} package: name: mappy @@ -6,7 +6,7 @@ package: source: url: https://pypi.io/packages/source/m/mappy/mappy-{{ version }}.tar.gz - sha256: 54645383ef0ca447b14a28d4621f87052c4b383443a4445f2ccd443c53279573 + sha256: 6a5008d53a44b157f39c5578fa6dce33ef3989270156f5e0a8fa08a19cfed21e build: number: 0 diff --git a/recipes/mathstats/meta.yaml b/recipes/mathstats/meta.yaml index 8c27a86b1075d..358b9e7fc9c47 100644 --- a/recipes/mathstats/meta.yaml +++ b/recipes/mathstats/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "0.2.6" %} +{% set version = "0.2.6.5" %} package: name: mathstats @@ -6,11 +6,11 @@ package: source: url: https://pypi.io/packages/source/m/mathstats/mathstats-{{ version }}.tar.gz - sha256: 08ab1819262dc23d459a0cfb53317ca2a0522dc1e4a5bbe37577f2e1459bf518 + sha256: bb831e49457755e2e15f85c14d6bf798d618d4e9896956f4449ee2c0bf9ef6c2 build: noarch: python - number: 1 + number: 0 requirements: host: diff --git a/recipes/megan/build.sh b/recipes/megan/build.sh new file mode 100644 index 0000000000000..f16ab190e3af8 --- /dev/null +++ b/recipes/megan/build.sh @@ -0,0 +1,25 @@ +#!/bin/bash + +# call installer +chmod u+x MEGAN_Community_unix_6_12_3.sh +MEGAN="$PREFIX/opt/$PKG_NAME-$PKG_VERSION" +./MEGAN_Community_unix_6_12_3.sh -q -dir "$MEGAN" +# link to bin/ and fix paths +# in all scripts bin_dir is defined as: +# ``` +# bin_dir=`dirname "$0"` # may be relative path +# bin_dir=`cd "$bin_dir" && pwd` # ensure absolute path +# ``` +# all other paths (eg to jars) are defined relative to bin_dir +# of course this does not work when linking/copying +# +# so we just fix this to the actual file, ie MEGAN/tools/TOOL +find "$MEGAN"/tools -type f | while read -r file +do + b=$(basename "$file") + ln -s "$file" "$PREFIX"/bin/"$b" + sed -i -e "s@\"\$0\"@\"$file\"@" "$file" +# sed -i -e "s@^bin_dir=.*@bin_dir=\"$MEGAN\/tools\"@" "$file" +done +ln -s "$MEGAN"/MEGAN "$PREFIX"/bin/MEGAN +sed -i -e "s@\"\$0\"@\"$MEGAN/MEGAN\"@" "$MEGAN"/MEGAN diff --git a/recipes/megan/meta.yaml b/recipes/megan/meta.yaml new file mode 100644 index 0000000000000..e61009562bb4c --- /dev/null +++ b/recipes/megan/meta.yaml @@ -0,0 +1,54 @@ +{% set name = "megan" %} +{% set version = "6.12.3" %} + +package: + name: {{ name|lower }} + version: {{ version }} + +source: + url: http://ab.inf.uni-tuebingen.de/data/software/megan6/download/MEGAN_Community_unix_6_12_3.sh # [linux] + sha256: a9062c33692eac51db135161d04163d412a0ec83cb94ada40f7f912186fc7529 # [linux] +# url: http://ab.inf.uni-tuebingen.de/data/software/megan6/download/MEGAN_Community_macos_6_12_3.dmg # [osx] +# sha256: 6ac0134a8774311026b3cb0969d2adaad67d50b88aa1fc89baae5419e5bf3012 # [osx] + +build: +# detect_binary_files_with_prefix: true + number: 0 + skip: True # [osx] + +requirements: + build: + - openjdk >=8.0.144 + run: + # Enforce a version requirement on openjdk to ensure + # it comes from the conda-forge channel and not default. + # Many yaks were shaved to bring us this information. + # Version number reference: https://github.com/conda/conda/issues/6948#issuecomment-369360906 + - openjdk >=8.0.144 + +test: + commands: + - aadder-run -h + - aadder-build -h + - blast2lca -h + - blast2rma -h + - daa2info -h + - daa2rma -h + - daa-meganizer -h + - extract-biome -h + - gc-assembler -h + - maf2daa -h + - rma2info -h + - sam2rma -h + - sort-last-maf -h + - references-annotator -h +# - MEGAN -h + +about: + home: 'http://ab.inf.uni-tuebingen.de/software/megan6/' + license: GPL >=3 + summary: 'A tool for studying the taxonomic content of a set of DNA reads' + +extra: + identifiers: + - biotools:megan diff --git a/recipes/meme/build.sh b/recipes/meme/build.sh index 5f450f7089118..5e40faf7d09f8 100644 --- a/recipes/meme/build.sh +++ b/recipes/meme/build.sh @@ -17,3 +17,13 @@ make AM_CFLAGS='-DNAN="(0.0/0.0)"' # make test make install + +ln -s $PREFIX/libexec/meme*/* $PREFIX/bin/ + +# if building with python3, +# modify meme-chip script to use python3 version of DREME +if [[ $PGK_BUILDNUM == *"py3"* ]] +then + sed -i '994s/dreme/dreme-py3/' $PREFIX/bin/meme-chip +fi + diff --git a/recipes/meme/meta.yaml b/recipes/meme/meta.yaml index 701c2649ef37c..9a73d102910ed 100644 --- a/recipes/meme/meta.yaml +++ b/recipes/meme/meta.yaml @@ -11,7 +11,7 @@ source: - mast.patch build: - number: 2 + number: 4 detect_binary_files_with_prefix: True requirements: @@ -38,8 +38,8 @@ requirements: - perl-html-tree - perl-math-cdf - perl-log-log4perl + - perl-json - openmpi - run: - yaml - expat @@ -59,6 +59,7 @@ requirements: - perl-html-tree - perl-math-cdf - perl-log-log4perl + - perl-json - openmpi test: diff --git a/recipes/merfishtools/meta.yaml b/recipes/merfishtools/meta.yaml index d1406fee51aa8..27549e6f3c554 100644 --- a/recipes/merfishtools/meta.yaml +++ b/recipes/merfishtools/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "1.4.0" %} +{% set version = "1.5.0" %} package: name: merfishtools @@ -10,7 +10,7 @@ build: source: url: https://github.com/merfishtools/merfishtools/archive/v{{version}}.tar.gz - sha256: 56b685cf82f1d6727eafd067040089557ab536af8eedfb6547d93097403f8286 + sha256: 5ee49804b88b0ff57c6e4e277954b098bd2e6c21d826aa3c416073aec4dcf208 requirements: build: diff --git a/recipes/metaseq/build.sh b/recipes/metaseq/build.sh deleted file mode 100644 index 650c36ed10929..0000000000000 --- a/recipes/metaseq/build.sh +++ /dev/null @@ -1,3 +0,0 @@ -#!/bin/bash - -python -m pip install --no-deps --ignore-installed . diff --git a/recipes/metaseq/meta.yaml b/recipes/metaseq/meta.yaml index 7e90f27f200c9..5dcbe70ff8c91 100644 --- a/recipes/metaseq/meta.yaml +++ b/recipes/metaseq/meta.yaml @@ -1,15 +1,19 @@ +{% set name = "metaseq" %} +{% set version = "0.5.6" %} +{% set sha256 = "8bb81b6d8e19f6a7227da188731717bde835662f48f6b07581e9605619db5e0d" %} + package: - name: metaseq - version: "0.5.6" + name: {{ name }} + version: {{ version }} source: - url: https://pypi.python.org/packages/source/m/metaseq/metaseq-0.5.6.tar.gz - md5: f29575db23019a5cd1003bfccb599847 + url: https://pypi.python.org/packages/source/m/{{ name }}/{{ name }}-{{ version }}.tar.gz + sha256: {{ sha256 }} build: - number: 1 - skip: True # [not py27] - script: python -m pip install --no-deps --ignore-installed . + number: 2 + skip: True # [py3k] + script: "{{ PYTHON }} -m pip install . --no-deps --ignore-installed -vvv " requirements: host: @@ -29,7 +33,6 @@ requirements: - pyyaml >=3.10 - pybedtools >=0.6.6 - fisher - run: - python - scipy >=0.10.1 @@ -52,5 +55,7 @@ test: about: home: http://github.com/daler/metaseq - license: MIT License - summary: 'Integrative analysis of high-thoughput sequencing data' + license: MIT + license_family: MIT + license_file: LICENSE.txt + summary: 'Framework for integrated analysis and plotting of ChIP/RIP/RNA/*-seq data.' diff --git a/recipes/mikado/meta.yaml b/recipes/mikado/meta.yaml index e0757747a82e8..e9d8881d57c36 100644 --- a/recipes/mikado/meta.yaml +++ b/recipes/mikado/meta.yaml @@ -1,8 +1,8 @@ {% set name = "mikado" %} -{% set version = "1.2.3" %} +{% set version = "1.2.4" %} {% set file_ext = "tar.gz" %} {% set hash_type = "sha256" %} -{% set hash_value = "784747156ba369555486e2168ec7caad91f23034aec0b377edd154f09ec74fc6" %} +{% set hash_value = "d9268b08aba2635ad8941371bdbfd415344dc640349bbfcdccbcaf82e6cb064b" %} package: name: '{{ name|lower }}' @@ -14,7 +14,7 @@ source: build: skip: True # [py27 or osx or py33] - number: 1 + number: 0 entry_points: - mikado = Mikado:main - daijin = Mikado.daijin:main diff --git a/recipes/minced/meta.yaml b/recipes/minced/meta.yaml index 4b9c52d3bf28d..0fdd5df13f952 100644 --- a/recipes/minced/meta.yaml +++ b/recipes/minced/meta.yaml @@ -1,6 +1,6 @@ {% set name = "minced" %} -{% set version = "0.3.0" %} -{% set hash = "482cbfe7140df85febaf8ca485065e4aa5347789de1c02f3d52fdd14739d0136" %} +{% set version = "0.3.2" %} +{% set hash = "334aee43292d0b657c4849f818ddfb3ac7811eb505502bf24a01d66719084b44" %} package: name: {{ name|lower }} @@ -11,7 +11,7 @@ source: sha256: {{ hash }} build: - number: 1 + number: 0 noarch: generic requirements: diff --git a/recipes/minimap2/build.sh b/recipes/minimap2/build.sh index ebaa0b0ccf419..2ea5548ddd655 100644 --- a/recipes/minimap2/build.sh +++ b/recipes/minimap2/build.sh @@ -5,5 +5,8 @@ export LIBRARY_PATH=$PREFIX/lib mkdir -p $PREFIX/bin +curl -L https://github.com/attractivechaos/k8/releases/download/0.2.5/k8-0.2.5.tar.bz2 | tar jxf - k8-0.2.5/k8-`uname -s` +cp k8-0.2.5/k8-* $PREFIX/bin/k8 + make -cp minimap2 $PREFIX/bin +cp minimap2 misc/paftools.js $PREFIX/bin diff --git a/recipes/minimap2/meta.yaml b/recipes/minimap2/meta.yaml index 868a9ba1b6157..5e31ced962d0d 100644 --- a/recipes/minimap2/meta.yaml +++ b/recipes/minimap2/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "2.12" %} +{% set version = "2.13" %} package: name: minimap2 @@ -6,7 +6,7 @@ package: source: url: https://github.com/lh3/minimap2/archive/v{{ version }}.tar.gz - sha256: 7bcac08a6e867c99b307afc8b2c07e36897ce8df702b6c2bdd3eeffff2a373e4 + sha256: b6e4a3502eb4b7f9566f936d741a4749e5539b292ffd7bdbe84f600c77d2fa72 build: number: 0 diff --git a/recipes/minvar/meta.yaml b/recipes/minvar/meta.yaml index ba229b2c4a03e..87ce79fc33ba7 100644 --- a/recipes/minvar/meta.yaml +++ b/recipes/minvar/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "2.2" %} +{% set version = "2.2.1" %} {% set build = 0 %} package: @@ -11,8 +11,8 @@ build: skip: True # [py27] source: - url: https://github.com/ozagordi/MinVar/archive/v{{ version }}.tar.gz - sha256: 91ed343df77a89d10dac55700be2cad6601375f1767e7ec4561718a64621e239 + url: https://github.com/MaryamZaheri/MinVar/archive/v{{ version }}.tar.gz + sha256: 65d2ddd8a9e47276ed68680ce1ed046a3f4fc258d320a4ffa1c17e753610afee requirements: host: diff --git a/recipes/mlst/meta.yaml b/recipes/mlst/meta.yaml index bf37c6b889a2f..bb379b46b5f1a 100644 --- a/recipes/mlst/meta.yaml +++ b/recipes/mlst/meta.yaml @@ -1,5 +1,5 @@ -{% set version = "2.15.1" %} -{% set sha256 = "d2968b3880c7059d096def435ee45ace4c6965309b4642b9f9900e77d8f443cf" %} +{% set version = "2.15.2" %} +{% set sha256 = "bc2ca70640dac4809b7749b80ef66d49c3459f9d4d3524f69ae55a01d79953a9" %} package: name: mlst diff --git a/recipes/motus/meta.yaml b/recipes/motus/meta.yaml index d25a594b400da..c8fd60af4f908 100644 --- a/recipes/motus/meta.yaml +++ b/recipes/motus/meta.yaml @@ -10,8 +10,9 @@ source: sha256: '{{ sha256 }}' build: - number: 1 - noarch: True + number: 2 + # motus requires python3 + skip: True # [not py3k] requirements: host: diff --git a/recipes/nanocomp/build.sh b/recipes/nanocomp/build.sh deleted file mode 100644 index e3b0eb7e3ac1a..0000000000000 --- a/recipes/nanocomp/build.sh +++ /dev/null @@ -1,3 +0,0 @@ -#!/bin/bash - -$PYTHON setup.py install --single-version-externally-managed --record=record.txt diff --git a/recipes/nanocomp/meta.yaml b/recipes/nanocomp/meta.yaml index 9c3bc57c47ac2..23340b010b70c 100644 --- a/recipes/nanocomp/meta.yaml +++ b/recipes/nanocomp/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "0.23.0" %} +{% set version = "0.23.1" %} package: name: nanocomp @@ -6,13 +6,14 @@ package: source: url: https://pypi.io/packages/source/n/nanocomp/NanoComp-{{ version }}.tar.gz - sha256: df066590117afd92d49dadf5a268dc5b4dbb7e71333d8536c4c5960d6ee3b3e5 + sha256: f221bd2e693711d94e761b49099f5d349d3ecf1118287eb7f9178522f5a70f10 build: entry_points: - NanoComp=nanocomp.NanoComp:main - number: 1 + number: 0 skip: True # [py27] + script: "{{ PYTHON }} -m pip install . --no-deps --ignore-installed --no-cache-dir -vvv" requirements: host: diff --git a/recipes/nanosim/build.sh b/recipes/nanosim/build.sh index 99dcacedfa695..87b317b6f8ecc 100644 --- a/recipes/nanosim/build.sh +++ b/recipes/nanosim/build.sh @@ -3,7 +3,6 @@ set -eu -o pipefail mkdir -p ${PREFIX}/bin cp src/*.py ${PREFIX}/bin/ -cp src/model_fitting.R ${PREFIX}/bin/ chmod 0755 "${PREFIX}/bin/read_analysis.py" chmod 0755 "${PREFIX}/bin/simulator.py" diff --git a/recipes/nanosim/meta.yaml b/recipes/nanosim/meta.yaml index 7788288b0d63a..ed2632782c0fd 100644 --- a/recipes/nanosim/meta.yaml +++ b/recipes/nanosim/meta.yaml @@ -1,5 +1,5 @@ -{% set version = "2.0.0" %} -{% set sha256 = "c3dab667ed68f90b55118b8b10d37a0b064ff3fa53b0068dfee312356c5b2482" %} +{% set version = "2.1.0" %} +{% set sha256 = "f01888589a1712976925affdc50c8aadc0e0cb5b94b25f472ba7bb208a6d860c" %} package: name: nanosim @@ -11,25 +11,26 @@ source: build: noarch: python - number: 1 + number: 0 requirements: host: - python - numpy + - scipy - six - htseq - minimap2 - last - - r-base + run: - python - numpy + - scipy - six - htseq - minimap2 - last - - r-base test: commands: diff --git a/recipes/nanosv/meta.yaml b/recipes/nanosv/meta.yaml index a204b03d92846..ca4587d521707 100644 --- a/recipes/nanosv/meta.yaml +++ b/recipes/nanosv/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "1.2.0" %} +{% set version = "1.2.2" %} package: name: nanosv @@ -6,10 +6,10 @@ package: source: url: https://pypi.io/packages/source/n/nanosv/NanoSV-{{ version }}.tar.gz - sha256: add65e53aacfc396835d752ba1c1431dfb20f058a9da2f1913aec40048199e80 + sha256: d8d858b8cc7f23341f91abb2be1d3b48586c7b10ad9dbf68fb735bdda1e7ab69 build: - number: 1 + number: 0 skip: True # [py27] entry_points: - NanoSV=nanosv.NanoSV:main diff --git a/recipes/ncbi-ngs-sdk/meta.yaml b/recipes/ncbi-ngs-sdk/meta.yaml index 5869fccbd1386..143c15281043f 100644 --- a/recipes/ncbi-ngs-sdk/meta.yaml +++ b/recipes/ncbi-ngs-sdk/meta.yaml @@ -1,5 +1,5 @@ -{% set version = "2.9.1" %} -{% set sha256 = "c24c93bd70ed198a44c6b9dba0d6704edc90f228f832f2fef21fa5342303fc50" %} +{% set version = "2.9.3" %} +{% set sha256 = "d16cdf340f4c66e449cc490a222e54e9074cd15fe0938cb75b951a72985f757d" %} package: name: ncbi-ngs-sdk diff --git a/recipes/ncbi-vdb/meta.yaml b/recipes/ncbi-vdb/meta.yaml index 904bbec1a7b3a..90f582526ad3e 100644 --- a/recipes/ncbi-vdb/meta.yaml +++ b/recipes/ncbi-vdb/meta.yaml @@ -1,5 +1,5 @@ -{% set version = "2.9.1" %} -{% set sha256 = "ef55c5dac0e9f0f05cfff6c9e56061b72aa034153895990bf2b7daaba8f06739" %} +{% set version = "2.9.3" %} +{% set sha256 = "100a0a109bd62531725c5ae3b191897c8e0834cd5ad593d042be6043b54cb98e" %} package: name: ncbi-vdb diff --git a/recipes/nextflow/meta.yaml b/recipes/nextflow/meta.yaml index 43ad705eba980..1a86ab4e5865f 100644 --- a/recipes/nextflow/meta.yaml +++ b/recipes/nextflow/meta.yaml @@ -1,24 +1,24 @@ -{% set version = "0.32.0" %} +{% set version = "18.10.1" %} package: name: nextflow version: {{ version }} build: - number: 1 + number: 2 noarch: generic source: url: https://www.nextflow.io/releases/v{{ version }}/nextflow - sha256: f4f757ec63328e1c2312d956437ec6fb7774226c631e3aba48e233e0c8e6b8a7 + sha256: 91d85e43578803ff88fd1c8d71129a1484f73b5c9f2962cc6916382c942b6602 requirements: host: - - openjdk >=8,<=10 + - openjdk >=8,<=11 - coreutils - curl run: - - openjdk >=8,<=10 + - openjdk >=8,<=11 - coreutils - curl @@ -28,5 +28,5 @@ test: about: home: "https://github.com/nextflow-io/nextflow" - license: "GPL3" + license: "Apache-2.0" summary: "A DSL for data-driven computational pipelines http://nextflow.io" diff --git a/recipes/nglview/meta.yaml b/recipes/nglview/meta.yaml index 62a6654c11bc5..b54ec3fa73a41 100644 --- a/recipes/nglview/meta.yaml +++ b/recipes/nglview/meta.yaml @@ -1,5 +1,5 @@ -{% set version = "1.1.6" %} -{% set sha256 = "460dfce6ab7b2f4bd4e339bd9a53d31db8acfeeda2015fe66b1abfe6bc9bdff5" %} +{% set version = "1.1.7" %} +{% set sha256 = "7c01586535cb7bf670c8a1d5c5607f5f2c5307bbeeae7435b0716a9032b9a22b" %} # from: https://github.com/conda-forge/nglview-feedstock/blob/master/recipe/meta.yaml package: diff --git a/recipes/nonpareil/meta.yaml b/recipes/nonpareil/meta.yaml index f0b9c8afc2853..1eb87f17ca7e9 100644 --- a/recipes/nonpareil/meta.yaml +++ b/recipes/nonpareil/meta.yaml @@ -1,5 +1,5 @@ -{% set version = "3.3.1" %} -{% set sha256 = "6fc9caf915f80704876fcd7b0a1fb3beda664fdb840fa0866bdfa1cb76df1a34" %} +{% set version = "3.3.3" %} +{% set sha256 = "a30502137af9a6599d798018017d0372bd18626b286fe666eebdbce915354ead" %} package: name: nonpareil diff --git a/recipes/novoplasty/meta.yaml b/recipes/novoplasty/meta.yaml index dfb7d9bb07b44..03e1bb6cddf55 100644 --- a/recipes/novoplasty/meta.yaml +++ b/recipes/novoplasty/meta.yaml @@ -1,16 +1,16 @@ {% set name = "NOVOPlasty" %} -{% set version = "2.2.2" %} +{% set version = "2.7.2" %} package: name: {{ name|lower }} version: {{ version }} source: - url: https://github.com/ndierckx/NOVOPlasty/archive/2.2.2.tar.gz - md5: 980a95dba3d36f3e9d78486d5d002e3f + url: https://github.com/ndierckx/NOVOPlasty/archive/2.7.2.tar.gz + sha256: a9c8067316245a3a39931fcc7b56a2c79aedbf7c7020584b68a21b5884cbbd07 build: - number: 1 + number: 0 requirements: build: diff --git a/recipes/npm-translate-gard/meta.yaml b/recipes/npm-translate-gard/meta.yaml new file mode 100644 index 0000000000000..cb3f4011dcf3d --- /dev/null +++ b/recipes/npm-translate-gard/meta.yaml @@ -0,0 +1,32 @@ +{% set name = "translate-gard" %} +{% set version = "1.0.4" %} +{% set sha256 = "e6636c46633e53f25a9e798a18b5a3eff34abda035ed228c86351e7b7c823263" %} +{% set node_version = os.environ.get('NODEJS_VERSION') or '6.*' %} + +package: + name: {{ name }} + version: {{ version }} + +source: + url: https://github.com/veg/translate-gard/archive/{{ version }}.tar.gz + sha256: {{ sha256 }} + +build: + number: 0 + skip: true # [osx] + script: npm install . && npm install -g + +requirements: + build: + - nodejs {{ node_version }} + run: + - nodejs {{ node_version }} + +test: + commands: + - npm list -g {{ name }} + +about: + home: https://github.com/veg/translate-gard/ + license: MIT + summary: 'Converts HyPhy 2.3.2 GARD output to JSON' diff --git a/recipes/ntcard/meta.yaml b/recipes/ntcard/meta.yaml index 8a5392067aed6..de81c546a7a06 100644 --- a/recipes/ntcard/meta.yaml +++ b/recipes/ntcard/meta.yaml @@ -1,16 +1,16 @@ {% set name = "ntcard" %} -{% set version = "1.0.0" %} +{% set version = "1.1.0" %} package: name: {{ name|lower }} version: {{ version }} build: - number: 2 + number: 0 source: url: https://github.com/bcgsc/ntCard/archive/{{ version }}.tar.gz - md5: 41d987f7926466d9afd1e845f369f2b9 + sha256: 88ffcffc67e619e714b65753baa077a9a16536fcb5c789c2d77bbd87dd4c2a15 requirements: build: diff --git a/recipes/ont-tombo/meta.yaml b/recipes/ont-tombo/meta.yaml index 74a8693d4a8b7..373b98ac87e27 100644 --- a/recipes/ont-tombo/meta.yaml +++ b/recipes/ont-tombo/meta.yaml @@ -1,6 +1,6 @@ {% set name = "ont-tombo" %} -{% set version = "1.4" %} -{% set hash = "af478a046156e8644fbf458191da18e2757fd71ac91d645c13cd5a3b5006c695" %} +{% set version = "1.5" %} +{% set hash = "51de9a86f99d2117aeee20fabb73470f649d29a6d79a40925f3f7348118aae98" %} package: name: {{ name|lower }} diff --git a/recipes/openslide-python/meta.yaml b/recipes/openslide-python/meta.yaml new file mode 100644 index 0000000000000..eb2bfb388d0a1 --- /dev/null +++ b/recipes/openslide-python/meta.yaml @@ -0,0 +1,40 @@ +{% set name = "openslide-python" %} +{% set version = "1.1.1" %} + +package: + name: "{{ name|lower }}" + version: "{{ version }}" + +source: + url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz + sha256: b460764914f3b9736f9bdd551da7927e194ed28d78588759a0a793dffe1749a6 + +build: + number: 0 + script: "{{ PYTHON }} -m pip install . --no-deps --ignore-installed -vvv " + +requirements: + build: + - {{ compiler('c') }} + host: + - pip + - python + - openslide + run: + - pillow + - python + - openslide + +test: + imports: + - openslide + +about: + home: http://openslide.org/ + license: GNU Lesser General Public v2 (LGPLv2) + license_family: LGPL + summary: Python interface to OpenSlide + +extra: + recipe-maintainers: + - bgruening diff --git a/recipes/paladin/build.sh b/recipes/paladin/build.sh index c43a6379bb4f5..6f6a169192ec9 100644 --- a/recipes/paladin/build.sh +++ b/recipes/paladin/build.sh @@ -1,4 +1,6 @@ #!/bin/bash export C_INCLUDE_PATH=${PREFIX}/include export LIBRARY_PATH=${PREFIX}/lib -make INCLUDES=$PREFIX/include INSTALLDIR=$PREFIX/bin install -j${CPU_COUNT} +make INCLUDES=$PREFIX/include -j${CPU_COUNT} +install -m 0755 paladin ${PREFIX}/bin + diff --git a/recipes/paladin/meta.yaml b/recipes/paladin/meta.yaml index 13a722c1e0460..174de0a9b9247 100644 --- a/recipes/paladin/meta.yaml +++ b/recipes/paladin/meta.yaml @@ -1,7 +1,6 @@ {% set name = "paladin" %} -{% set version = "1.3.1" %} -{% set sha256 = "8ac244e20e5beb27633191b120ad4ec5061e6d05d411d975c8fef90e47b9764f" %} -{% set md5 = "de72fca3355459ae446c990921955040" %} +{% set version = "1.4.4" %} +{% set sha256 = "6e37144d54027c381bdcd290c59ebd16034800513e6604a7432c376f50fac663" %} package: name: {{ name }} @@ -10,10 +9,9 @@ package: source: url: https://github.com/twestbrookunh/{{ name }}/archive/v{{ version }}.tar.gz sha256: {{ sha256 }} - md5: {{ md5 }} build: - number: 2 + number: 0 requirements: build: diff --git a/recipes/pbalign/meta.yaml b/recipes/pbalign/meta.yaml index 1a7981dd3a808..5ef9b585a54c5 100644 --- a/recipes/pbalign/meta.yaml +++ b/recipes/pbalign/meta.yaml @@ -24,7 +24,7 @@ extra: build: skip: True # [not py27] - number: 0 + number: 1 requirements: host: @@ -33,7 +33,7 @@ requirements: run: - python - pysam >=0.13 - - pbcore >=1.5.1 + - pbcore >=1.6.5 - pbcommand >=1.1.1 - blasr >=5.3.2 - pbbam >=0.18.0 diff --git a/recipes/pbbam/meta.yaml b/recipes/pbbam/meta.yaml index 5565fb73399c8..46952bb831ba9 100644 --- a/recipes/pbbam/meta.yaml +++ b/recipes/pbbam/meta.yaml @@ -26,7 +26,7 @@ build: requirements: build: - {{ compiler('cxx') }} - - meson ==0.46* + - meson >=0.48.1 - ninja - pkg-config host: diff --git a/recipes/pbcopper/meta.yaml b/recipes/pbcopper/meta.yaml index 92e48ab31f5ae..13c9c9799210d 100644 --- a/recipes/pbcopper/meta.yaml +++ b/recipes/pbcopper/meta.yaml @@ -26,7 +26,7 @@ build: requirements: build: - {{ compiler('cxx') }} - - meson + - meson >=0.48.1 - ninja host: - boost diff --git a/recipes/pbcore/meta.yaml b/recipes/pbcore/meta.yaml index 832a79c26de11..122dce6d9f394 100644 --- a/recipes/pbcore/meta.yaml +++ b/recipes/pbcore/meta.yaml @@ -1,6 +1,6 @@ {% set name = "pbcore" %} -{% set version = "1.5.1" %} -{% set sha256 = "716a428088cf4215ff6f4e5ca05b499031cdd203cb22c712f3fd11ff3b31c170" %} +{% set version = "1.6.5" %} +{% set sha256 = "c99e4f1b5caf721e3379f8f45c44f22dd006be396e986f1fda7b67bc61f7c1cc" %} package: name: {{ name }} @@ -22,7 +22,7 @@ extra: build: skip: True # [not py27] - number: 2 + number: 0 requirements: host: diff --git a/recipes/pbcoretools/meta.yaml b/recipes/pbcoretools/meta.yaml index 45c2d9613547a..5d9741b91748d 100644 --- a/recipes/pbcoretools/meta.yaml +++ b/recipes/pbcoretools/meta.yaml @@ -22,7 +22,7 @@ extra: build: skip: True # [not py27] - number: 2 + number: 3 requirements: host: @@ -31,13 +31,13 @@ requirements: - cython - numpy >=1.15 - pysam >=0.13 - - pbcore >=1.5.1 + - pbcore >=1.6.5 - pbcommand >=1.1.1 run: - python - numpy >=1.15 - pysam >=0.13 - - pbcore >=1.5.1 + - pbcore >=1.6.5 - pbcommand >=1.1.1 test: diff --git a/recipes/pbmm2/meta.yaml b/recipes/pbmm2/meta.yaml index bf5c967cf4338..cc5585c18757b 100644 --- a/recipes/pbmm2/meta.yaml +++ b/recipes/pbmm2/meta.yaml @@ -28,7 +28,7 @@ requirements: build: - {{ compiler('cxx') }} - {{ compiler('c') }} - - meson ==0.46.0* + - meson >=0.48.1 - ninja - pkg-config host: diff --git a/recipes/peptide-shaker/meta.yaml b/recipes/peptide-shaker/meta.yaml index eed6309ed30c0..a16d2a1b79a23 100644 --- a/recipes/peptide-shaker/meta.yaml +++ b/recipes/peptide-shaker/meta.yaml @@ -1,5 +1,5 @@ {% set name = "PeptideShaker" %} -{% set version = "1.16.30" %} +{% set version = "1.16.31" %} # Do not forget to update the version string in the peptide-shaker.py file about: @@ -22,7 +22,7 @@ build: source: url: http://genesis.ugent.be/maven2/eu/isas/peptideshaker/{{ name }}/{{ version }}/{{ name }}-{{ version }}.zip - sha256: eeb53a662be880d3f95c9e35fcf4d770adbecc6e0b4a2e2b2ba77aa8d836b780 + sha256: 7086bf35b9f0ac0ad52d940f782373cd05f0b5cac638d3e696311939de980602 requirements: host: diff --git a/recipes/peptide-shaker/peptide-shaker.py b/recipes/peptide-shaker/peptide-shaker.py index 34fd5a5b63d41..4a1c38ebdd156 100755 --- a/recipes/peptide-shaker/peptide-shaker.py +++ b/recipes/peptide-shaker/peptide-shaker.py @@ -13,7 +13,7 @@ from os import access from os import getenv from os import X_OK -jar_file = 'PeptideShaker-1.16.30.jar' +jar_file = 'PeptideShaker-1.16.31.jar' default_jvm_mem_opts = ['-Xms512m', '-Xmx1g'] diff --git a/recipes/perl-number-range/build.sh b/recipes/perl-number-range/build.sh new file mode 100644 index 0000000000000..67918fe672fe6 --- /dev/null +++ b/recipes/perl-number-range/build.sh @@ -0,0 +1,19 @@ +#!/bin/bash + +# If it has Build.PL use that, otherwise use Makefile.PL +if [ -f Build.PL ]; then + perl Build.PL + perl ./Build + perl ./Build test + # Make sure this goes in site + perl ./Build install --installdirs site +elif [ -f Makefile.PL ]; then + # Make sure this goes in site + perl Makefile.PL INSTALLDIRS=site + make + make test + make install +else + echo 'Unable to find Build.PL or Makefile.PL. You need to modify build.sh.' + exit 1 +fi diff --git a/recipes/perl-number-range/meta.yaml b/recipes/perl-number-range/meta.yaml new file mode 100644 index 0000000000000..e9cb588e544cf --- /dev/null +++ b/recipes/perl-number-range/meta.yaml @@ -0,0 +1,31 @@ +{% set name = "perl-number-range" %} +{% set version = "0.12" %} +{% set sha256 = "433e821ac44ab6164c7e92b60ff7afa60a279bc550134c82ceb70b3ef4ee2925" %} + +package: + name: {{ name }} + version: {{ version }} + +source: + url: https://cpan.metacpan.org/authors/id/L/LA/LARRYSH/Number-Range-{{ version }}.tar.gz + sha256: {{ sha256 }} + +build: + number: 0 + +requirements: + host: + - perl + - perl-extutils-makemaker + run: + - perl + - perl-extutils-makemaker + +test: + imports: + - Number::Range + +about: + home: http://metacpan.org/pod/Number::Range + license: perl_5 + summary: 'Perl extension defining ranges of numbers and testing if a number is found in the range' diff --git a/recipes/perl-pcap/meta.yaml b/recipes/perl-pcap/meta.yaml index 62ea84544ae81..d09161a70e0b9 100644 --- a/recipes/perl-pcap/meta.yaml +++ b/recipes/perl-pcap/meta.yaml @@ -1,13 +1,13 @@ package: name: perl-pcap - version: '1.11.1' + version: '3.5.2' source: - url: https://github.com/ICGC-TCGA-PanCancer/PCAP-core/archive/v1.11.1.tar.gz - sha256: c631926239098f8c8768792bed74f4d38b1cd188af40e71f8c430ae2a47157a1 + url: https://github.com/ICGC-TCGA-PanCancer/PCAP-core/archive/v3.5.2.tar.gz + sha256: 0e5542de800acdeb576c9930ff6da145c576c7c21dda753760047ebfe853af3b build: - number: 3 + number: 0 skip: True # [osx] requirements: diff --git a/recipes/perl-sanger-cgp-allelecount/meta.yaml b/recipes/perl-sanger-cgp-allelecount/meta.yaml index 73fcf1988e450..0433e53460cbc 100644 --- a/recipes/perl-sanger-cgp-allelecount/meta.yaml +++ b/recipes/perl-sanger-cgp-allelecount/meta.yaml @@ -1,13 +1,13 @@ package: name: perl-sanger-cgp-allelecount - version: '2.1.2' + version: '4.0.0' source: - url: https://github.com/cancerit/alleleCount/archive/v2.1.2.tar.gz - sha256: 2c7fd5521d4dd3353a3937949007ba8b0b0ad6025ea06f82ee351e837f1dd625 + url: https://github.com/cancerit/alleleCount/archive/v4.0.0.tar.gz + sha256: 3841dee52b79ec520d5a2faa83dff048badb46dafddb0053b7553eb20aa7fea1 build: - number: 3 + number: 0 skip: True # [osx] requirements: diff --git a/recipes/perl-sanger-cgp-vagrent/meta.yaml b/recipes/perl-sanger-cgp-vagrent/meta.yaml index 152bd5b60d52f..aef407c7e919f 100644 --- a/recipes/perl-sanger-cgp-vagrent/meta.yaml +++ b/recipes/perl-sanger-cgp-vagrent/meta.yaml @@ -1,13 +1,13 @@ package: name: perl-sanger-cgp-vagrent - version: '3.2.0' + version: '3.3.3' source: - url: https://github.com/cancerit/VAGrENT/archive/v3.2.0.tar.gz - md5: 09996ac5a3fff126f10e163b5bd32ecf + url: https://github.com/cancerit/VAGrENT/archive/v3.3.3.tar.gz + sha256: 14a0a85bbd22d767fbd9597fb1363334e8995229ff621d0217eda5602ac2dcb3 build: - number: 1 + number: 0 skip: True # [osx] requirements: diff --git a/recipes/perl-sanger-cgp-vcf/meta.yaml b/recipes/perl-sanger-cgp-vcf/meta.yaml index bbf1d46b19d4d..e692668d9e602 100644 --- a/recipes/perl-sanger-cgp-vcf/meta.yaml +++ b/recipes/perl-sanger-cgp-vcf/meta.yaml @@ -1,13 +1,13 @@ package: name: perl-sanger-cgp-vcf - version: '1.3.1' + version: '2.2.1' source: - url: https://github.com/cancerit/cgpVcf/archive/v1.3.1.tar.gz - sha256: 7eb0acf54165afedd4198945e2ee1413697f37dc591e22e606676347f93468d6 + url: https://github.com/cancerit/cgpVcf/archive/v2.2.1.tar.gz + sha256: b93ae878eac4b111966c1e9845b63a89fb79882d242e8e3cd0bae6e9573d6d75 build: - number: 3 + number: 0 skip: True # [osx] requirements: diff --git a/recipes/perl-velvetoptimiser/Makefile.PL b/recipes/perl-velvetoptimiser/Makefile.PL index e6e369580f5d4..61bf211c3bdb7 100644 --- a/recipes/perl-velvetoptimiser/Makefile.PL +++ b/recipes/perl-velvetoptimiser/Makefile.PL @@ -4,7 +4,7 @@ use ExtUtils::MakeMaker; # the contents of the Makefile that is written. WriteMakefile( NAME => 'VelvetOpt', - VERSION => '2.2.5', # finds $VERSION, requires EU::MM from perl >= 5.5 + VERSION => '2.2.6', # finds $VERSION, requires EU::MM from perl >= 5.5 PREREQ_PM => {}, # e.g., Module::Name => 1.1 ABSTRACT => 'The VelvetOptimiser is designed to run as a wrapper script for the Velvet assembler (Daniel Zerbino, EBI UK) and to assist with optimising the assembly.', # retrieve abstract from module AUTHOR => 'Simon Gladman & Torsten Seemann', diff --git a/recipes/perl-velvetoptimiser/meta.yaml b/recipes/perl-velvetoptimiser/meta.yaml index 3c493e2df1f1b..a463270336c77 100644 --- a/recipes/perl-velvetoptimiser/meta.yaml +++ b/recipes/perl-velvetoptimiser/meta.yaml @@ -1,15 +1,13 @@ package: name: perl-velvetoptimiser - version: "2.2.5" + version: "2.2.6" source: - url: https://github.com/tseemann/VelvetOptimiser/archive/2.2.5.tar.gz - md5: 66966ce03f61321a2f81a5cfb45a3be9 - patches: - - perl_path.patch + url: https://github.com/tseemann/VelvetOptimiser/archive/2.2.6.tar.gz + md5: 1b7495b54e084672657ff7ac91aa00bf build: - number: 1 + number: 0 requirements: host: @@ -22,7 +20,7 @@ requirements: test: commands: - - VelvetOptimiser.pl --version + - VelvetOptimiser.pl --version about: home: https://github.com/tseemann/VelvetOptimiser diff --git a/recipes/perl-velvetoptimiser/perl_path.patch b/recipes/perl-velvetoptimiser/perl_path.patch deleted file mode 100644 index 8db14c5db48c5..0000000000000 --- a/recipes/perl-velvetoptimiser/perl_path.patch +++ /dev/null @@ -1,8 +0,0 @@ ---- VelvetOptimiser.pl 2012-10-05 01:06:28.000000000 +0000 -+++ VelvetOptimiser.pl.new 2016-05-03 20:13:32.676376334 +0000 -@@ -1,4 +1,4 @@ --#!/usr/bin/perl -+#!/usr/bin/env perl - # - # VelvetOptimiser.pl - # diff --git a/recipes/phame/meta.yaml b/recipes/phame/meta.yaml index c66a562d8edc9..99e21c20496f9 100644 --- a/recipes/phame/meta.yaml +++ b/recipes/phame/meta.yaml @@ -1,6 +1,6 @@ {% set name = "phame" %} -{% set version = "1.0.2" %} -{% set hash = "79292f8a00290f3e85e1df8c1edbd000c1548f1b3c176c2a4949d78a1aabe973" %} +{% set version = "1.0.3" %} +{% set hash = "026b5c54ff9fe121fefd222dc2f9912da34a9395a04d26f7e468aca5adcd1703" %} package: name: {{ name }} @@ -40,6 +40,7 @@ requirements: - curl >=7.60.0 - hyphy >=2.3.12 # [not osx] - mafft >=7.313 + - iqtree >=1.6.7 test: commands: @@ -51,7 +52,7 @@ test: about: home: https://github.com/LANL-Bioinformatics/PhaME - license: BSD-3 + license: GPLV2 summary: A tool to derive SNP matrices and phylogenetic tree from raw reads, contigs, and full genomes. extra: diff --git a/recipes/picard/meta.yaml b/recipes/picard/meta.yaml index 7ec766ae509ae..5ef728bd5b34f 100644 --- a/recipes/picard/meta.yaml +++ b/recipes/picard/meta.yaml @@ -1,5 +1,5 @@ -{% set version = "2.18.14" %} -{% set sha256 = "4941719941a46c72e72a3b160ff8b8fc7e2af90198004bd727526ce522ae8575" %} +{% set version = "2.18.15" %} +{% set sha256 = "f4f521f57a199b1884982a34938af0e70939bbbe7b818795288810529558f480" %} package: name: picard diff --git a/recipes/plek/build.sh b/recipes/plek/build.sh new file mode 100644 index 0000000000000..67224a72c99d4 --- /dev/null +++ b/recipes/plek/build.sh @@ -0,0 +1,20 @@ +#!/bin/bash + +# python PLEK_setup.py +g++ -c svm.cpp +gcc -g -Wall svm-train.c svm.o -o svm-train -lstdc++ -lm +gcc -g -Wall svm-predict.c svm.o -o svm-predict -lstdc++ -lm +gcc -g -Wall svm-scale.c svm.o -o svm-scale -lstdc++ -lm +gcc -g -Wall PLEK_main.c -o PLEK -lm +gcc -g -Wall PLEK_spsn.c -o PLEK_spsn -lm + +chmod +x *.py +chmod +x *.R +cp PLEK ${PREFIX}/bin +cp PLEK.model ${PREFIX}/bin +cp PLEK_spsn ${PREFIX}/bin +cp svm-predict ${PREFIX}/bin +cp svm-scale ${PREFIX}/bin +cp svm-train ${PREFIX}/bin +cp *.py ${PREFIX}/bin +cp *.R ${PREFIX}/bin diff --git a/recipes/plek/dos2unix.patch b/recipes/plek/dos2unix.patch new file mode 100644 index 0000000000000..1e801c79c86de --- /dev/null +++ b/recipes/plek/dos2unix.patch @@ -0,0 +1,2026 @@ +--- PLEKModelling.py 2014-06-26 10:18:03.000000000 -0500 ++++ PLEKModelling.py.new 2018-10-30 12:12:30.641887159 -0500 +@@ -1,578 +1,578 @@ +-#!/usr/bin/env python +-####################################################### +-# +-# PLEK Modelling - build predictor of lncRNAs and mRNAs based on k-mer scheme +-# Authors: Aimin Li, Junying Zhang +-# Contacts: LiAiminMail@gmail.com, jyzhang@mail.xidian.edu.cn +-# Webcite: https://sourceforge.net/projects/plek/ +-# Version: 1.2 +-# Updated on: June 26, 2014 +-# +-####################################################### +- +- +-__all__ = [''] +-import os, sys, traceback, getpass, time, re, subprocess, commands +-from threading import Thread +- +- +-class GridOption: # set or get input parameters +- args="" +- +- def __init__(self, options): +- dirname = os.path.dirname(__file__) +- self.svmtrain_pathname = os.path.join(dirname, './svm-train') +- self.svmpredict_pathname = os.path.join(dirname, './svm-predict') +- self.svmscale_pathname = os.path.join(dirname, './svm-scale') +- self.mRNA_file = "" +- self.lncRNA_file = "" +- self.log2c = "0,5,1" # 0,1,2,3,4,5 +- self.log2g = "0,-5,-1" # 0,-1,-2,-3,-4,-5 +- self.prefix = "plek_mdl_" +- self.rangefile = "" +- self.is_mRNAlncRNA_balanced = 0 +- self.thread_count = 12 +- self.modelfile="" +- self.kmer=5 +- self.min_seq_length=200 +- self.unkown=0 +- self.is_recompile=0 +- self.isoutmsg=0 +- self.isrmtempfile=1 +- self.isadjustweight=0 +- self.nfold=10 +- self.script_dir="./" +- self.islogging=1 +- self.x_fold=1 # down-sampling fold +- self.parse_opts(options) +- +- def parse_opts(self, options): +- args=options # save options to args +- if type(options) == str: +- options = options.split() +- i = 0 +- pass_through_opts = [] +- # get python script file's name, args[0] +- # determine it is with dir or only file_name +- script_name=args[0] +- +- if script_name.rfind('/')>=0: +- self.script_dir=script_name[:script_name.rfind('/')+1] +- +- self.svmtrain_pathname = self.script_dir + 'svm-train' +- self.svmpredict_pathname = self.script_dir + 'svm-predict' +- self.svmscale_pathname = self.script_dir + 'svm-scale' +- +- while i < len(options): +- if options[i] == '-mRNA': # a file to provide mRNA transcript sequences in fasta format. +- i = i + 1 +- self.mRNA_file = options[i] +- elif options[i] == '-lncRNA': # a file to provide lncRNA transcript sequences in fasta format. +- i = i + 1 +- self.lncRNA_file = options[i] +- elif options[i] == '-thread': # The number of threads for running the PLEK Modelling program. The bigger this number is, the faster it runs. +- i = i + 1 +- self.thread_count = int(options[i]) +- elif options[i] == '-log2c': # The search range of svm C parameter. Format: from, to, by. i.e. 1,5,1 means log2c=1,2,3,4,5. +- i = i + 1 +- self.log2c = options[i] +- elif options[i] == '-log2g': # The search range of svm G parameter. Format: from, to, by. i.e. 1,-4,-1 means log2g=1,0,-1,-2,-3,-4. +- i = i + 1 +- self.log2g = options[i] +- elif options[i] == '-minlength': # The minimum length of sequences. The sequences whose lengths are more than minlength will be processed. +- i = i + 1 +- self.min_seq_length = int(options[i]) +- elif options[i] == '-isoutmsg': # Output messages to stdout(screen) or not. "0" means that PLEK be run quietly. "1" means that PLEK outputs the details of processing. +- i = i + 1 +- self.isoutmsg = int(options[i]) +- elif options[i] == '-isrmtempfile': # Remove temporary files or not. "0" means that PLEK retains temporary files. "1" means that PLEK remove temporary files. +- i = i + 1 +- self.isrmtempfile = int(options[i]) +- elif options[i] == '-nfold': # n-fold cross validation in search for optimal parameters. +- i = i + 1 +- self.nfold = int(options[i]) +- elif options[i] == '-k': # range of k. k=5 means that we will calculate usage of 1364 k-mer patterns. (k=1, 4 patterns; k=2, 16; k=3, 64; k=4, 256; k=5, 1024; 1364=4+64+256+1024) +- i = i + 1 +- self.kmer = int(options[i]) +- elif options[i] == '-model': # svm model file (output). +- i = i + 1 +- self.modelfile = options[i] +- elif options[i] == '-range': # svm range file (output). +- i = i + 1 +- self.rangefile = options[i] +- elif options[i] == '-prefix': # The prefix of output files. +- i = i + 1 +- self.prefix = options[i] +- elif options[i] == '-isbalanced': # NOTE: isbalanced=1, need to be balanced. If the samples are unbalanced, it will subsample the overrepresented class to obtain an equal amount of positives and negatives; isbalanced=0, not to be balanced. If the samples are unbalanced, svm will reweight the misclassification cost (adjust the wi parameters). +- i = i + 1 +- self.is_mRNAlncRNA_balanced = int(options[i]) +- elif options[i] == '-isrecompile': # re-compile source. +- i = i + 1 +- self.is_recompile = int(options[i]) +- elif options[i] == '-isadjustweight': # isadjustweight. +- i = i + 1 +- self.isadjustweight = int(options[i]) +- elif options[i] == '-x_fold': # +- i = i + 1 +- self.x_fold = int(options[i]) +- elif options[i] == '-islogging': # +- i = i + 1 +- self.islogging = int(options[i]) +- else: +- pass_through_opts.append(options[i]) +- i = i + 1 +- +- self.pass_through_string = ' '.join(pass_through_opts) +- +- +-if __name__ == '__main__': +- def exit_with_help(): +- print("""\ +-===================== +- USAGE AND EXAMPLES +-===================== +-Usage of PLEK Modelling -- used to build your own classifier with your +- training data (mRNA/lncRNA transcripts): +- +-python PLEKModelling.py -mRNA mRNAs_fasta -lncRNA lncRNAs_fasta +- -prefix prefix_of_output -log2c range_of_log2c -log2g range_of_log2g +- -thread number_of_threads -model model_file -range range_file +- -minlength min_length_of_sequence -isoutmsg 0_or_1 -isrmtempfile 0_or_1 +- -k k_mer -nfold n_fold_cross_validation -isbalanced 0_or_1 +- +- -mRNA mRNA transcripts used to build predictor, in fasta format. +- +- -lncRNA lncRNA transcripts used to build predictor, in fasta format. +- +- -prefix Prefix of the output files. +- +- -log2c (Optional) The specified range of C parameter for the svm parameter +- search. Default value: 0,5,1. (from, to, by; 0,1,2,3,4,5) +- +- -log2g (Optional) The specified range of G parameter for the svm parameter +- search. Default value: 0,-5,-1.(from, to, by; 0,-1,-2,-3,-4,-5) +- +- -thread (Optional) The number of threads for running the PLEKModelling +- program. The bigger this number is, the faster PLEKModelling runs. +- Note that a larger thread number means larger consumption of memory. +- Default value: 12. +- +- -model (Optional) The name of a predictor model file (an output file +- by PLEKModelling.py). +- +- -range (Optional) The name of a svm range file (an output file by +- PLEKModelling.py). +- +- -minlength (Optional) The minimum length of sequences. The sequences whose +- lengths are more than minlength will be processed. Default +- value: 200. +- +- -isoutmsg (Optional) Output messages to stdout(screen) or not. "0" means +- that PLEKModelling be run quietly. "1" means that PLEKModelling +- outputs the details of processing. Default value: 0. +- +- -isrmtempfile (Optional) Remove temporary files or not. "0" means that PLEKModelling +- retains temporary files. "1" means that PLEKModelling remove temporary +- files. Default value: 1. +- +- -k (Optional) range of k. k=5 means that we will calculate usage of +- 1364 k-mer patterns. (k=1, 4 patterns; k=2, 16; k=3, 64; k=4, 256; +- k=5, 1024; 1364=4+64+256+1024). Default value: 5. +- +- -nfold (Optional) n-fold cross-validation in search for optimal parameters. +- Default value: 10. +- +- -isbalanced (Optional) In the case of isbalanced=1, if the samples are +- unbalanced, it will subsample the overrepresented class to obtain an +- equal amount of positives and negatives. +- Default value: 0. +- +- +-Examples: +-1. $ python PLEKModelling.py -mRNA PLEK_mRNAs.fa -lncRNA PLEK_lncRNAs.fa -prefix 20140531 +- +- NOTE: To train a classifier using the mRNA sequences in the 'PLEK_mRNAs.fa' file +- and lncRNA in 'PLEK_lncRNAs.fa'. The program outputs the model in the file +- '20140531.model' and the svm-scale range in '20140531.range'. +- We can use the new model as follows: +- python PLEK.py -fasta PLEK_test.fa -out 20140531.predicted -thread 10 \\ +- -range 20140531.range -model 20140531.model +- +-2. $ python PLEKModelling.py -mRNA PLEK_mRNAs.fa -lncRNA PLEK_lncRNAs.fa -prefix 20140601 \\ +- -log2c 1,3,1 -log2g -1,-3,-1 -nfold 2 -k 4 +- +- NOTE: This example is used to demonstrate the usage of PLEKModelling.py +- in a simple/quick way. User can run this to check if our program can run correctly. +- To train a classifier using the mRNA sequences in the 'PLEK_mRNAs.fa' file +- and lncRNA in 'PLEK_lncRNAs.fa'. The range of log2c is 1,2,3. The range of log2g +- is -1,-2,-3. Use a 2-fold cross-validation. K is 4, it will calculate the usage +- of 340 patterns (4+16+63+256=340). The program outputs the model in the file +- '20140601.model' and the svm-scale range in '20140601.range'. +- We can use the new model as follows: +- python PLEK.py -fasta PLEK_test.fa -out 20140601.predicted -thread 10 \\ +- -range 20140601.range -model 20140601.model -k 4 +- +-Notes: +- (1) In general, it is time-consuming to build a new classifier. +- (2) The accuracy of a classifier model is connected with the quality and +- quantity of training samples. We encourage users to supply as many reliable +- samples as possible to PLEKModelling.py to train a classifier. We suggest +- that transcripts annotated with 'pseudogene', 'predicted' and 'putative' +- be removed before training models. +- (3) To parallel run PLEKModelling.py in PBS, please see +- PLEK_howto_generate_scripts.pdf +- +- +-===================== +- CONTACTS +-===================== +-Aimin Li: LiAiminMail@gmail.com +-Junying Zhang: jyzhang@mail.xidian.edu.cn +- +-====================== +- WEBSITE +-===================== +-https://sourceforge.net/projects/plek/ +- """) +- sys.exit(1) +- +- +- def compile_c(_opts): # re-compile source +- print('[{0}] Compiling svm, svm-train, svm-predict, svm-scale'.format(time.strftime('%Y-%m-%d %H:%M:%S'))) +- os.system("g++ -c " + _opts.script_dir + "svm.cpp -o " + _opts.script_dir + "svm.o") +- os.system("LNAG=C gcc -g -Wall " + _opts.script_dir + "svm-train.c " + _opts.script_dir + "svm.o -o " + _opts.script_dir + "svm-train -lstdc++ -lm") +- os.system("LNAG=C gcc -g -Wall " + _opts.script_dir + "svm-predict.c " + _opts.script_dir + "svm.o -o " + _opts.script_dir + "svm-predict -lstdc++ -lm") +- os.system("LNAG=C gcc -g -Wall " + _opts.script_dir + "svm-scale.c " + _opts.script_dir + "svm.o -o " + _opts.script_dir + "svm-scale -lstdc++ -lm") +- +- print('[{0}] Compiling PLEK_main, PLEK_spsn'.format(time.strftime('%Y-%m-%d %H:%M:%S'))) +- os.system("LNAG=C gcc -g -Wall " + _opts.script_dir + "PLEK_main.c -o " + _opts.script_dir + "PLEK -lm") +- os.system("LNAG=C gcc -g -Wall " + _opts.script_dir + "PLEK_spsn.c -o " + _opts.script_dir + "PLEK_spsn -lm ") +- +- def sampling(pos_number, neg_number, prefix, x_fold): +- if pos_number> neg_number: +- os.system(' grep -e "^1" '+prefix+'.scale | sort -R | sort -R | sed -n "1,'+str(x_fold*neg_number)+'p" > '+prefix+'.pos_selected ') +- os.system(' grep -e "^0" '+prefix+'.scale > '+prefix+'.neg_selected ') +- os.system(' cat '+prefix+'.pos_selected '+prefix+'.neg_selected > '+prefix+'.newscale ') +- os.system(' rm '+prefix+'.pos_selected ') +- os.system(' rm '+prefix+'.neg_selected ') +- if neg_number> pos_number: +- os.system(' grep -e "^0" '+prefix+'.scale | sort -R | sort -R | sed -n "1,'+str(x_fold*pos_number)+'p" > '+prefix+'.neg_selected ') +- os.system(' grep -e "^1" '+prefix+'.scale > '+prefix+'.pos_selected ') +- os.system(' cat '+prefix+'.pos_selected '+prefix+'.neg_selected > '+prefix+'.newscale ') +- os.system(' rm '+prefix+'.pos_selected ') +- os.system(' rm '+prefix+'.neg_selected ') +- +- if len(sys.argv) < 2: +- exit_with_help() +- options = sys.argv +- try: +- +- print('[{0}] Beginning PLEK Modelling run (Version 1.2) '.format(time.strftime('%Y-%m-%d %H:%M:%S'))) +- +- # get input options +- _opts = GridOption(options); +- cmdline=None; +- +- c1,c2,step1=_opts.log2c.split(",") +- g1,g2,step2=_opts.log2g.split(",") +- grid_file_name="svm_grid_modelling.py" +- if c1==c2 and g1==g2: +- grid_file_name="svm_grid_modelling_singlet.py" +- +- logfile=_opts.prefix + "_modelling.logs" +- if _opts.islogging==1: +- if os.path.isfile(logfile): +- os.remove(logfile) +- if not os.path.isfile(logfile): +- open(logfile, 'a').close() +- with open(logfile, 'a') as log_file: +- log_file.write(time.strftime('%Y-%m-%d %H:%M:%S')+", started.\n") +- # recompile source +- if _opts.is_recompile or (not os.path.isfile(_opts.script_dir + 'PLEK')): +- compile_c(_opts) +- else: +- time.sleep(2) +- +- # check if the mRNA/lncRNA file exists +- if not os.path.isfile( _opts.mRNA_file): +- print("ERROR: No such file '" + _opts.mRNA_file + "'") +- with open(logfile, 'a') as log_file: +- log_file.write("ERROR: No such file '" + _opts.mRNA_file + "'\n") +- sys.exit(1) +- if not os.path.isfile( _opts.lncRNA_file): +- print("ERROR: No such file '" + _opts.lncRNA_file + "'") +- with open(logfile, 'a') as log_file: +- log_file.write("ERROR: No such file '" + _opts.lncRNA_file + "'\n") +- sys.exit(1) +- +- if _opts.modelfile=="": +- _opts.modelfile=_opts.prefix + ".model" +- if _opts.rangefile=="": +- _opts.rangefile=_opts.prefix + ".range" +- +- # output options: +- print(" Settings:") +- print(" mRNAs: " + _opts.mRNA_file) +- print(" lncRNAs: " + _opts.lncRNA_file) +- print(" Minimal sequence length (nt): " + str(_opts.min_seq_length) ) +- print(" Thread count: " + str(_opts.thread_count )) +- print(" n-fold cross validation: " + str(_opts.nfold )) +- print(" log2c (from, to, by): " + _opts.log2c ) +- print(" log2g (from, to, by): " + _opts.log2g ) +- print(" k-mer: " + str(_opts.kmer )) +- print(" Prefix of output files: " + _opts.prefix) +- print(" Model (output): " + _opts.modelfile ) +- print(" Range (output): " + _opts.rangefile ) +- with open(logfile, 'a') as log_file: +- log_file.write(" Settings:"+ "\n") +- log_file.write(" mRNAs: " + _opts.mRNA_file+ "\n") +- log_file.write(" lncRNAs: " + _opts.lncRNA_file+ "\n") +- log_file.write(" Minimal sequence length (nt): " + str(_opts.min_seq_length) + "\n") +- log_file.write(" Thread count: " + str(_opts.thread_count )+ "\n") +- log_file.write(" n-fold cross validation: " + str(_opts.nfold )+ "\n") +- log_file.write(" log2c (from, to, by): " + _opts.log2c + "\n") +- log_file.write(" log2g (from, to, by): " + _opts.log2g + "\n") +- log_file.write(" k-mer: " + str(_opts.kmer )+ "\n") +- log_file.write(" Prefix of output files: " + _opts.prefix+ "\n") +- log_file.write(" Model (output): " + _opts.modelfile + "\n") +- log_file.write(" Range (output): " + _opts.rangefile + "\n") +- +- svm_file=str(_opts.prefix)+"_allsvm"; +- print('[{0}] PLEK Modelling 1.2.0 is running'.format(time.strftime('%Y-%m-%d %H:%M:%S'))) +- +- with open(logfile, 'a') as log_file: +- log_file.write(time.strftime('%Y-%m-%d %H:%M:%S')+", calculating k-mer usage frequencies.\n") +- +- # calculate k-mer usage frequencies, output +- print('[{0}] Calculating k-mer usage'.format(time.strftime('%Y-%m-%d %H:%M:%S'))) +- if _opts.mRNA_file!="" and _opts.lncRNA_file!="" and _opts.is_mRNAlncRNA_balanced==1: # balanced +- if not os.path.isfile(_opts.mRNA_file): +- print("ERROR: No such file '" + _opts.mRNA_file + "'") +- sys.exit(1) +- if not os.path.isfile(_opts.lncRNA_file): +- print("ERROR: No such file '" + _opts.lncRNA_file + "'") +- sys.exit(1) +- cmdline = (_opts.script_dir + 'PLEK \\\n -p {0} \\\n -n {1} \\\n -o {2} \\\n -s 1 -d 5 -k {3} -l {4} -b -isoutmsg {5} -isrmtempfile {6}').format\ +- (_opts.mRNA_file, _opts.lncRNA_file, _opts.prefix, _opts.kmer, _opts.min_seq_length, _opts.isoutmsg, _opts.isrmtempfile) +- if _opts.mRNA_file!="" and _opts.lncRNA_file!="" and _opts.is_mRNAlncRNA_balanced==0: # unbalanced +- if not os.path.isfile(_opts.mRNA_file): +- print("ERROR: No such file '" + _opts.mRNA_file + "'") +- sys.exit(1) +- if not os.path.isfile(_opts.lncRNA_file): +- print("ERROR: No such file '" + _opts.lncRNA_file + "'") +- sys.exit(1) +- cmdline = (_opts.script_dir + 'PLEK \\\n -p {0} \\\n -n {1} \\\n -o {2} \\\n -s 1 -d 5 -k {3} -l {4} -isoutmsg {5} -isrmtempfile {6}').format\ +- (_opts.mRNA_file, _opts.lncRNA_file, _opts.prefix, _opts.kmer, _opts.min_seq_length, _opts.isoutmsg, _opts.isrmtempfile) +- +- if _opts.isoutmsg == 1: +- print(" " + cmdline) +- with open(logfile, 'a') as log_file: +- log_file.write("-------------\n\t"+cmdline+"\n-------------\n") +- os.system(cmdline) +- +- +- +- # if unbalanced, get the number of positive and negative samples. +- # awk '$1==1' _allsvm | wc -l +- cmdline="awk '$1==1' " + _opts.prefix + "_allsvm | wc -l " +- pos_sample_no=int(commands.getstatusoutput(cmdline)[1]) +- cmdline="awk '$1==0' " + _opts.prefix + "_allsvm | wc -l " +- neg_sample_no=int(commands.getstatusoutput(cmdline)[1]) +- w1=1 +- w0=1 +- if pos_sample_no>300 and neg_sample_no>300: # cmd was executed successfully. +- if _opts.isadjustweight==1 and pos_sample_no>neg_sample_no: +- w0=pos_sample_no/neg_sample_no +- if _opts.isadjustweight==1 and pos_sample_no {2} ').format\ +- (_opts.rangefile, _opts.prefix + "_allsvm", _opts.prefix + ".scale") +- if _opts.isoutmsg == 1: +- print(" " + cmdline) +- with open(logfile, 'a') as log_file: +- log_file.write("-------------\n\t"+cmdline+"\n-------------\n") +- os.system(cmdline) +- +- +- if not os.path.isfile( _opts.prefix + ".scale"): +- print("ERROR: No such file '" + _opts.prefix + ".scale" + "'") +- sys.exit(1) +- +- with open(logfile, 'a') as log_file: +- log_file.write(time.strftime('%Y-%m-%d %H:%M:%S')+", grid.py.\n") +- with open(logfile, 'a') as log_file: +- log_file.write("\tParameters is logged to " + _opts.prefix + ".scale.grid.out" + "\n") +- +- # grid.py, output to a file for subsequent analysis +- print('[{0}] Choosing optimal classifier parameters. This step is usally time-consuming'.format(time.strftime('%Y-%m-%d %H:%M:%S'))) +- +- new_pos_sample_no=0 +- new_neg_sample_no=0 +- +- scaled_file=_opts.prefix + ".scale" +- if pos_sample_no+neg_sample_no>50000 and (pos_sample_no>_opts.x_fold*neg_sample_no or pos_sample_no*_opts.x_foldneg_sample_no: +- new_pos_sample_no=_opts.x_fold*neg_sample_no +- new_neg_sample_no=neg_sample_no +- else: +- new_pos_sample_no=pos_sample_no +- new_neg_sample_no=_opts.x_fold*pos_sample_no +- +- memory=500+(new_pos_sample_no+new_neg_sample_no)*5000/100000 +- epsilon =0.1 +- if (new_pos_sample_no+new_neg_sample_no)<50000: +- epsilon =0.01 +- if (new_pos_sample_no+new_neg_sample_no)<10000: +- epsilon =0.001 +- +- +- para_select_w1=1 +- para_select_w0=1 +- if _opts.isadjustweight==1 and new_pos_sample_no!=new_neg_sample_no: +- if new_pos_sample_no>new_neg_sample_no: +- para_select_w0=new_pos_sample_no/new_neg_sample_no +- else: +- para_select_w1=new_neg_sample_no/new_pos_sample_no +- +- +- if _opts.isadjustweight==1: +- cmdline= ("python " + _opts.script_dir +grid_file_name+" \\\n -log2c {0} -log2g {1} -thread {2} \\\n -svmtrain {3} \\\n -gnuplot null -v {4} -e "+str(epsilon)+" -m "+str(memory)+" -l "+ logfile +" -w1 {5} -w0 {6} \\\n {7} ").format\ +- (_opts.log2c, _opts.log2g, _opts.thread_count, _opts.svmtrain_pathname, _opts.nfold, para_select_w1, para_select_w0, scaled_file) +- else: +- cmdline= ("python " + _opts.script_dir +grid_file_name+" \\\n -log2c {0} -log2g {1} -thread {2} \\\n -svmtrain {3} \\\n -gnuplot null -v {4} -e "+str(epsilon)+" -m "+str(memory)+" -l "+ logfile +" \\\n {5} ").format\ +- (_opts.log2c, _opts.log2g, _opts.thread_count, _opts.svmtrain_pathname, _opts.nfold, scaled_file) +- +- if _opts.isoutmsg == 1: +- print(" " + cmdline) +- with open(logfile, 'a') as log_file: +- log_file.write("-------------\n\t"+cmdline+"\n-------------\n") +- os.system(cmdline) +- +- if os.path.isfile( _opts.prefix + ".newscale"): +- if os.path.isfile( _opts.prefix + ".scale.grid.out"): +- os.system(" rm " + _opts.prefix + ".scale.grid.out") +- if os.path.isfile( _opts.prefix + ".scale.grid.err"): +- os.system(" rm " + _opts.prefix + ".scale.grid.err") +- os.system(" mv " + _opts.prefix + ".newscale.grid.out " + _opts.prefix + ".scale.grid.out") +- os.system(" mv " + _opts.prefix + ".newscale.grid.err " + _opts.prefix + ".scale.grid.err") +- +- # get optimal parameter: c, g +- # cat 20140530.scale.grid.out | sed 's/parameters.*]//g' | sed 's/(best//g' | sed 's/c=//g' | sed 's/g=//g' | sed 's/rate=//g' | sed 's/)//g'| sed 's/,//g' | awk '{ print $3,$1,$2,$4,$5}'| sort -r | sed -n '1,1p' +- # 91.4 1.0 -2.0 2.0 0.25 +- cmdline="cat " + _opts.prefix + ".scale" +".grid.out | sed 's/parameters.*]//g' | sed 's/(best//g' | sed 's/c=//g' | sed 's/g=//g' | sed 's/rate=//g' | sed 's/)//g'| sed 's/,//g' | awk '{ print $3,$1,$2,$4,$5}' | sort -r | sed -n '1,1p' > " + _opts.prefix + ".scale.grid.out.opt" +- if _opts.isoutmsg == 1: +- print(" " + cmdline) +- with open(logfile, 'a') as log_file: +- log_file.write("-------------\n\t"+cmdline+"\n-------------\n") +- os.system(cmdline) +- +- # output: _opts.prefix + ".scale.grid.out.opt" +- # rate, log2c, log2g, c, g +- rate=0.0 +- log2c=0.0 +- log2g=0.0 +- c=0.0 +- g=0.0 +- for line in open(_opts.prefix + ".scale.grid.out.opt", 'r'): +- line = line.strip() +- rate=float(line.split()[0]) +- log2c=float(line.split()[1]) +- log2g=float(line.split()[2]) +- c=float(line.split()[3]) +- g=float(line.split()[4]) +- +- +- with open(logfile, 'a') as log_file: +- log_file.write("\tOptimal parameters is logged to " + _opts.prefix + ".scale.grid.out.opt" + "\n") +- +- with open(logfile, 'a') as log_file: +- log_file.write(time.strftime('%Y-%m-%d %H:%M:%S')+", building model.\n") +- +- if rate<=0: +- print "ERROR. rate<=0." +- sys.exit(1) +- +- print('[{0}] Building model'.format(time.strftime('%Y-%m-%d %H:%M:%S'))) +- +- # svm-train a model +- #./svm-train -c ${c} -g ${g} -m 3000 rout.scale xxx.model +- +- memory=500+(pos_sample_no+neg_sample_no)*5000/100000 +- if _opts.isadjustweight==1: +- cmdline= (_opts.script_dir +'svm-train \\\n -c {0} -g {1} -m '+str(memory)+' -w1 {2} -w0 {3} -q \\\n {4} \\\n {5} ').format\ +- (c,g, w1, w0, _opts.prefix + ".scale", _opts.prefix + ".model") +- else: +- cmdline= (_opts.script_dir +'svm-train \\\n -c {0} -g {1} -m '+str(memory)+' -q \\\n {2} \\\n {3} ').format\ +- (c,g, _opts.prefix + ".scale", _opts.prefix + ".model") +- +- if _opts.isoutmsg == 1: +- print(" " + cmdline) +- with open(logfile, 'a') as log_file: +- log_file.write("-------------\n\t"+cmdline+"\n-------------\n") +- if c<0 or g<0: +- print("\t"+"c<0 or g<0") +- sys.exit(1) +- os.system(cmdline) +- +- +- # remove temporary files +- # os.remove(_opts.prefix+'_temp_'+str(fn)) +- if _opts.isrmtempfile==1: +- if os.path.isfile( _opts.prefix + "_allsvm"): +- os.remove(_opts.prefix + "_allsvm") +- if os.path.isfile( _opts.prefix + "_allsvmdesc"): +- os.remove(_opts.prefix + "_allsvmdesc") +- #if os.path.isfile( _opts.prefix + "_logs"): +- # os.remove(_opts.prefix + "_logs") +- if os.path.isfile( _opts.prefix + ".scale"): +- os.remove(_opts.prefix + ".scale") +- if os.path.isfile( _opts.prefix + ".newscale"): +- os.remove(_opts.prefix + ".newscale") +- #if os.path.isfile( _opts.prefix + ".scale.grid.err"): +- # os.remove(_opts.prefix + ".scale.grid.err") +- #if os.path.isfile( _opts.prefix + ".scale.grid.out"): +- # os.remove(_opts.prefix + ".scale.grid.out") +- #if os.path.isfile( _opts.prefix + ".scale.grid.out.opt"): +- # os.remove(_opts.prefix + ".scale.grid.out.opt") +- if os.path.isfile( _opts.prefix + ".scale"): +- os.remove(_opts.prefix + ".scale") +- +- # output +- print('[{0}] Run complete'.format(time.strftime('%Y-%m-%d %H:%M:%S'))) +- print(' Model file: {0}'.format(_opts.modelfile)) +- print(' Range file: {0}'.format(_opts.rangefile)) +- +- with open(logfile, 'a') as log_file: +- log_file.write(' Model file: {0}'.format(_opts.modelfile) + "\n") +- with open(logfile, 'a') as log_file: +- log_file.write(' Range file: {0}'.format(_opts.rangefile) + "\n") +- +- with open(logfile, 'a') as log_file: +- log_file.write(time.strftime('%Y-%m-%d %H:%M:%S')+", end.\n") +- +- sys.exit(0) +- +- except (IOError,ValueError) as e: +- sys.stderr.write(str(e) + '\n') +- sys.stderr.write('Try "python {0}" for more information.\n'.format(sys.arg[0])) +- sys.exit(1) ++#!/usr/bin/env python ++####################################################### ++# ++# PLEK Modelling - build predictor of lncRNAs and mRNAs based on k-mer scheme ++# Authors: Aimin Li, Junying Zhang ++# Contacts: LiAiminMail@gmail.com, jyzhang@mail.xidian.edu.cn ++# Webcite: https://sourceforge.net/projects/plek/ ++# Version: 1.2 ++# Updated on: June 26, 2014 ++# ++####################################################### ++ ++ ++__all__ = [''] ++import os, sys, traceback, getpass, time, re, subprocess ++from threading import Thread ++ ++ ++class GridOption: # set or get input parameters ++ args="" ++ ++ def __init__(self, options): ++ dirname = os.path.dirname(__file__) ++ self.svmtrain_pathname = os.path.join(dirname, './svm-train') ++ self.svmpredict_pathname = os.path.join(dirname, './svm-predict') ++ self.svmscale_pathname = os.path.join(dirname, './svm-scale') ++ self.mRNA_file = "" ++ self.lncRNA_file = "" ++ self.log2c = "0,5,1" # 0,1,2,3,4,5 ++ self.log2g = "0,-5,-1" # 0,-1,-2,-3,-4,-5 ++ self.prefix = "plek_mdl_" ++ self.rangefile = "" ++ self.is_mRNAlncRNA_balanced = 0 ++ self.thread_count = 12 ++ self.modelfile="" ++ self.kmer=5 ++ self.min_seq_length=200 ++ self.unkown=0 ++ self.is_recompile=0 ++ self.isoutmsg=0 ++ self.isrmtempfile=1 ++ self.isadjustweight=0 ++ self.nfold=10 ++ self.script_dir="./" ++ self.islogging=1 ++ self.x_fold=1 # down-sampling fold ++ self.parse_opts(options) ++ ++ def parse_opts(self, options): ++ args=options # save options to args ++ if type(options) == str: ++ options = options.split() ++ i = 0 ++ pass_through_opts = [] ++ # get python script file's name, args[0] ++ # determine it is with dir or only file_name ++ script_name=args[0] ++ ++ if script_name.rfind('/')>=0: ++ self.script_dir=script_name[:script_name.rfind('/')+1] ++ ++ self.svmtrain_pathname = self.script_dir + 'svm-train' ++ self.svmpredict_pathname = self.script_dir + 'svm-predict' ++ self.svmscale_pathname = self.script_dir + 'svm-scale' ++ ++ while i < len(options): ++ if options[i] == '-mRNA': # a file to provide mRNA transcript sequences in fasta format. ++ i = i + 1 ++ self.mRNA_file = options[i] ++ elif options[i] == '-lncRNA': # a file to provide lncRNA transcript sequences in fasta format. ++ i = i + 1 ++ self.lncRNA_file = options[i] ++ elif options[i] == '-thread': # The number of threads for running the PLEK Modelling program. The bigger this number is, the faster it runs. ++ i = i + 1 ++ self.thread_count = int(options[i]) ++ elif options[i] == '-log2c': # The search range of svm C parameter. Format: from, to, by. i.e. 1,5,1 means log2c=1,2,3,4,5. ++ i = i + 1 ++ self.log2c = options[i] ++ elif options[i] == '-log2g': # The search range of svm G parameter. Format: from, to, by. i.e. 1,-4,-1 means log2g=1,0,-1,-2,-3,-4. ++ i = i + 1 ++ self.log2g = options[i] ++ elif options[i] == '-minlength': # The minimum length of sequences. The sequences whose lengths are more than minlength will be processed. ++ i = i + 1 ++ self.min_seq_length = int(options[i]) ++ elif options[i] == '-isoutmsg': # Output messages to stdout(screen) or not. "0" means that PLEK be run quietly. "1" means that PLEK outputs the details of processing. ++ i = i + 1 ++ self.isoutmsg = int(options[i]) ++ elif options[i] == '-isrmtempfile': # Remove temporary files or not. "0" means that PLEK retains temporary files. "1" means that PLEK remove temporary files. ++ i = i + 1 ++ self.isrmtempfile = int(options[i]) ++ elif options[i] == '-nfold': # n-fold cross validation in search for optimal parameters. ++ i = i + 1 ++ self.nfold = int(options[i]) ++ elif options[i] == '-k': # range of k. k=5 means that we will calculate usage of 1364 k-mer patterns. (k=1, 4 patterns; k=2, 16; k=3, 64; k=4, 256; k=5, 1024; 1364=4+64+256+1024) ++ i = i + 1 ++ self.kmer = int(options[i]) ++ elif options[i] == '-model': # svm model file (output). ++ i = i + 1 ++ self.modelfile = options[i] ++ elif options[i] == '-range': # svm range file (output). ++ i = i + 1 ++ self.rangefile = options[i] ++ elif options[i] == '-prefix': # The prefix of output files. ++ i = i + 1 ++ self.prefix = options[i] ++ elif options[i] == '-isbalanced': # NOTE: isbalanced=1, need to be balanced. If the samples are unbalanced, it will subsample the overrepresented class to obtain an equal amount of positives and negatives; isbalanced=0, not to be balanced. If the samples are unbalanced, svm will reweight the misclassification cost (adjust the wi parameters). ++ i = i + 1 ++ self.is_mRNAlncRNA_balanced = int(options[i]) ++ elif options[i] == '-isrecompile': # re-compile source. ++ i = i + 1 ++ self.is_recompile = int(options[i]) ++ elif options[i] == '-isadjustweight': # isadjustweight. ++ i = i + 1 ++ self.isadjustweight = int(options[i]) ++ elif options[i] == '-x_fold': # ++ i = i + 1 ++ self.x_fold = int(options[i]) ++ elif options[i] == '-islogging': # ++ i = i + 1 ++ self.islogging = int(options[i]) ++ else: ++ pass_through_opts.append(options[i]) ++ i = i + 1 ++ ++ self.pass_through_string = ' '.join(pass_through_opts) ++ ++ ++if __name__ == '__main__': ++ def exit_with_help(): ++ print("""\ ++===================== ++ USAGE AND EXAMPLES ++===================== ++Usage of PLEK Modelling -- used to build your own classifier with your ++ training data (mRNA/lncRNA transcripts): ++ ++python PLEKModelling.py -mRNA mRNAs_fasta -lncRNA lncRNAs_fasta ++ -prefix prefix_of_output -log2c range_of_log2c -log2g range_of_log2g ++ -thread number_of_threads -model model_file -range range_file ++ -minlength min_length_of_sequence -isoutmsg 0_or_1 -isrmtempfile 0_or_1 ++ -k k_mer -nfold n_fold_cross_validation -isbalanced 0_or_1 ++ ++ -mRNA mRNA transcripts used to build predictor, in fasta format. ++ ++ -lncRNA lncRNA transcripts used to build predictor, in fasta format. ++ ++ -prefix Prefix of the output files. ++ ++ -log2c (Optional) The specified range of C parameter for the svm parameter ++ search. Default value: 0,5,1. (from, to, by; 0,1,2,3,4,5) ++ ++ -log2g (Optional) The specified range of G parameter for the svm parameter ++ search. Default value: 0,-5,-1.(from, to, by; 0,-1,-2,-3,-4,-5) ++ ++ -thread (Optional) The number of threads for running the PLEKModelling ++ program. The bigger this number is, the faster PLEKModelling runs. ++ Note that a larger thread number means larger consumption of memory. ++ Default value: 12. ++ ++ -model (Optional) The name of a predictor model file (an output file ++ by PLEKModelling.py). ++ ++ -range (Optional) The name of a svm range file (an output file by ++ PLEKModelling.py). ++ ++ -minlength (Optional) The minimum length of sequences. The sequences whose ++ lengths are more than minlength will be processed. Default ++ value: 200. ++ ++ -isoutmsg (Optional) Output messages to stdout(screen) or not. "0" means ++ that PLEKModelling be run quietly. "1" means that PLEKModelling ++ outputs the details of processing. Default value: 0. ++ ++ -isrmtempfile (Optional) Remove temporary files or not. "0" means that PLEKModelling ++ retains temporary files. "1" means that PLEKModelling remove temporary ++ files. Default value: 1. ++ ++ -k (Optional) range of k. k=5 means that we will calculate usage of ++ 1364 k-mer patterns. (k=1, 4 patterns; k=2, 16; k=3, 64; k=4, 256; ++ k=5, 1024; 1364=4+64+256+1024). Default value: 5. ++ ++ -nfold (Optional) n-fold cross-validation in search for optimal parameters. ++ Default value: 10. ++ ++ -isbalanced (Optional) In the case of isbalanced=1, if the samples are ++ unbalanced, it will subsample the overrepresented class to obtain an ++ equal amount of positives and negatives. ++ Default value: 0. ++ ++ ++Examples: ++1. $ python PLEKModelling.py -mRNA PLEK_mRNAs.fa -lncRNA PLEK_lncRNAs.fa -prefix 20140531 ++ ++ NOTE: To train a classifier using the mRNA sequences in the 'PLEK_mRNAs.fa' file ++ and lncRNA in 'PLEK_lncRNAs.fa'. The program outputs the model in the file ++ '20140531.model' and the svm-scale range in '20140531.range'. ++ We can use the new model as follows: ++ python PLEK.py -fasta PLEK_test.fa -out 20140531.predicted -thread 10 \\ ++ -range 20140531.range -model 20140531.model ++ ++2. $ python PLEKModelling.py -mRNA PLEK_mRNAs.fa -lncRNA PLEK_lncRNAs.fa -prefix 20140601 \\ ++ -log2c 1,3,1 -log2g -1,-3,-1 -nfold 2 -k 4 ++ ++ NOTE: This example is used to demonstrate the usage of PLEKModelling.py ++ in a simple/quick way. User can run this to check if our program can run correctly. ++ To train a classifier using the mRNA sequences in the 'PLEK_mRNAs.fa' file ++ and lncRNA in 'PLEK_lncRNAs.fa'. The range of log2c is 1,2,3. The range of log2g ++ is -1,-2,-3. Use a 2-fold cross-validation. K is 4, it will calculate the usage ++ of 340 patterns (4+16+63+256=340). The program outputs the model in the file ++ '20140601.model' and the svm-scale range in '20140601.range'. ++ We can use the new model as follows: ++ python PLEK.py -fasta PLEK_test.fa -out 20140601.predicted -thread 10 \\ ++ -range 20140601.range -model 20140601.model -k 4 ++ ++Notes: ++ (1) In general, it is time-consuming to build a new classifier. ++ (2) The accuracy of a classifier model is connected with the quality and ++ quantity of training samples. We encourage users to supply as many reliable ++ samples as possible to PLEKModelling.py to train a classifier. We suggest ++ that transcripts annotated with 'pseudogene', 'predicted' and 'putative' ++ be removed before training models. ++ (3) To parallel run PLEKModelling.py in PBS, please see ++ PLEK_howto_generate_scripts.pdf ++ ++ ++===================== ++ CONTACTS ++===================== ++Aimin Li: LiAiminMail@gmail.com ++Junying Zhang: jyzhang@mail.xidian.edu.cn ++ ++====================== ++ WEBSITE ++===================== ++https://sourceforge.net/projects/plek/ ++ """) ++ sys.exit(1) ++ ++ ++ def compile_c(_opts): # re-compile source ++ print('[{0}] Compiling svm, svm-train, svm-predict, svm-scale'.format(time.strftime('%Y-%m-%d %H:%M:%S'))) ++ os.system("g++ -c " + _opts.script_dir + "svm.cpp -o " + _opts.script_dir + "svm.o") ++ os.system("LNAG=C gcc -g -Wall " + _opts.script_dir + "svm-train.c " + _opts.script_dir + "svm.o -o " + _opts.script_dir + "svm-train -lstdc++ -lm") ++ os.system("LNAG=C gcc -g -Wall " + _opts.script_dir + "svm-predict.c " + _opts.script_dir + "svm.o -o " + _opts.script_dir + "svm-predict -lstdc++ -lm") ++ os.system("LNAG=C gcc -g -Wall " + _opts.script_dir + "svm-scale.c " + _opts.script_dir + "svm.o -o " + _opts.script_dir + "svm-scale -lstdc++ -lm") ++ ++ print('[{0}] Compiling PLEK_main, PLEK_spsn'.format(time.strftime('%Y-%m-%d %H:%M:%S'))) ++ os.system("LNAG=C gcc -g -Wall " + _opts.script_dir + "PLEK_main.c -o " + _opts.script_dir + "PLEK -lm") ++ os.system("LNAG=C gcc -g -Wall " + _opts.script_dir + "PLEK_spsn.c -o " + _opts.script_dir + "PLEK_spsn -lm ") ++ ++ def sampling(pos_number, neg_number, prefix, x_fold): ++ if pos_number> neg_number: ++ os.system(' grep -e "^1" '+prefix+'.scale | sort -R | sort -R | sed -n "1,'+str(x_fold*neg_number)+'p" > '+prefix+'.pos_selected ') ++ os.system(' grep -e "^0" '+prefix+'.scale > '+prefix+'.neg_selected ') ++ os.system(' cat '+prefix+'.pos_selected '+prefix+'.neg_selected > '+prefix+'.newscale ') ++ os.system(' rm '+prefix+'.pos_selected ') ++ os.system(' rm '+prefix+'.neg_selected ') ++ if neg_number> pos_number: ++ os.system(' grep -e "^0" '+prefix+'.scale | sort -R | sort -R | sed -n "1,'+str(x_fold*pos_number)+'p" > '+prefix+'.neg_selected ') ++ os.system(' grep -e "^1" '+prefix+'.scale > '+prefix+'.pos_selected ') ++ os.system(' cat '+prefix+'.pos_selected '+prefix+'.neg_selected > '+prefix+'.newscale ') ++ os.system(' rm '+prefix+'.pos_selected ') ++ os.system(' rm '+prefix+'.neg_selected ') ++ ++ if len(sys.argv) < 2: ++ exit_with_help() ++ options = sys.argv ++ try: ++ ++ print('[{0}] Beginning PLEK Modelling run (Version 1.2) '.format(time.strftime('%Y-%m-%d %H:%M:%S'))) ++ ++ # get input options ++ _opts = GridOption(options); ++ cmdline=None; ++ ++ c1,c2,step1=_opts.log2c.split(",") ++ g1,g2,step2=_opts.log2g.split(",") ++ grid_file_name="svm_grid_modelling.py" ++ if c1==c2 and g1==g2: ++ grid_file_name="svm_grid_modelling_singlet.py" ++ ++ logfile=_opts.prefix + "_modelling.logs" ++ if _opts.islogging==1: ++ if os.path.isfile(logfile): ++ os.remove(logfile) ++ if not os.path.isfile(logfile): ++ open(logfile, 'a').close() ++ with open(logfile, 'a') as log_file: ++ log_file.write(time.strftime('%Y-%m-%d %H:%M:%S')+", started.\n") ++ # recompile source ++ if _opts.is_recompile or (not os.path.isfile(_opts.script_dir + 'PLEK')): ++ compile_c(_opts) ++ else: ++ time.sleep(2) ++ ++ # check if the mRNA/lncRNA file exists ++ if not os.path.isfile( _opts.mRNA_file): ++ print("ERROR: No such file '" + _opts.mRNA_file + "'") ++ with open(logfile, 'a') as log_file: ++ log_file.write("ERROR: No such file '" + _opts.mRNA_file + "'\n") ++ sys.exit(1) ++ if not os.path.isfile( _opts.lncRNA_file): ++ print("ERROR: No such file '" + _opts.lncRNA_file + "'") ++ with open(logfile, 'a') as log_file: ++ log_file.write("ERROR: No such file '" + _opts.lncRNA_file + "'\n") ++ sys.exit(1) ++ ++ if _opts.modelfile=="": ++ _opts.modelfile=_opts.prefix + ".model" ++ if _opts.rangefile=="": ++ _opts.rangefile=_opts.prefix + ".range" ++ ++ # output options: ++ print(" Settings:") ++ print(" mRNAs: " + _opts.mRNA_file) ++ print(" lncRNAs: " + _opts.lncRNA_file) ++ print(" Minimal sequence length (nt): " + str(_opts.min_seq_length) ) ++ print(" Thread count: " + str(_opts.thread_count )) ++ print(" n-fold cross validation: " + str(_opts.nfold )) ++ print(" log2c (from, to, by): " + _opts.log2c ) ++ print(" log2g (from, to, by): " + _opts.log2g ) ++ print(" k-mer: " + str(_opts.kmer )) ++ print(" Prefix of output files: " + _opts.prefix) ++ print(" Model (output): " + _opts.modelfile ) ++ print(" Range (output): " + _opts.rangefile ) ++ with open(logfile, 'a') as log_file: ++ log_file.write(" Settings:"+ "\n") ++ log_file.write(" mRNAs: " + _opts.mRNA_file+ "\n") ++ log_file.write(" lncRNAs: " + _opts.lncRNA_file+ "\n") ++ log_file.write(" Minimal sequence length (nt): " + str(_opts.min_seq_length) + "\n") ++ log_file.write(" Thread count: " + str(_opts.thread_count )+ "\n") ++ log_file.write(" n-fold cross validation: " + str(_opts.nfold )+ "\n") ++ log_file.write(" log2c (from, to, by): " + _opts.log2c + "\n") ++ log_file.write(" log2g (from, to, by): " + _opts.log2g + "\n") ++ log_file.write(" k-mer: " + str(_opts.kmer )+ "\n") ++ log_file.write(" Prefix of output files: " + _opts.prefix+ "\n") ++ log_file.write(" Model (output): " + _opts.modelfile + "\n") ++ log_file.write(" Range (output): " + _opts.rangefile + "\n") ++ ++ svm_file=str(_opts.prefix)+"_allsvm"; ++ print('[{0}] PLEK Modelling 1.2.0 is running'.format(time.strftime('%Y-%m-%d %H:%M:%S'))) ++ ++ with open(logfile, 'a') as log_file: ++ log_file.write(time.strftime('%Y-%m-%d %H:%M:%S')+", calculating k-mer usage frequencies.\n") ++ ++ # calculate k-mer usage frequencies, output ++ print('[{0}] Calculating k-mer usage'.format(time.strftime('%Y-%m-%d %H:%M:%S'))) ++ if _opts.mRNA_file!="" and _opts.lncRNA_file!="" and _opts.is_mRNAlncRNA_balanced==1: # balanced ++ if not os.path.isfile(_opts.mRNA_file): ++ print("ERROR: No such file '" + _opts.mRNA_file + "'") ++ sys.exit(1) ++ if not os.path.isfile(_opts.lncRNA_file): ++ print("ERROR: No such file '" + _opts.lncRNA_file + "'") ++ sys.exit(1) ++ cmdline = (_opts.script_dir + 'PLEK \\\n -p {0} \\\n -n {1} \\\n -o {2} \\\n -s 1 -d 5 -k {3} -l {4} -b -isoutmsg {5} -isrmtempfile {6}').format\ ++ (_opts.mRNA_file, _opts.lncRNA_file, _opts.prefix, _opts.kmer, _opts.min_seq_length, _opts.isoutmsg, _opts.isrmtempfile) ++ if _opts.mRNA_file!="" and _opts.lncRNA_file!="" and _opts.is_mRNAlncRNA_balanced==0: # unbalanced ++ if not os.path.isfile(_opts.mRNA_file): ++ print("ERROR: No such file '" + _opts.mRNA_file + "'") ++ sys.exit(1) ++ if not os.path.isfile(_opts.lncRNA_file): ++ print("ERROR: No such file '" + _opts.lncRNA_file + "'") ++ sys.exit(1) ++ cmdline = (_opts.script_dir + 'PLEK \\\n -p {0} \\\n -n {1} \\\n -o {2} \\\n -s 1 -d 5 -k {3} -l {4} -isoutmsg {5} -isrmtempfile {6}').format\ ++ (_opts.mRNA_file, _opts.lncRNA_file, _opts.prefix, _opts.kmer, _opts.min_seq_length, _opts.isoutmsg, _opts.isrmtempfile) ++ ++ if _opts.isoutmsg == 1: ++ print(" " + cmdline) ++ with open(logfile, 'a') as log_file: ++ log_file.write("-------------\n\t"+cmdline+"\n-------------\n") ++ os.system(cmdline) ++ ++ ++ ++ # if unbalanced, get the number of positive and negative samples. ++ # awk '$1==1' _allsvm | wc -l ++ cmdline="awk '$1==1' " + _opts.prefix + "_allsvm | wc -l " ++ pos_sample_no=int(subprocess.getstatusoutput(cmdline)[1]) ++ cmdline="awk '$1==0' " + _opts.prefix + "_allsvm | wc -l " ++ neg_sample_no=int(subprocess.getstatusoutput(cmdline)[1]) ++ w1=1 ++ w0=1 ++ if pos_sample_no>300 and neg_sample_no>300: # cmd was executed successfully. ++ if _opts.isadjustweight==1 and pos_sample_no>neg_sample_no: ++ w0=pos_sample_no/neg_sample_no ++ if _opts.isadjustweight==1 and pos_sample_no {2} ').format\ ++ (_opts.rangefile, _opts.prefix + "_allsvm", _opts.prefix + ".scale") ++ if _opts.isoutmsg == 1: ++ print(" " + cmdline) ++ with open(logfile, 'a') as log_file: ++ log_file.write("-------------\n\t"+cmdline+"\n-------------\n") ++ os.system(cmdline) ++ ++ ++ if not os.path.isfile( _opts.prefix + ".scale"): ++ print("ERROR: No such file '" + _opts.prefix + ".scale" + "'") ++ sys.exit(1) ++ ++ with open(logfile, 'a') as log_file: ++ log_file.write(time.strftime('%Y-%m-%d %H:%M:%S')+", grid.py.\n") ++ with open(logfile, 'a') as log_file: ++ log_file.write("\tParameters is logged to " + _opts.prefix + ".scale.grid.out" + "\n") ++ ++ # grid.py, output to a file for subsequent analysis ++ print('[{0}] Choosing optimal classifier parameters. This step is usally time-consuming'.format(time.strftime('%Y-%m-%d %H:%M:%S'))) ++ ++ new_pos_sample_no=0 ++ new_neg_sample_no=0 ++ ++ scaled_file=_opts.prefix + ".scale" ++ if pos_sample_no+neg_sample_no>50000 and (pos_sample_no>_opts.x_fold*neg_sample_no or pos_sample_no*_opts.x_foldneg_sample_no: ++ new_pos_sample_no=_opts.x_fold*neg_sample_no ++ new_neg_sample_no=neg_sample_no ++ else: ++ new_pos_sample_no=pos_sample_no ++ new_neg_sample_no=_opts.x_fold*pos_sample_no ++ ++ memory=500+(new_pos_sample_no+new_neg_sample_no)*5000/100000 ++ epsilon =0.1 ++ if (new_pos_sample_no+new_neg_sample_no)<50000: ++ epsilon =0.01 ++ if (new_pos_sample_no+new_neg_sample_no)<10000: ++ epsilon =0.001 ++ ++ ++ para_select_w1=1 ++ para_select_w0=1 ++ if _opts.isadjustweight==1 and new_pos_sample_no!=new_neg_sample_no: ++ if new_pos_sample_no>new_neg_sample_no: ++ para_select_w0=new_pos_sample_no/new_neg_sample_no ++ else: ++ para_select_w1=new_neg_sample_no/new_pos_sample_no ++ ++ ++ if _opts.isadjustweight==1: ++ cmdline= ("python " + _opts.script_dir +grid_file_name+" \\\n -log2c {0} -log2g {1} -thread {2} \\\n -svmtrain {3} \\\n -gnuplot null -v {4} -e "+str(epsilon)+" -m "+str(memory)+" -l "+ logfile +" -w1 {5} -w0 {6} \\\n {7} ").format\ ++ (_opts.log2c, _opts.log2g, _opts.thread_count, _opts.svmtrain_pathname, _opts.nfold, para_select_w1, para_select_w0, scaled_file) ++ else: ++ cmdline= ("python " + _opts.script_dir +grid_file_name+" \\\n -log2c {0} -log2g {1} -thread {2} \\\n -svmtrain {3} \\\n -gnuplot null -v {4} -e "+str(epsilon)+" -m "+str(memory)+" -l "+ logfile +" \\\n {5} ").format\ ++ (_opts.log2c, _opts.log2g, _opts.thread_count, _opts.svmtrain_pathname, _opts.nfold, scaled_file) ++ ++ if _opts.isoutmsg == 1: ++ print(" " + cmdline) ++ with open(logfile, 'a') as log_file: ++ log_file.write("-------------\n\t"+cmdline+"\n-------------\n") ++ os.system(cmdline) ++ ++ if os.path.isfile( _opts.prefix + ".newscale"): ++ if os.path.isfile( _opts.prefix + ".scale.grid.out"): ++ os.system(" rm " + _opts.prefix + ".scale.grid.out") ++ if os.path.isfile( _opts.prefix + ".scale.grid.err"): ++ os.system(" rm " + _opts.prefix + ".scale.grid.err") ++ os.system(" mv " + _opts.prefix + ".newscale.grid.out " + _opts.prefix + ".scale.grid.out") ++ os.system(" mv " + _opts.prefix + ".newscale.grid.err " + _opts.prefix + ".scale.grid.err") ++ ++ # get optimal parameter: c, g ++ # cat 20140530.scale.grid.out | sed 's/parameters.*]//g' | sed 's/(best//g' | sed 's/c=//g' | sed 's/g=//g' | sed 's/rate=//g' | sed 's/)//g'| sed 's/,//g' | awk '{ print $3,$1,$2,$4,$5}'| sort -r | sed -n '1,1p' ++ # 91.4 1.0 -2.0 2.0 0.25 ++ cmdline="cat " + _opts.prefix + ".scale" +".grid.out | sed 's/parameters.*]//g' | sed 's/(best//g' | sed 's/c=//g' | sed 's/g=//g' | sed 's/rate=//g' | sed 's/)//g'| sed 's/,//g' | awk '{ print $3,$1,$2,$4,$5}' | sort -r | sed -n '1,1p' > " + _opts.prefix + ".scale.grid.out.opt" ++ if _opts.isoutmsg == 1: ++ print(" " + cmdline) ++ with open(logfile, 'a') as log_file: ++ log_file.write("-------------\n\t"+cmdline+"\n-------------\n") ++ os.system(cmdline) ++ ++ # output: _opts.prefix + ".scale.grid.out.opt" ++ # rate, log2c, log2g, c, g ++ rate=0.0 ++ log2c=0.0 ++ log2g=0.0 ++ c=0.0 ++ g=0.0 ++ for line in open(_opts.prefix + ".scale.grid.out.opt", 'r'): ++ line = line.strip() ++ rate=float(line.split()[0]) ++ log2c=float(line.split()[1]) ++ log2g=float(line.split()[2]) ++ c=float(line.split()[3]) ++ g=float(line.split()[4]) ++ ++ ++ with open(logfile, 'a') as log_file: ++ log_file.write("\tOptimal parameters is logged to " + _opts.prefix + ".scale.grid.out.opt" + "\n") ++ ++ with open(logfile, 'a') as log_file: ++ log_file.write(time.strftime('%Y-%m-%d %H:%M:%S')+", building model.\n") ++ ++ if rate<=0: ++ print("ERROR. rate<=0.") ++ sys.exit(1) ++ ++ print('[{0}] Building model'.format(time.strftime('%Y-%m-%d %H:%M:%S'))) ++ ++ # svm-train a model ++ #./svm-train -c ${c} -g ${g} -m 3000 rout.scale xxx.model ++ ++ memory=500+(pos_sample_no+neg_sample_no)*5000/100000 ++ if _opts.isadjustweight==1: ++ cmdline= (_opts.script_dir +'svm-train \\\n -c {0} -g {1} -m '+str(memory)+' -w1 {2} -w0 {3} -q \\\n {4} \\\n {5} ').format\ ++ (c,g, w1, w0, _opts.prefix + ".scale", _opts.prefix + ".model") ++ else: ++ cmdline= (_opts.script_dir +'svm-train \\\n -c {0} -g {1} -m '+str(memory)+' -q \\\n {2} \\\n {3} ').format\ ++ (c,g, _opts.prefix + ".scale", _opts.prefix + ".model") ++ ++ if _opts.isoutmsg == 1: ++ print(" " + cmdline) ++ with open(logfile, 'a') as log_file: ++ log_file.write("-------------\n\t"+cmdline+"\n-------------\n") ++ if c<0 or g<0: ++ print("\t"+"c<0 or g<0") ++ sys.exit(1) ++ os.system(cmdline) ++ ++ ++ # remove temporary files ++ # os.remove(_opts.prefix+'_temp_'+str(fn)) ++ if _opts.isrmtempfile==1: ++ if os.path.isfile( _opts.prefix + "_allsvm"): ++ os.remove(_opts.prefix + "_allsvm") ++ if os.path.isfile( _opts.prefix + "_allsvmdesc"): ++ os.remove(_opts.prefix + "_allsvmdesc") ++ #if os.path.isfile( _opts.prefix + "_logs"): ++ # os.remove(_opts.prefix + "_logs") ++ if os.path.isfile( _opts.prefix + ".scale"): ++ os.remove(_opts.prefix + ".scale") ++ if os.path.isfile( _opts.prefix + ".newscale"): ++ os.remove(_opts.prefix + ".newscale") ++ #if os.path.isfile( _opts.prefix + ".scale.grid.err"): ++ # os.remove(_opts.prefix + ".scale.grid.err") ++ #if os.path.isfile( _opts.prefix + ".scale.grid.out"): ++ # os.remove(_opts.prefix + ".scale.grid.out") ++ #if os.path.isfile( _opts.prefix + ".scale.grid.out.opt"): ++ # os.remove(_opts.prefix + ".scale.grid.out.opt") ++ if os.path.isfile( _opts.prefix + ".scale"): ++ os.remove(_opts.prefix + ".scale") ++ ++ # output ++ print('[{0}] Run complete'.format(time.strftime('%Y-%m-%d %H:%M:%S'))) ++ print(' Model file: {0}'.format(_opts.modelfile)) ++ print(' Range file: {0}'.format(_opts.rangefile)) ++ ++ with open(logfile, 'a') as log_file: ++ log_file.write(' Model file: {0}'.format(_opts.modelfile) + "\n") ++ with open(logfile, 'a') as log_file: ++ log_file.write(' Range file: {0}'.format(_opts.rangefile) + "\n") ++ ++ with open(logfile, 'a') as log_file: ++ log_file.write(time.strftime('%Y-%m-%d %H:%M:%S')+", end.\n") ++ ++ sys.exit(0) ++ ++ except (IOError,ValueError) as e: ++ sys.stderr.write(str(e) + '\n') ++ sys.stderr.write('Try "python {0}" for more information.\n'.format(sys.arg[0])) ++ sys.exit(1) +--- PLEK.py 2014-06-23 18:10:34.000000000 -0500 ++++ PLEK.py.new 2018-10-30 12:08:29.801884548 -0500 +@@ -1,412 +1,412 @@ +-#!/usr/bin/env python +-####################################################### +-# +-# PLEK - predictor of lncRNAs and mRNAs based on k-mer scheme +-# Authors: Aimin Li, JunYing Zhang +-# Contacts: LiAiminMail@gmail.com, jyzhang@mail.xidian.edu.cn +-# Webcite: https://sourceforge.net/projects/plek/ +-# Version: 1.2 +-# Updated on: June 19, 2014 +-# +-####################################################### +- +-#usage: python PLEK.py -fasta fasta_file -out prefix_of_output_file -thread number_of_threads +- +-#example: python PLEK.py -fasta PLEK_test.fa -out myfile -thread 10 +-#output: myfile +- +-__all__ = [''] +-import os, sys, traceback, getpass, time, re +-from threading import Thread +-from subprocess import * +- +-class SVMScaleThread(Thread): # class for svm-scale +- def __init__(self, range_file, svm_origin, svm_scaled, script_dir): +- Thread.__init__(self) +- self.range_file = range_file +- self.svm_origin = svm_origin +- self.svm_scaled = svm_scaled +- self.script_dir = script_dir +- +- def run(self): +- cmdline= (self.script_dir +'svm-scale -r {0} {1} > {2} ').format\ +- (self.range_file, self.svm_origin, self.svm_scaled) +- os.system(cmdline) +- +-class SVMPredictThread(Thread): # class for svm-predict +- def __init__(self, svm_scaled, svm_model, predicted, script_dir): +- Thread.__init__(self) +- self.svm_scaled = svm_scaled +- self.svm_model = svm_model +- self.predicted = predicted +- self.script_dir = script_dir +- +- def run(self): +- cmdline= (self.script_dir + 'svm-predict {0} {1} {2} ').format\ +- (self.svm_scaled,self.svm_model,self.predicted) +- os.system(cmdline) +- +- +-class GridOption: # set or get input parameters +- def __init__(self, options): +- dirname = os.path.dirname(__file__) +- self.svmtrain_pathname = os.path.join(dirname, './svm-train') +- self.svmpredict_pathname = os.path.join(dirname, './svm-predict') +- self.svmscale_pathname = os.path.join(dirname, './svm-scale') +- self.pos_file = "" +- self.neg_file = "" +- self.prefix = "plek_output_" +- self.svmrangefile = "PLEK.range" +- self.is_posneg_balanced = 0 +- self.thread_count = 5 +- self.modelfile="PLEK.model" +- self.kmer=5 +- self.min_seq_length=200 +- self.unkown=0 +- self.is_recompile=0 +- self.input_type=1 +- self.isoutmsg=0 +- self.isrmtempfile=1 +- self.script_dir="./" +- self.parse_options(options) +- +- def parse_options(self, options): +- args=options # save options to args +- if type(options) == str: +- options = options.split() +- i = 0 +- pass_through_options = [] +- # get python script file's name, args[0] +- # determine it is with dir or only file_name +- script_name=args[0] +- #print strHello +- if script_name.rfind('/')>=0: +- self.script_dir=script_name[:script_name.rfind('/')+1] +- +- self.svmtrain_pathname = self.script_dir + 'svm-train' +- self.svmpredict_pathname = self.script_dir + 'svm-predict' +- self.svmscale_pathname = self.script_dir + 'svm-scale' +- self.svmrangefile = self.script_dir +"PLEK.range" +- self.modelfile = self.script_dir +"PLEK.model" +- +- while i < len(options): +- if options[i] == '-fasta': # The name of a fasta file, its sequences are to be predicted. +- i = i + 1 +- self.pos_file = options[i] +- self.unkown=1 +- elif options[i] == '-thread': # The number of threads for running the PLEK program. The bigger this number is, the faster PLEK runs. +- i = i + 1 +- self.thread_count = options[i] +- elif options[i] == '-out': # The file name for the results of prediction. Predicted positive samples are labeled as "Coding", and negative as "Non-coding". +- i = i + 1 +- self.prefix = options[i] +- elif options[i] == '-minlength': # The minimum length of sequences. The sequences whose lengths are more than minlength will be processed. +- i = i + 1 +- self.min_seq_length = options[i] +- elif options[i] == '-isoutmsg': # Output messages to stdout(screen) or not. "0" means that PLEK be run quietly. "1" means that PLEK outputs the details of processing. +- i = i + 1 +- self.isoutmsg = options[i] +- elif options[i] == '-isrmtempfile': # Remove temporary files or not. "0" means that PLEK retains temporary files. "1" means that PLEK remove temporary files. +- i = i + 1 +- self.isrmtempfile = options[i] +- elif options[i] == '-pos': # positive class. +- i = i + 1 +- self.pos_file = options[i] +- elif options[i] == '-neg': # negative class. +- i = i + 1 +- self.neg_file = options[i] +- elif options[i] == '-range': # svm range file. +- i = i + 1 +- self.svmrangefile = options[i] +- elif options[i] == '-k': # range of k. +- i = i + 1 +- self.kmer = options[i] +- elif options[i] == '-model': # svm model file. +- i = i + 1 +- self.modelfile = options[i] +- elif options[i] == '-balance': +- self.is_posneg_balanced = 1 # NOTE: -b , need to balance; NO -b, not balance. +- elif options[i] == '-isrecompile': # re-compile source. +- i = i + 1 +- self.is_recompile = options[i] +- else: +- pass_through_options.append(options[i]) +- i = i + 1 +- +- self.pass_through_string = ' '.join(pass_through_options) +- +- +-if __name__ == '__main__': +- def exit_with_help(): +- print("""\ +-===================== +- USAGE AND EXAMPLES +-===================== +-Usage: +-python PLEK.py -fasta fasta_file -out output_file -thread number_of_threads +- -minlength min_length_of_sequence -isoutmsg 0_or_1 -isrmtempfile 0_or_1 +- +- -fasta The name of a fasta file, its sequences are to be predicted. +- +- -out The file name for the results of prediction. Predicted positive +- samples are labeled as "Coding", and negative as "Non-coding". +- +- -thread (Optional) The number of threads for running the PLEK program. +- The bigger this number is, the faster PLEK runs. Default value: 5. +- +- -minlength (Optional) The minimum length of sequences. The sequences whose +- lengths are more than minlength will be processed. Default +- value: 200. +- +- -isoutmsg (Optional) Output messages to stdout(screen) or not. "0" means +- that PLEK be run quietly. "1" means that PLEK outputs the details +- of processing. Default value: 0. +- +- -isrmtempfile (Optional) Remove temporary files or not. "0" means that PLEK +- retains temporary files. "1" means that PLEK remove temporary +- files. Default value: 1. +- +- +- +-Examples: +-1. $ python PLEK.py -fasta PLEK_test.fa -out predicted -thread 10 +- +- NOTE: To predict the sequences in the 'PLEK_test.fa' file, run the PLEK program with +- 10 threads. The program outputs the predicted sequences in the file 'predicted'. +- +- +-2. $ python PLEK.py -fasta PLEK_test.fa -out predicted -thread 10 -minlength 300 +- +- NOTE: To predict the sequences in the 'PLEK_test.fa' file, run the PLEK program with +- 10 threads. The program outputs the predicted sequences in the file 'predicted'. +- The sequences with the length of >300nt will be processed (remained). +- +- +-3. $ python PLEK.py -fasta PLEK_test.fa -out predicted -thread 10 -isrmtempfile 0 +- +- NOTE: To predict the sequences in the 'PLEK_test.fa' file, run the PLEK program with +- 10 threads. The program outputs the predicted sequences in the file 'predicted'. +- The details of PLEK run will output to the files with "predicted" as prefix. +- +- +-4. $ python PLEK.py -fasta PLEK_test.fa -out predicted -thread 10 -isoutmsg 1 +- +- NOTE: To predict the sequences in the 'PLEK_test.fa' file, run the PLEK program with +- 10 threads. The program outputs the predicted sequences in the file 'predicted'. +- The details of PLEK run will output to user's screen(stdio). +- +-===================== +- CONTACTS +-===================== +-Aimin Li: LiAiminMail@gmail.com +-Junying Zhang: jyzhang@mail.xidian.edu.cn +- +-====================== +- WEBSITE +-===================== +-https://sourceforge.net/projects/plek/ +- """) +- sys.exit(1) +- +- def file_id_by_lineid(totalcount,filecount,n): # for splitting input files. +- # totalcount, total line count +- #filecount, the number of files +- #n , current row id +- countperfile=totalcount/filecount +- for i in range(1,filecount): +- if n>(i-1)*countperfile and n<=i*countperfile: +- return i +- return filecount +- +- def compile_c(_options): # re-compile source +- print('[{0}] Compiling svm, svm-train, svm-predict, svm-scale'.format(time.strftime('%Y-%m-%d %H:%M:%S'))) +- os.system("g++ -c " + _options.script_dir + "svm.cpp -o " + _options.script_dir + "svm.o") +- os.system("LNAG=C gcc -g -Wall " + _options.script_dir + "svm-train.c " + _options.script_dir + "svm.o -o " + _options.script_dir + "svm-train -lstdc++ -lm") +- os.system("LNAG=C gcc -g -Wall " + _options.script_dir + "svm-predict.c " + _options.script_dir + "svm.o -o " + _options.script_dir + "svm-predict -lstdc++ -lm") +- os.system("LNAG=C gcc -g -Wall " + _options.script_dir + "svm-scale.c " + _options.script_dir + "svm.o -o " + _options.script_dir + "svm-scale -lstdc++ -lm") +- +- print('[{0}] Compiling PLEK_main, PLEK_spsn'.format(time.strftime('%Y-%m-%d %H:%M:%S'))) +- os.system("LNAG=C gcc -g -Wall " + _options.script_dir + "PLEK_main.c -o " + _options.script_dir + "PLEK -lm") +- os.system("LNAG=C gcc -g -Wall " + _options.script_dir + "PLEK_spsn.c -o " + _options.script_dir + "PLEK_spsn -lm ") +- +- +- if len(sys.argv) < 2: +- exit_with_help() +- options = sys.argv +- try: +- print('[{0}] Beginning PLEK run (Version 1.2) '.format(time.strftime('%Y-%m-%d %H:%M:%S'))) +- # get input options +- _options = GridOption(options); +- cmdline=None; +- +- # recompile source +- if _options.is_recompile or (not os.path.isfile(_options.script_dir + 'PLEK')): +- compile_c(_options) +- +- # check if the model file exists +- if not os.path.isfile( _options.modelfile): +- print('Building model') +- os.system("cat " + _options.script_dir + "PLEK.model0 " + _options.script_dir + "PLEK.model1 " + _options.script_dir + "PLEK.model2 > " + _options.modelfile ) +- if not os.path.isfile( _options.modelfile): +- print("ERROR: No such file '" + _options.modelfile + "'") +- sys.exit(1) +- +- svm_file=str(_options.prefix)+"_allsvm"; +- print('[{0}] PLEK is running'.format(time.strftime('%Y-%m-%d %H:%M:%S'))) +- +- # calculate k-mer usage frequencies +- print('[{0}] Calculating k-mer usage'.format(time.strftime('%Y-%m-%d %H:%M:%S'))) +- if _options.pos_file!="" and _options.neg_file!="" and _options.is_posneg_balanced==1: # for modeling +- _options.input_type=1 +- if not os.path.isfile(_options.pos_file): +- print("ERROR: No such file '" + _options.pos_file + "'") +- sys.exit(1) +- if not os.path.isfile(_options.neg_file): +- print("ERROR: No such file '" + _options.neg_file + "'") +- sys.exit(1) +- cmdline = (_options.script_dir + 'PLEK -s 1 -d 5 -p {0} -n {1} -o {2} -k {3} -l {4} -b -isoutmsg {5} -isrmtempfile {6}').format\ +- (_options.pos_file, _options.neg_file, _options.prefix, _options.kmer, _options.min_seq_length, _options.isoutmsg, _options.isrmtempfile) +- if _options.pos_file!="" and _options.neg_file!="" and _options.is_posneg_balanced==0: # for known Pos & Neg +- _options.input_type=2 +- if not os.path.isfile(_options.pos_file): +- print("ERROR: No such file '" + _options.pos_file + "'") +- sys.exit(1) +- if not os.path.isfile(_options.neg_file): +- print("ERROR: No such file '" + _options.neg_file + "'") +- sys.exit(1) +- cmdline = (_options.script_dir + 'PLEK -s 1 -d 5 -p {0} -n {1} -o {2} -k {3} -l {4} -b -isoutmsg {5} -isrmtempfile {6}').format\ +- (_options.pos_file, _options.neg_file, _options.prefix, _options.kmer, _options.min_seq_length, _options.isoutmsg, _options.isrmtempfile) +- if _options.pos_file!="" and _options.neg_file=="" : # for known Pos; for unkown Neg +- _options.input_type=3 +- if _options.unkown==1: +- _options.input_type=4 +- if not os.path.isfile(_options.pos_file): +- print("ERROR: No such file '" + _options.pos_file + "'") +- sys.exit(1) +- cmdline = (_options.script_dir + 'PLEK -s 1 -d 5 -p {0} -o {1} -k {2} -l {3} -isoutmsg {4} -isrmtempfile {5}').format\ +- (_options.pos_file, _options.prefix, _options.kmer, _options.min_seq_length, _options.isoutmsg, _options.isrmtempfile) +- if _options.pos_file=="" and _options.neg_file!="" : # for known Neg +- _options.input_type=5 +- if not os.path.isfile(_options.neg_file): +- print("ERROR: No such file '" + _options.neg_file + "'") +- sys.exit(1) +- cmdline = (_options.script_dir + 'PLEK -s 1 -d 5 -n {0} -o {1} -k {2} -l {3} -isoutmsg {4} -isrmtempfile {5}').format\ +- (_options.neg_file, _options.prefix, _options.kmer, _options.min_seq_length, _options.isoutmsg, _options.isrmtempfile) +- +- os.system(cmdline) +- +- # split file (input, file of k-mer usage frequencies ) +- +- #total number of rows +- count = -1 +- for count, line in enumerate(open(svm_file, 'rU')): +- pass +- count += 1 +- # +- file_count=int(_options.thread_count) +- #print(' Number of sequence: {0}'.format(count)) +- +- file_array=[] +- for fn in range(1,file_count+1): +- fp=open(_options.prefix+'_temp_'+str(fn),'w') +- file_array.append(fp) +- # +- if not os.path.isfile(svm_file): +- print("ERROR: No such file '" + svm_file + "'") +- sys.exit(1) +- fv=open(svm_file,'r') +- n=1 +- for line in fv: +- file_id=file_id_by_lineid(count,file_count,n) +- file_p=file_array[file_id-1] +- file_p.write(line) +- n+=1 +- +- for fn in range(1,file_count+1): +- file_p=file_array[fn-1] +- file_p.close() +- fv.close() +- +- # svm-scale +- print('[{0}] Scaling data'.format(time.strftime('%Y-%m-%d %H:%M:%S'))) +- scale_array=[] +- for fn in range(1,file_count+1): +- scale_obj=SVMScaleThread(_options.svmrangefile, _options.prefix+'_temp_'+str(fn), _options.prefix+'_temp_'+str(fn)+'_scaled', _options.script_dir) +- scale_array.append(scale_obj); +- scale_obj.start() +- +- # svm-predict +- for fn in range(1,file_count+1): +- scale_obj=scale_array[fn-1] +- scale_obj.join() +- +- # remove temporary files +- if _options.isrmtempfile==1: +- for fn in range(1,file_count+1): +- os.remove(_options.prefix+'_temp_'+str(fn)) +- +- print('[{0}] Predicting'.format(time.strftime('%Y-%m-%d %H:%M:%S'))) +- predict_array=[] +- for fn in range(1,file_count+1): +- predict_obj=SVMPredictThread(_options.prefix+'_temp_'+str(fn)+'_scaled', _options.modelfile, _options.prefix+'_temp_'+str(fn)+'_predicted', _options.script_dir) +- predict_array.append(predict_obj); +- predict_obj.start() +- +- # merge: predicted file +- for fn in range(1,file_count+1): +- predict_obj=predict_array[fn-1] +- predict_obj.join() +- +- # remove temporary files +- if _options.isrmtempfile==1: +- for fn in range(1,file_count+1): +- os.remove(_options.prefix+'_temp_'+str(fn)+'_scaled') +- +- f_final=open(_options.prefix+"_predicted",'w') +- +- for fn in range(1,file_count+1): +- f_predicted=open(_options.prefix+'_temp_'+str(fn)+'_predicted') +- for line in f_predicted: +- f_final.write(line) +- f_predicted.close() +- f_final.flush() +- +- f_final.close() +- +- # compare svm_file & predicted file +- if _options.input_type==2 or _options.input_type==3 or _options.input_type==5 or _options.input_type==4: +- cmdline=(_options.script_dir + 'PLEK_spsn -svm {0} -predict {1} -desc {2} -descclass {3} -output {4} -input_type {5} -isoutmsg {6} -isrmtempfile {7}').format\ +- (svm_file, _options.prefix+"_predicted", _options.prefix+"_allsvmdesc", _options.prefix+"_result", _options.prefix+"_logs", _options.input_type, _options.isoutmsg, _options.isrmtempfile) +- os.system(cmdline); +- +- if _options.isrmtempfile==1: +- os.remove(_options.prefix+"_logs") +- os.rename(_options.prefix+"_result", _options.prefix) +- +- # remove temporary files +- if _options.isrmtempfile==1: +- for fn in range(1,file_count+1): +- os.remove(_options.prefix+'_temp_'+str(fn)+'_predicted') +- +- print('[{0}] Run complete'.format(time.strftime('%Y-%m-%d %H:%M:%S'))) +- print(' Result file: {0}'.format(_options.prefix)) +- +- # statistics +- Total_count=0 +- Noncoding_count=0 +- for line in open(_options.prefix, 'r'): +- Total_count=Total_count+1 +- #if line.find("Non-coding")>=0: +- if re.compile(r'^Non-coding').match(line): +- Noncoding_count=Noncoding_count+1 +- print(' Coding: {0}/{1}={2}%, Non-coding: {3}/{4}={5}%'.format( +- Total_count-Noncoding_count, Total_count, 1.0*(Total_count-Noncoding_count)/Total_count*100, +- Noncoding_count, Total_count, 1.0*(Noncoding_count)/Total_count*100)) +- +- +- sys.exit(1) +- +- except (IOError,ValueError) as e: +- sys.stderr.write(str(e) + '\n') +- sys.stderr.write('Try "python {0}" for more information.\n'.format(sys.arg[0])) +- sys.exit(1) ++#!/usr/bin/env python ++####################################################### ++# ++# PLEK - predictor of lncRNAs and mRNAs based on k-mer scheme ++# Authors: Aimin Li, JunYing Zhang ++# Contacts: LiAiminMail@gmail.com, jyzhang@mail.xidian.edu.cn ++# Webcite: https://sourceforge.net/projects/plek/ ++# Version: 1.2 ++# Updated on: June 19, 2014 ++# ++####################################################### ++ ++#usage: python PLEK.py -fasta fasta_file -out prefix_of_output_file -thread number_of_threads ++ ++#example: python PLEK.py -fasta PLEK_test.fa -out myfile -thread 10 ++#output: myfile ++ ++__all__ = [''] ++import os, sys, traceback, getpass, time, re ++from threading import Thread ++from subprocess import * ++ ++class SVMScaleThread(Thread): # class for svm-scale ++ def __init__(self, range_file, svm_origin, svm_scaled, script_dir): ++ Thread.__init__(self) ++ self.range_file = range_file ++ self.svm_origin = svm_origin ++ self.svm_scaled = svm_scaled ++ self.script_dir = script_dir ++ ++ def run(self): ++ cmdline= (self.script_dir +'svm-scale -r {0} {1} > {2} ').format\ ++ (self.range_file, self.svm_origin, self.svm_scaled) ++ os.system(cmdline) ++ ++class SVMPredictThread(Thread): # class for svm-predict ++ def __init__(self, svm_scaled, svm_model, predicted, script_dir): ++ Thread.__init__(self) ++ self.svm_scaled = svm_scaled ++ self.svm_model = svm_model ++ self.predicted = predicted ++ self.script_dir = script_dir ++ ++ def run(self): ++ cmdline= (self.script_dir + 'svm-predict {0} {1} {2} ').format\ ++ (self.svm_scaled,self.svm_model,self.predicted) ++ os.system(cmdline) ++ ++ ++class GridOption: # set or get input parameters ++ def __init__(self, options): ++ dirname = os.path.dirname(__file__) ++ self.svmtrain_pathname = os.path.join(dirname, './svm-train') ++ self.svmpredict_pathname = os.path.join(dirname, './svm-predict') ++ self.svmscale_pathname = os.path.join(dirname, './svm-scale') ++ self.pos_file = "" ++ self.neg_file = "" ++ self.prefix = "plek_output_" ++ self.svmrangefile = "PLEK.range" ++ self.is_posneg_balanced = 0 ++ self.thread_count = 5 ++ self.modelfile="PLEK.model" ++ self.kmer=5 ++ self.min_seq_length=200 ++ self.unkown=0 ++ self.is_recompile=0 ++ self.input_type=1 ++ self.isoutmsg=0 ++ self.isrmtempfile=1 ++ self.script_dir="./" ++ self.parse_options(options) ++ ++ def parse_options(self, options): ++ args=options # save options to args ++ if type(options) == str: ++ options = options.split() ++ i = 0 ++ pass_through_options = [] ++ # get python script file's name, args[0] ++ # determine it is with dir or only file_name ++ script_name=args[0] ++ #print strHello ++ if script_name.rfind('/')>=0: ++ self.script_dir=script_name[:script_name.rfind('/')+1] ++ ++ self.svmtrain_pathname = self.script_dir + 'svm-train' ++ self.svmpredict_pathname = self.script_dir + 'svm-predict' ++ self.svmscale_pathname = self.script_dir + 'svm-scale' ++ self.svmrangefile = self.script_dir +"PLEK.range" ++ self.modelfile = self.script_dir +"PLEK.model" ++ ++ while i < len(options): ++ if options[i] == '-fasta': # The name of a fasta file, its sequences are to be predicted. ++ i = i + 1 ++ self.pos_file = options[i] ++ self.unkown=1 ++ elif options[i] == '-thread': # The number of threads for running the PLEK program. The bigger this number is, the faster PLEK runs. ++ i = i + 1 ++ self.thread_count = options[i] ++ elif options[i] == '-out': # The file name for the results of prediction. Predicted positive samples are labeled as "Coding", and negative as "Non-coding". ++ i = i + 1 ++ self.prefix = options[i] ++ elif options[i] == '-minlength': # The minimum length of sequences. The sequences whose lengths are more than minlength will be processed. ++ i = i + 1 ++ self.min_seq_length = options[i] ++ elif options[i] == '-isoutmsg': # Output messages to stdout(screen) or not. "0" means that PLEK be run quietly. "1" means that PLEK outputs the details of processing. ++ i = i + 1 ++ self.isoutmsg = options[i] ++ elif options[i] == '-isrmtempfile': # Remove temporary files or not. "0" means that PLEK retains temporary files. "1" means that PLEK remove temporary files. ++ i = i + 1 ++ self.isrmtempfile = options[i] ++ elif options[i] == '-pos': # positive class. ++ i = i + 1 ++ self.pos_file = options[i] ++ elif options[i] == '-neg': # negative class. ++ i = i + 1 ++ self.neg_file = options[i] ++ elif options[i] == '-range': # svm range file. ++ i = i + 1 ++ self.svmrangefile = options[i] ++ elif options[i] == '-k': # range of k. ++ i = i + 1 ++ self.kmer = options[i] ++ elif options[i] == '-model': # svm model file. ++ i = i + 1 ++ self.modelfile = options[i] ++ elif options[i] == '-balance': ++ self.is_posneg_balanced = 1 # NOTE: -b , need to balance; NO -b, not balance. ++ elif options[i] == '-isrecompile': # re-compile source. ++ i = i + 1 ++ self.is_recompile = options[i] ++ else: ++ pass_through_options.append(options[i]) ++ i = i + 1 ++ ++ self.pass_through_string = ' '.join(pass_through_options) ++ ++ ++if __name__ == '__main__': ++ def exit_with_help(): ++ print("""\ ++===================== ++ USAGE AND EXAMPLES ++===================== ++Usage: ++python PLEK.py -fasta fasta_file -out output_file -thread number_of_threads ++ -minlength min_length_of_sequence -isoutmsg 0_or_1 -isrmtempfile 0_or_1 ++ ++ -fasta The name of a fasta file, its sequences are to be predicted. ++ ++ -out The file name for the results of prediction. Predicted positive ++ samples are labeled as "Coding", and negative as "Non-coding". ++ ++ -thread (Optional) The number of threads for running the PLEK program. ++ The bigger this number is, the faster PLEK runs. Default value: 5. ++ ++ -minlength (Optional) The minimum length of sequences. The sequences whose ++ lengths are more than minlength will be processed. Default ++ value: 200. ++ ++ -isoutmsg (Optional) Output messages to stdout(screen) or not. "0" means ++ that PLEK be run quietly. "1" means that PLEK outputs the details ++ of processing. Default value: 0. ++ ++ -isrmtempfile (Optional) Remove temporary files or not. "0" means that PLEK ++ retains temporary files. "1" means that PLEK remove temporary ++ files. Default value: 1. ++ ++ ++ ++Examples: ++1. $ python PLEK.py -fasta PLEK_test.fa -out predicted -thread 10 ++ ++ NOTE: To predict the sequences in the 'PLEK_test.fa' file, run the PLEK program with ++ 10 threads. The program outputs the predicted sequences in the file 'predicted'. ++ ++ ++2. $ python PLEK.py -fasta PLEK_test.fa -out predicted -thread 10 -minlength 300 ++ ++ NOTE: To predict the sequences in the 'PLEK_test.fa' file, run the PLEK program with ++ 10 threads. The program outputs the predicted sequences in the file 'predicted'. ++ The sequences with the length of >300nt will be processed (remained). ++ ++ ++3. $ python PLEK.py -fasta PLEK_test.fa -out predicted -thread 10 -isrmtempfile 0 ++ ++ NOTE: To predict the sequences in the 'PLEK_test.fa' file, run the PLEK program with ++ 10 threads. The program outputs the predicted sequences in the file 'predicted'. ++ The details of PLEK run will output to the files with "predicted" as prefix. ++ ++ ++4. $ python PLEK.py -fasta PLEK_test.fa -out predicted -thread 10 -isoutmsg 1 ++ ++ NOTE: To predict the sequences in the 'PLEK_test.fa' file, run the PLEK program with ++ 10 threads. The program outputs the predicted sequences in the file 'predicted'. ++ The details of PLEK run will output to user's screen(stdio). ++ ++===================== ++ CONTACTS ++===================== ++Aimin Li: LiAiminMail@gmail.com ++Junying Zhang: jyzhang@mail.xidian.edu.cn ++ ++====================== ++ WEBSITE ++===================== ++https://sourceforge.net/projects/plek/ ++ """) ++ sys.exit(1) ++ ++ def file_id_by_lineid(totalcount,filecount,n): # for splitting input files. ++ # totalcount, total line count ++ #filecount, the number of files ++ #n , current row id ++ countperfile=totalcount/filecount ++ for i in range(1,filecount): ++ if n>(i-1)*countperfile and n<=i*countperfile: ++ return i ++ return filecount ++ ++ def compile_c(_options): # re-compile source ++ print('[{0}] Compiling svm, svm-train, svm-predict, svm-scale'.format(time.strftime('%Y-%m-%d %H:%M:%S'))) ++ os.system("g++ -c " + _options.script_dir + "svm.cpp -o " + _options.script_dir + "svm.o") ++ os.system("LNAG=C gcc -g -Wall " + _options.script_dir + "svm-train.c " + _options.script_dir + "svm.o -o " + _options.script_dir + "svm-train -lstdc++ -lm") ++ os.system("LNAG=C gcc -g -Wall " + _options.script_dir + "svm-predict.c " + _options.script_dir + "svm.o -o " + _options.script_dir + "svm-predict -lstdc++ -lm") ++ os.system("LNAG=C gcc -g -Wall " + _options.script_dir + "svm-scale.c " + _options.script_dir + "svm.o -o " + _options.script_dir + "svm-scale -lstdc++ -lm") ++ ++ print('[{0}] Compiling PLEK_main, PLEK_spsn'.format(time.strftime('%Y-%m-%d %H:%M:%S'))) ++ os.system("LNAG=C gcc -g -Wall " + _options.script_dir + "PLEK_main.c -o " + _options.script_dir + "PLEK -lm") ++ os.system("LNAG=C gcc -g -Wall " + _options.script_dir + "PLEK_spsn.c -o " + _options.script_dir + "PLEK_spsn -lm ") ++ ++ ++ if len(sys.argv) < 2: ++ exit_with_help() ++ options = sys.argv ++ try: ++ print('[{0}] Beginning PLEK run (Version 1.2) '.format(time.strftime('%Y-%m-%d %H:%M:%S'))) ++ # get input options ++ _options = GridOption(options); ++ cmdline=None; ++ ++ # recompile source ++ if _options.is_recompile or (not os.path.isfile(_options.script_dir + 'PLEK')): ++ compile_c(_options) ++ ++ # check if the model file exists ++ if not os.path.isfile( _options.modelfile): ++ print('Building model') ++ os.system("cat " + _options.script_dir + "PLEK.model0 " + _options.script_dir + "PLEK.model1 " + _options.script_dir + "PLEK.model2 > " + _options.modelfile ) ++ if not os.path.isfile( _options.modelfile): ++ print("ERROR: No such file '" + _options.modelfile + "'") ++ sys.exit(1) ++ ++ svm_file=str(_options.prefix)+"_allsvm"; ++ print('[{0}] PLEK is running'.format(time.strftime('%Y-%m-%d %H:%M:%S'))) ++ ++ # calculate k-mer usage frequencies ++ print('[{0}] Calculating k-mer usage'.format(time.strftime('%Y-%m-%d %H:%M:%S'))) ++ if _options.pos_file!="" and _options.neg_file!="" and _options.is_posneg_balanced==1: # for modeling ++ _options.input_type=1 ++ if not os.path.isfile(_options.pos_file): ++ print("ERROR: No such file '" + _options.pos_file + "'") ++ sys.exit(1) ++ if not os.path.isfile(_options.neg_file): ++ print("ERROR: No such file '" + _options.neg_file + "'") ++ sys.exit(1) ++ cmdline = (_options.script_dir + 'PLEK -s 1 -d 5 -p {0} -n {1} -o {2} -k {3} -l {4} -b -isoutmsg {5} -isrmtempfile {6}').format\ ++ (_options.pos_file, _options.neg_file, _options.prefix, _options.kmer, _options.min_seq_length, _options.isoutmsg, _options.isrmtempfile) ++ if _options.pos_file!="" and _options.neg_file!="" and _options.is_posneg_balanced==0: # for known Pos & Neg ++ _options.input_type=2 ++ if not os.path.isfile(_options.pos_file): ++ print("ERROR: No such file '" + _options.pos_file + "'") ++ sys.exit(1) ++ if not os.path.isfile(_options.neg_file): ++ print("ERROR: No such file '" + _options.neg_file + "'") ++ sys.exit(1) ++ cmdline = (_options.script_dir + 'PLEK -s 1 -d 5 -p {0} -n {1} -o {2} -k {3} -l {4} -b -isoutmsg {5} -isrmtempfile {6}').format\ ++ (_options.pos_file, _options.neg_file, _options.prefix, _options.kmer, _options.min_seq_length, _options.isoutmsg, _options.isrmtempfile) ++ if _options.pos_file!="" and _options.neg_file=="" : # for known Pos; for unkown Neg ++ _options.input_type=3 ++ if _options.unkown==1: ++ _options.input_type=4 ++ if not os.path.isfile(_options.pos_file): ++ print("ERROR: No such file '" + _options.pos_file + "'") ++ sys.exit(1) ++ cmdline = (_options.script_dir + 'PLEK -s 1 -d 5 -p {0} -o {1} -k {2} -l {3} -isoutmsg {4} -isrmtempfile {5}').format\ ++ (_options.pos_file, _options.prefix, _options.kmer, _options.min_seq_length, _options.isoutmsg, _options.isrmtempfile) ++ if _options.pos_file=="" and _options.neg_file!="" : # for known Neg ++ _options.input_type=5 ++ if not os.path.isfile(_options.neg_file): ++ print("ERROR: No such file '" + _options.neg_file + "'") ++ sys.exit(1) ++ cmdline = (_options.script_dir + 'PLEK -s 1 -d 5 -n {0} -o {1} -k {2} -l {3} -isoutmsg {4} -isrmtempfile {5}').format\ ++ (_options.neg_file, _options.prefix, _options.kmer, _options.min_seq_length, _options.isoutmsg, _options.isrmtempfile) ++ ++ os.system(cmdline) ++ ++ # split file (input, file of k-mer usage frequencies ) ++ ++ #total number of rows ++ count = -1 ++ for count, line in enumerate(open(svm_file, 'rU')): ++ pass ++ count += 1 ++ # ++ file_count=int(_options.thread_count) ++ #print(' Number of sequence: {0}'.format(count)) ++ ++ file_array=[] ++ for fn in range(1,file_count+1): ++ fp=open(_options.prefix+'_temp_'+str(fn),'w') ++ file_array.append(fp) ++ # ++ if not os.path.isfile(svm_file): ++ print("ERROR: No such file '" + svm_file + "'") ++ sys.exit(1) ++ fv=open(svm_file,'r') ++ n=1 ++ for line in fv: ++ file_id=file_id_by_lineid(count,file_count,n) ++ file_p=file_array[file_id-1] ++ file_p.write(line) ++ n+=1 ++ ++ for fn in range(1,file_count+1): ++ file_p=file_array[fn-1] ++ file_p.close() ++ fv.close() ++ ++ # svm-scale ++ print('[{0}] Scaling data'.format(time.strftime('%Y-%m-%d %H:%M:%S'))) ++ scale_array=[] ++ for fn in range(1,file_count+1): ++ scale_obj=SVMScaleThread(_options.svmrangefile, _options.prefix+'_temp_'+str(fn), _options.prefix+'_temp_'+str(fn)+'_scaled', _options.script_dir) ++ scale_array.append(scale_obj); ++ scale_obj.start() ++ ++ # svm-predict ++ for fn in range(1,file_count+1): ++ scale_obj=scale_array[fn-1] ++ scale_obj.join() ++ ++ # remove temporary files ++ if _options.isrmtempfile==1: ++ for fn in range(1,file_count+1): ++ os.remove(_options.prefix+'_temp_'+str(fn)) ++ ++ print('[{0}] Predicting'.format(time.strftime('%Y-%m-%d %H:%M:%S'))) ++ predict_array=[] ++ for fn in range(1,file_count+1): ++ predict_obj=SVMPredictThread(_options.prefix+'_temp_'+str(fn)+'_scaled', _options.modelfile, _options.prefix+'_temp_'+str(fn)+'_predicted', _options.script_dir) ++ predict_array.append(predict_obj); ++ predict_obj.start() ++ ++ # merge: predicted file ++ for fn in range(1,file_count+1): ++ predict_obj=predict_array[fn-1] ++ predict_obj.join() ++ ++ # remove temporary files ++ if _options.isrmtempfile==1: ++ for fn in range(1,file_count+1): ++ os.remove(_options.prefix+'_temp_'+str(fn)+'_scaled') ++ ++ f_final=open(_options.prefix+"_predicted",'w') ++ ++ for fn in range(1,file_count+1): ++ f_predicted=open(_options.prefix+'_temp_'+str(fn)+'_predicted') ++ for line in f_predicted: ++ f_final.write(line) ++ f_predicted.close() ++ f_final.flush() ++ ++ f_final.close() ++ ++ # compare svm_file & predicted file ++ if _options.input_type==2 or _options.input_type==3 or _options.input_type==5 or _options.input_type==4: ++ cmdline=(_options.script_dir + 'PLEK_spsn -svm {0} -predict {1} -desc {2} -descclass {3} -output {4} -input_type {5} -isoutmsg {6} -isrmtempfile {7}').format\ ++ (svm_file, _options.prefix+"_predicted", _options.prefix+"_allsvmdesc", _options.prefix+"_result", _options.prefix+"_logs", _options.input_type, _options.isoutmsg, _options.isrmtempfile) ++ os.system(cmdline); ++ ++ if _options.isrmtempfile==1: ++ os.remove(_options.prefix+"_logs") ++ os.rename(_options.prefix+"_result", _options.prefix) ++ ++ # remove temporary files ++ if _options.isrmtempfile==1: ++ for fn in range(1,file_count+1): ++ os.remove(_options.prefix+'_temp_'+str(fn)+'_predicted') ++ ++ print('[{0}] Run complete'.format(time.strftime('%Y-%m-%d %H:%M:%S'))) ++ print(' Result file: {0}'.format(_options.prefix)) ++ ++ # statistics ++ Total_count=0 ++ Noncoding_count=0 ++ for line in open(_options.prefix, 'r'): ++ Total_count=Total_count+1 ++ #if line.find("Non-coding")>=0: ++ if re.compile(r'^Non-coding').match(line): ++ Noncoding_count=Noncoding_count+1 ++ print(' Coding: {0}/{1}={2}%, Non-coding: {3}/{4}={5}%'.format( ++ Total_count-Noncoding_count, Total_count, 1.0*(Total_count-Noncoding_count)/Total_count*100, ++ Noncoding_count, Total_count, 1.0*(Noncoding_count)/Total_count*100)) ++ ++ ++ sys.exit(1) ++ ++ except (IOError,ValueError) as e: ++ sys.stderr.write(str(e) + '\n') ++ sys.stderr.write('Try "python {0}" for more information.\n'.format(sys.arg[0])) ++ sys.exit(1) +--- svm_grid_modelling.py 2014-06-26 09:18:10.000000000 -0500 ++++ svm_grid_modelling.py.new 2018-10-30 12:08:29.804884548 -0500 +@@ -1,4 +1,4 @@ +-#!/usr/bin/env python ++#!/usr/bin/env python + # updated on May 31, 2014 + # by Aimin Li + +--- svm_grid_modelling_singlet.py 2014-06-26 19:13:47.000000000 -0500 ++++ svm_grid_modelling_singlet.py.new 2018-10-30 12:14:29.997888454 -0500 +@@ -1,4 +1,4 @@ +-#!/usr/bin/env python ++#!/usr/bin/env python + # updated on June 26, 2014 + # Related to: PLEK_howto_generate_scripts.doc, PLEK_generate_scripts.R, + # Called by: PLEKModelling.py +@@ -133,8 +133,8 @@ + p_status = p.wait() + #print "\t\t", cmdline + if p_status!=0: # error +- print "\t\t", err +- print "Command output : ", output ++ print("\t\t", err) ++ print("Command output : ", output) + #print "Command output : ", output + #print "Command exit status/return code : ", p_status + +--- svm-subset.py 2014-06-21 02:18:47.000000000 -0500 ++++ svm-subset.py.new 2018-10-30 12:19:27.521891685 -0500 +@@ -90,6 +90,10 @@ + + def main(argv=sys.argv): + #dataset, subset_size, method, subset_file, rest_file = process_options(argv) ++ ++ if len(argv) < 3: ++ exit_with_help(argv) ++ + dataset=testsubset.txt + subset_size=2 + method=0 diff --git a/recipes/plek/meta.yaml b/recipes/plek/meta.yaml new file mode 100644 index 0000000000000..1c7976250fd63 --- /dev/null +++ b/recipes/plek/meta.yaml @@ -0,0 +1,50 @@ +{% set name = "PLEK" %} +{% set version = "1.2" %} +{% set sha256 = "6b6962376aeb3340916b58273cbd96d80aff57596cfafd25c665005cccd070bc" %} + +package: + name: "{{ name|lower }}" + version: "{{ version }}" + +source: + url: https://sourceforge.net/projects/plek/files/PLEK.1.2.tar.gz + sha256: {{ sha256 }} + patches: + - dos2unix.patch + +build: + number: 0 + +requirements: + build: + - {{ compiler('c') }} + - {{ compiler('cxx') }} + host: + - python + run: + - python + +test: + commands: + - PLEK | grep "PLEK" > /dev/null + - PLEK_spsn | grep "PLEK_spsn" > /dev/null + - svm-predict | grep "svm-predict" > /dev/null + - svm-scale | grep "svm-scale" > /dev/null + - svm-train | grep "svm-train" > /dev/null + - PLEK.py | grep "PLEK.py" > /dev/null + - PLEKModelling.py | grep "PLEKModelling.py" > /dev/null + - svm-easy.py | grep "svm-easy.py" > /dev/null + - svm_grid_modelling.py | grep "grid.py" > /dev/null + - svm_grid_modelling_singlet.py | grep "grid.py" > /dev/null + - svm-subset.py | grep "svm-subset.py" > /dev/null + +about: + home: https://sourceforge.net/projects/plek + license: GNU GPL v3 + license_family: GPL + license_file: '' + summary: Predictor of long non-coding RNAs and mRNAs based on k-mer scheme. + +extra: + identifiers: + - biotools:plek diff --git a/recipes/popdel/Makefile.patch b/recipes/popdel/Makefile.patch index db464ddb169bb..a69bce3dff8ef 100644 --- a/recipes/popdel/Makefile.patch +++ b/recipes/popdel/Makefile.patch @@ -1,51 +1,45 @@ -*** Makefile 2018-10-02 09:49:04.550508012 +0200 ---- MakefileConda 2018-10-02 10:42:21.608584390 +0200 -*************** -*** 1,10 **** -- # Use version 4.9 of g++ -- -- # Set dependencies, s.t. make detects changes in header files. -- %.o: %.cc %.h -- g++ -c $^ -- -- CXX=g++ - CC=$(CXX) - - # Set this to include SeqAn libraries, either system wide ---- 1,3 ---- -*************** -*** 14,21 **** - CXXFLAGS+=-I$(SEQAN_LIB) -DSEQAN_HAS_ZLIB=1 -std=c++14 -DSEQAN_DISABLE_VERSION_CHECK - LDLIBS=-lz -lpthread - -! DATE=on 2018-10-01 -! VERSION=1.0.1 - CXXFLAGS+=-DDATE=\""$(DATE)"\" -DVERSION=\""$(VERSION)"\" - - # Enable warnings ---- 7,14 ---- - CXXFLAGS+=-I$(SEQAN_LIB) -DSEQAN_HAS_ZLIB=1 -std=c++14 -DSEQAN_DISABLE_VERSION_CHECK - LDLIBS=-lz -lpthread - -! DATE=on 2018-10-01 16:57:32 -! VERSION=1.0.1-cb5783f - CXXFLAGS+=-DDATE=\""$(DATE)"\" -DVERSION=\""$(VERSION)"\" - - # Enable warnings -*************** -*** 30,43 **** - all: CXXFLAGS+=-O3 -DSEQAN_ENABLE_TESTING=0 -DSEQAN_ENABLE_DEBUG=0 - all: popdel - -- .PHONY: profiling -- profiling: CXXFLAGS+=-g -O3 -DSEQAN_ENABLE_TESTING=0 -DSEQAN_ENABLE_DEBUG=1 -- profiling: popdel -- -- .PHONY: debug -- debug: CXXFLAGS+=-g -O0 -DSEQAN_ENABLE_TESTING=0 -DSEQAN_ENABLE_DEBUG=1 -- debug: popdel -- - PREFIX = /usr/local - .PHONY: install - install: popdel ---- 23,28 ---- +--- Makefile 2018-10-18 15:23:37.903614000 +0200 ++++ MakefileConda 2018-10-18 15:53:03.215652075 +0200 +@@ -1,10 +1,3 @@ +-# Use version 4.9 of g++ +- +-# Set dependencies, s.t. make detects changes in header files. +-%.o: %.cc %.h +- g++ -c $^ +- +-CXX=g++ + CC=$(CXX) + + # Set this to include SeqAn libraries, either system wide +@@ -14,14 +7,13 @@ + CXXFLAGS+=-I$(SEQAN_LIB) -DSEQAN_HAS_ZLIB=1 -std=c++14 -DSEQAN_DISABLE_VERSION_CHECK + LDLIBS=-lz -lpthread + +-DATE=on $(shell git log --pretty=format:"%cd" --date=iso | cut -f 1,2 -d " " | head -n 1) +-VERSION=1.0.2-$(shell git log --pretty=format:"%h" --date=iso | head -n 1) ++DATE=on 2018-10-18 ++VERSION=1.0.2 + CXXFLAGS+=-DDATE=\""$(DATE)"\" -DVERSION=\""$(VERSION)"\" + + # Enable warnings + CXXFLAGS+=-W -Wall -Wno-long-long -pedantic -Wno-variadic-macros -Wno-unused-result + +- + HEADERS=parse_popdel.h insert_histogram_popdel.h workflow_popdel.h utils_popdel.h popdel_view_parameter_parsing.h + HEADERS+=popdel_profile/*.h + HEADERS+=popdel_call/*.h +@@ -30,14 +22,6 @@ + all: CXXFLAGS+=-O3 -DSEQAN_ENABLE_TESTING=0 -DSEQAN_ENABLE_DEBUG=0 + all: popdel + +-.PHONY: profiling +-profiling: CXXFLAGS+=-g -O3 -DSEQAN_ENABLE_TESTING=0 -DSEQAN_ENABLE_DEBUG=1 +-profiling: popdel +- +-.PHONY: debug +-debug: CXXFLAGS+=-g -O0 -DSEQAN_ENABLE_TESTING=0 -DSEQAN_ENABLE_DEBUG=1 +-debug: popdel +- + PREFIX = /usr/local + .PHONY: install + install: CXXFLAGS+=-O3 -DSEQAN_ENABLE_TESTING=0 -DSEQAN_ENABLE_DEBUG=0 diff --git a/recipes/popdel/meta.yaml b/recipes/popdel/meta.yaml index ccfef502905b0..906833101c19a 100644 --- a/recipes/popdel/meta.yaml +++ b/recipes/popdel/meta.yaml @@ -1,10 +1,10 @@ package: name: popdel - version: "1.0.1" + version: "1.0.2" source: - url: https://github.com/kehrlab/PopDel/archive/v1.0.1.tar.gz - sha256: 68851eb092396b1e3ca114f3cd15374430039efc2602b3d5e89b373a3a0ed360 + url: https://github.com/kehrlab/PopDel/archive/v1.0.2.tar.gz + sha256: 606d18e87dc0cd83265b1cc976a1a153637e948fff1af2f9929f043fac991e01 patches: - Makefile.patch diff --git a/recipes/prince/meta.yaml b/recipes/prince/meta.yaml new file mode 100644 index 0000000000000..73b7de066df9a --- /dev/null +++ b/recipes/prince/meta.yaml @@ -0,0 +1,38 @@ +{% set name = "PRINCE" %} +{% set version = "1.0" %} +{% set sha256 = "b5478d9c77f8a8beb31ab3d6ed1ffd1e00c756ac9685658b16b69f04178e4b7b" %} + +package: + name: {{ name|lower }} + version: {{ version }} + +source: + url: https://github.com/WGS-TB/PythonPRINCE/archive/v{{ version }}.tar.gz + sha256: {{ sha256 }} + +build: + number: 0 + noarch: python + script: "{{ PYTHON }} -m pip install . --no-deps --ignore-installed --no-cache-dir -vvv" + +requirements: + host: + - python + - pip + run: + - python + - biopython + - numpy + - scipy + +test: + imports: + - prince + commands: + - prince -h + +about: + home: https://github.com/WGS-TB/PythonPrince + summary: PRINCE estimates Variable Number Tandem Repeats (VNTR) copy number from raw next generation sequencing (NGS) data. + license: MIT + license_file: LICENSE diff --git a/recipes/prophex/meta.yaml b/recipes/prophex/meta.yaml index 7e7bf0300d0dd..2b0c9bc7f7a35 100644 --- a/recipes/prophex/meta.yaml +++ b/recipes/prophex/meta.yaml @@ -1,5 +1,5 @@ -{% set version = "0.1.0" %} -{% set sha256 = "d57393d9423ec5c0fa3d5547f8817f9d9a6e11305073cf998189fbe749115ca4" %} +{% set version = "0.1.1" %} +{% set sha256 = "d1919cefbe64f1d31ebcd57de00eaaa3acc46a4622c92f9c631301b47303f67a" %} package: name: prophex @@ -10,7 +10,7 @@ source: sha256: {{ sha256 }} build: - number: 4 + number: 0 requirements: build: diff --git a/recipes/purge_haplotigs/meta.yaml b/recipes/purge_haplotigs/meta.yaml index f69f3fe495759..ef28e03ac79ea 100644 --- a/recipes/purge_haplotigs/meta.yaml +++ b/recipes/purge_haplotigs/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "1.0.1" %} +{% set version = "1.0.3" %} package: name: purge_haplotigs @@ -6,7 +6,7 @@ package: source: url: https://bitbucket.org/mroachawri/purge_haplotigs/get/v{{ version }}.tar.gz - sha256: e646af4ddbe3e0d6c20e8e8b4159770146f5b15eba9058aedbbeefe18584f31c + sha256: cc9828138760989564be266493aeb8715a6602342ac779f9eaca3bc6699dbd7e build: number: 0 diff --git a/recipes/pydemult/meta.yaml b/recipes/pydemult/meta.yaml new file mode 100644 index 0000000000000..ba7362cdaf6fc --- /dev/null +++ b/recipes/pydemult/meta.yaml @@ -0,0 +1,47 @@ +{% set name = "pydemult" %} +{% set version = "0.4.1" %} + +package: + name: "{{ name|lower }}" + version: "{{ version }}" + +source: + url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz + sha256: 5a44dc6c819fd4394b282d6aeff4b571b61654486ce6e4b782d3cc0731c3a0e2 + +build: + number: 0 + skip: True # [py27] + entry_points: + - pydemult = pydemult.pydemult:demultiplex + script: "{{ PYTHON }} -m pip install . --no-deps --ignore-installed -vvv " + +requirements: + host: + - mputil + - pandas + - pip + - python + run: + - mputil + - pandas + - python + +test: + imports: + - pydemult + commands: + - pydemult --help + +about: + home: https://github.com/jenzopr/pydemult + license: MIT + license_family: MIT + license_file: LICENSE + summary: Streamed and parallel demultiplexing of fastq files in python + doc_url: https://github.com/jenzopr/pydemult + dev_url: https://github.com/jenzopr/pydemult + +extra: + recipe-maintainers: + - jenzopr diff --git a/recipes/pyfaidx/meta.yaml b/recipes/pyfaidx/meta.yaml index ccb30f73895b5..214d52e9c0f58 100644 --- a/recipes/pyfaidx/meta.yaml +++ b/recipes/pyfaidx/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "0.5.4.1" %} +{% set version = "0.5.5.2" %} package: name: pyfaidx @@ -6,7 +6,7 @@ package: source: url: https://pypi.io/packages/source/p/pyfaidx/pyfaidx-{{ version }}.tar.gz - sha256: 6c24a674320784b007b77f291acb2419acbe7b7a59234c2cee99b4f78d6cfc34 + sha256: 9ac22bdc7b9c5d995d32eb9dc278af9ba970481636ec75c0d687d38c26446caa build: number: 0 diff --git a/recipes/pyimzml/meta.yaml b/recipes/pyimzml/meta.yaml index 1d5e7b823788d..80b37090e6559 100644 --- a/recipes/pyimzml/meta.yaml +++ b/recipes/pyimzml/meta.yaml @@ -1,5 +1,5 @@ -{% set version = "1.2.3" %} -{% set sha256 = "13143d28dfc648ae3ac20a92766439567ff5a90fdfaf3b5730046bebd724d1bc" %} +{% set version = "1.2.4" %} +{% set sha256 = "848ded49d515eb7287bc0976b6d8a574fc1b8c6847310d9bb06dc79192b5774b" %} package: name: pyimzml diff --git a/recipes/pymzml/0.7.8/meta.yaml b/recipes/pymzml/0.7.8/meta.yaml new file mode 100644 index 0000000000000..0ddbf62db3d0b --- /dev/null +++ b/recipes/pymzml/0.7.8/meta.yaml @@ -0,0 +1,35 @@ +package: + name: pymzml + version: "0.7.8" + +source: + url: https://pypi.python.org/packages/80/29/d2decd2873a409b24ac6ac0fb72432f87cc46ed7f0e4790929ca63976011/pymzml-0.7.8.zip + md5: a2e2e68da8f35dc09ab820c450994eff + +build: + noarch: python + number: 1 + script: python -m pip install --no-deps --ignore-installed . + +requirements: + host: + - python + - pip + - plotly + run: + - python + - plotly + +test: + imports: + - pymzml + +about: + home: http://pymzml.github.com + license: GNU General Public License (GPL) + summary: 'high-throughput mzML parsing' + license_family: LGPL + +extra: + identifiers: + - biotools:pymzml diff --git a/recipes/pymzml/meta.yaml b/recipes/pymzml/meta.yaml index 0ddbf62db3d0b..26fee7fde6e41 100644 --- a/recipes/pymzml/meta.yaml +++ b/recipes/pymzml/meta.yaml @@ -1,21 +1,20 @@ package: name: pymzml - version: "0.7.8" + version: "2.0.5" source: - url: https://pypi.python.org/packages/80/29/d2decd2873a409b24ac6ac0fb72432f87cc46ed7f0e4790929ca63976011/pymzml-0.7.8.zip - md5: a2e2e68da8f35dc09ab820c450994eff + url: https://files.pythonhosted.org/packages/09/1f/c353d3fb7318e848fc7a827c370af7efedf807620f3951d257bd26f1ac90/pymzml-2.0.5.zip + sha256: 75ddd7d22cbe54f9aab5cbf537718e4b85639334d165a672ea841e6602d0dfd5 build: noarch: python - number: 1 + number: script: python -m pip install --no-deps --ignore-installed . requirements: host: - python - pip - - plotly run: - python - plotly diff --git a/recipes/pypairs/meta.yaml b/recipes/pypairs/meta.yaml new file mode 100644 index 0000000000000..adbfd48b53c36 --- /dev/null +++ b/recipes/pypairs/meta.yaml @@ -0,0 +1,36 @@ +{% set name = "pypairs" %} +{% set version = "2.0.5" %} + +package: + name: "{{ name|lower }}" + version: "{{ version }}" + +source: + url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz + sha256: 902eeb0714d1102776160acbd60dd5efb4cbbfbcf49123b3a001b8d572c7e19f + +build: + number: 0 + script: "{{ PYTHON }} -m pip install . --no-deps --ignore-installed -vvv " + noarch: python + +requirements: + host: + - pip + - python + run: + - colorama + - numba + - numpy + - pandas + - python + +test: + imports: + - pypairs + +about: + home: https://github.com/rfechtner/pypairs + license: MIT + license_family: MIT + summary: A Python-reimplementation of the Pairs algorithm described by A. Scialdone et al. (2015) diff --git a/recipes/pyqi/0.3.1/build.sh b/recipes/pyqi/0.3.1/build.sh deleted file mode 100644 index 4899c226c8dd0..0000000000000 --- a/recipes/pyqi/0.3.1/build.sh +++ /dev/null @@ -1,9 +0,0 @@ -#!/bin/bash - -$PYTHON setup.py install --single-version-externally-managed --record=record.txt - -# Add more build steps here, if they are necessary. - -# See -# http://docs.continuum.io/conda/build.html -# for a list of environment variables that are set during the build process. diff --git a/recipes/pyqi/0.3.1/meta.yaml b/recipes/pyqi/0.3.1/meta.yaml deleted file mode 100644 index e1d9651134559..0000000000000 --- a/recipes/pyqi/0.3.1/meta.yaml +++ /dev/null @@ -1,31 +0,0 @@ -package: - name: pyqi - version: "0.3.1" - -source: - url: https://pypi.python.org/packages/60/f0/a7392f5f5caf59a50ccaddbb35a458514953512b7dd6053567cb02849c6e/pyqi-0.3.1.tar.gz - md5: dfffadd5b19bd802bcf57c4161ef2b96 - -build: - number: 1 - skip: True #[not py27] - -requirements: - host: - - python - - setuptools - - run: - - python - - setuptools - -test: - # Python imports - imports: - - pyqi - -about: - home: http://bipy.github.io/pyqi - license: BSD License - summary: 'pyqi: expose your interface' - diff --git a/recipes/pyqi/0.3.2/build.sh b/recipes/pyqi/0.3.2/build.sh deleted file mode 100644 index 4d7fc032b8cbe..0000000000000 --- a/recipes/pyqi/0.3.2/build.sh +++ /dev/null @@ -1,9 +0,0 @@ -#!/bin/bash - -$PYTHON setup.py install - -# Add more build steps here, if they are necessary. - -# See -# http://docs.continuum.io/conda/build.html -# for a list of environment variables that are set during the build process. diff --git a/recipes/pyqi/0.3.2/meta.yaml b/recipes/pyqi/0.3.2/meta.yaml deleted file mode 100644 index 2cff2671ed49b..0000000000000 --- a/recipes/pyqi/0.3.2/meta.yaml +++ /dev/null @@ -1,31 +0,0 @@ -package: - name: pyqi - version: "0.3.2" - -source: - url: https://pypi.python.org/packages/source/p/pyqi/pyqi-0.3.2.tar.gz - md5: 9507c06eeb22a816d963c860ad8e92ae - -build: - number: 1 - skip: True [not py27] - -requirements: - host: - - python - - setuptools - - run: - - python - - setuptools - -test: - # Python imports - imports: - - pyqi - -about: - home: http://bipy.github.io/pyqi - license: BSD License - summary: 'pyqi: expose your interface' - diff --git a/recipes/python-chado/meta.yaml b/recipes/python-chado/meta.yaml index 8ad1c02b3c57f..f2a3ff46723b7 100644 --- a/recipes/python-chado/meta.yaml +++ b/recipes/python-chado/meta.yaml @@ -1,10 +1,10 @@ package: name: python-chado - version: "2.1.5" + version: "2.2.1" source: - url: https://files.pythonhosted.org/packages/7a/17/296926b1a497d5ddc6359d28ba5b6175a76b8df88f43ed4e07ec128cd54d/chado-2.1.5.tar.gz - sha256: cb3b0ab01a8cb6c0bc0e8c0a7b30d985a5b30e18559b7768573860f01b33d524 + url: https://files.pythonhosted.org/packages/56/d4/d2fc5dfa0ef39e01680033ca40c59934a409abe9320b8eb3f5830d42c86b/chado-2.2.1.tar.gz + sha256: b2f11fac0f950ddf6bfc1170a68c4c8a7dbb588d5046d42ae6191acc1f0bf547 build: noarch: python diff --git a/recipes/python-consensuscore/meta.yaml b/recipes/python-consensuscore/meta.yaml index 7aa661ca5604f..18476d75372b4 100644 --- a/recipes/python-consensuscore/meta.yaml +++ b/recipes/python-consensuscore/meta.yaml @@ -27,7 +27,7 @@ build: requirements: build: - {{ compiler('cxx') }} - - meson + - meson >=0.48.1 - ninja - pkg-config - swig diff --git a/recipes/python-edlib/meta.yaml b/recipes/python-edlib/meta.yaml index cd51e821c00c9..137017912b679 100644 --- a/recipes/python-edlib/meta.yaml +++ b/recipes/python-edlib/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "1.2.3" %} +{% set version = "1.2.3.post1" %} package: name: python-edlib @@ -6,10 +6,10 @@ package: source: url: https://pypi.io/packages/source/e/edlib/edlib-{{ version }}.tar.gz - sha256: 5f32e02653402f9f649c1e256c39f6fc7361d16fecb2aae6d425c40d4d936be9 + sha256: 622ea738c177ea1c5f131a137c37599daba55c8d75875d51e93a5a980b2ae5be build: - number: 1 + number: 0 requirements: build: diff --git a/recipes/python-hyphy-python/meta.yaml b/recipes/python-hyphy-python/meta.yaml index 6746dca527034..4a62612dbb7ec 100644 --- a/recipes/python-hyphy-python/meta.yaml +++ b/recipes/python-hyphy-python/meta.yaml @@ -1,8 +1,8 @@ -{% set version = "0.1.6" %} +{% set version = "0.1.9" %} {% set name = "hyphy-python" %} build: - number: 1 + number: 0 package: name: python-{{ name | lower }} @@ -10,7 +10,7 @@ package: source: url: https://github.com/veg/{{ name }}/archive/{{ version }}.tar.gz - sha256: 343a3227f9edb5e2580c7c46a9ab2f7684c480be1bf2f342ea0df2f4ae42582f + sha256: 0e29cc24f983d62b936610461a377e26f9ff0ce31823f41b1e18fe547f223a14 requirements: build: diff --git a/recipes/python-omero/meta.yaml b/recipes/python-omero/meta.yaml index 18f55f7a21b7f..dafe3bce2a776 100644 --- a/recipes/python-omero/meta.yaml +++ b/recipes/python-omero/meta.yaml @@ -1,5 +1,5 @@ -{% set OMERO_VERSION = "5.4.8" %} -{% set OMERO_BUILD = "99" %} +{% set OMERO_VERSION = "5.4.9" %} +{% set OMERO_BUILD = "101" %} package: name: python-omero @@ -7,10 +7,10 @@ package: source: url: http://downloads.openmicroscopy.org/omero/{{ OMERO_VERSION }}/artifacts/OMERO.py-{{ OMERO_VERSION }}-ice36-b{{ OMERO_BUILD }}.zip - sha1: 4f9d7c835ccbdeba0a4b6efe62065c4b7148df9b + sha1: a79c21a2c8ec71021ccd9d6045fcd47d77bfeb95 build: - number: 1 + number: 0 skip: True # [py3k] requirements: diff --git a/recipes/python-omero/setup.py b/recipes/python-omero/setup.py index acbea26a7333c..069585d5e6349 100644 --- a/recipes/python-omero/setup.py +++ b/recipes/python-omero/setup.py @@ -4,4 +4,4 @@ from os import listdir pyfiles = [f.replace('.py', '') for f in listdir('.') if f.endswith('.py')] -setup(name='OMERO Python', version='5.4.7', description='OME (Open Microscopy Environment) develops open-source software and data format standards for the storage and manipulation of biological light microscopy data.', url='https://www.openmicroscopy.org/', packages=find_packages(), py_modules=pyfiles) +setup(name='OMERO Python', version='5.4.9', description='OME (Open Microscopy Environment) develops open-source software and data format standards for the storage and manipulation of biological light microscopy data.', url='https://www.openmicroscopy.org/', packages=find_packages(), py_modules=pyfiles) diff --git a/recipes/pythonpy/meta.yaml b/recipes/pythonpy/meta.yaml index bb3a310ce5dfc..659a5687db4a9 100644 --- a/recipes/pythonpy/meta.yaml +++ b/recipes/pythonpy/meta.yaml @@ -1,14 +1,14 @@ package: name: pythonpy - version: '0.4.2' + version: '0.4.11' source: - url: https://pypi.python.org/packages/source/p/pythonpy/pythonpy-0.4.2.tar.gz - md5: 9e4de105c594ecc04127a0fee088edc0 + url: https://pypi.python.org/packages/source/p/pythonpy/pythonpy-0.4.11.tar.gz + sha256: 2a8eeace21bb6d1cff3822f612fc5c33cbaaad0933dce84955e594a0bf1ec81a build: noarch: python - number: 1 + number: 0 skip: False requirements: diff --git a/recipes/pyvolve/meta.yaml b/recipes/pyvolve/meta.yaml index c1d100b80178e..27cb9da2f3c5d 100644 --- a/recipes/pyvolve/meta.yaml +++ b/recipes/pyvolve/meta.yaml @@ -1,5 +1,5 @@ -{% set version = "0.8.9" %} -{% set sha256 = "9f42a06b381d0e468e2c08d9f8fa42d4a169899fd63dc11c369ea97a10cf1fef" %} +{% set version = "0.9.0" %} +{% set sha256 = "d907f55c3b68d3161ca4a689ef8f2929e8e8025e081df1610ee373909059dd32" %} package: name: pyvolve diff --git a/recipes/quasitools/meta.yaml b/recipes/quasitools/meta.yaml index 06e93933cfde0..c69a655004c91 100644 --- a/recipes/quasitools/meta.yaml +++ b/recipes/quasitools/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "0.4.2" %} +{% set version = "0.5.0" %} package: name: quasitools @@ -6,7 +6,7 @@ package: source: url: https://github.com/phac-nml/quasitools/archive/v{{ version }}.tar.gz - sha256: ab1554465f8b677226fa8884a4e8983faeb5d6655af739b7e46317d748dba288 + sha256: ac20cd5364aebac7fa6d5f53e9b390ce6465782ded8593413202b79788b7b29e build: number: 0 @@ -30,6 +30,7 @@ requirements: test: commands: + # click requires a unicode locale - quasitools --help about: diff --git a/recipes/quast/build.sh b/recipes/quast/build.sh index e6faae4837193..cdf0c4e6f6d53 100644 --- a/recipes/quast/build.sh +++ b/recipes/quast/build.sh @@ -11,12 +11,15 @@ QUAST_HOME=$PREFIX/opt/quast-$PKG_VERSION mkdir -p $BINARY_HOME mkdir -p $QUAST_HOME +rm -r $SRC_DIR/quast_libs/site_packages/joblib* +rm -r $SRC_DIR/quast_libs/site_packages/simplejson + python "setup.py" install cp -R $SRC_DIR/*quast*.py $QUAST_HOME/ cp -R $SRC_DIR/icarus.py $QUAST_HOME/ -lib_path=`python -c "from distutils.sysconfig import get_python_lib; print get_python_lib()"` +lib_path=`python -c "from distutils.sysconfig import get_python_lib; print(get_python_lib())"` ln -s $lib_path/quast_libs $QUAST_HOME/quast_libs diff --git a/recipes/quast/glimmer-issue_do-not-crash-if-nothing-found.patch b/recipes/quast/glimmer-issue_do-not-crash-if-nothing-found.patch deleted file mode 100644 index ca375d9bbdddf..0000000000000 --- a/recipes/quast/glimmer-issue_do-not-crash-if-nothing-found.patch +++ /dev/null @@ -1,36 +0,0 @@ -From 09f54c635f913135c4ede2ec5d03fb90b42ab042 Mon Sep 17 00:00:00 2001 -From: almiheenko -Date: Mon, 13 Aug 2018 12:25:32 +0300 -Subject: [PATCH] Glimmer: do not crush if glimmer failed - ---- - quast_libs/glimmer.py | 6 +++--- - 1 file changed, 3 insertions(+), 3 deletions(-) - -diff --git a/quast_libs/glimmer.py b/quast_libs/glimmer.py -index 867711f2..101e5962 100644 ---- a/quast_libs/glimmer.py -+++ b/quast_libs/glimmer.py -@@ -80,7 +80,7 @@ def glimmerHMM(tool_dir, fasta_fpath, out_fpath, gene_lengths, err_path, tmp_dir - contigs[ind] = seq - - if not gffs: -- return None, None, None, None -+ return None, None, None, None, None, None - - out_gff_fpath = out_fpath + '_genes.gff' + ('.gz' if not qconfig.no_gzip else '') - out_gff_path = merge_gffs(gffs, out_gff_fpath) -@@ -198,8 +198,8 @@ def do(contigs_fpaths, gene_lengths, out_dirpath): - report.add_field(reporting.Fields.PREDICTED_GENES, genes) - if unique is None and full_genes is None: - logger.error( -- 'Glimmer failed running Glimmer for %s. ' + ('Run with the --debug option' -- ' to see the command line.' if not qconfig.debug else '') % label) -+ 'Failed running Glimmer for %s. ' % label + ('Run with the --debug option' -+ ' to see the command line.' if not qconfig.debug else '')) - - if not qconfig.debug: - shutil.rmtree(tmp_dirpath) --- -2.17.1 - diff --git a/recipes/quast/meta.yaml b/recipes/quast/meta.yaml index a3bddb943787b..9b17e70d5da72 100644 --- a/recipes/quast/meta.yaml +++ b/recipes/quast/meta.yaml @@ -1,27 +1,25 @@ {% set name = "quast" %} -{% set version = "5.0.0" %} -{% set hash = "e95dc05cf8e824a4b23fa5c4da2b5297" %} +{% set version = "5.0.1" %} +{% set hash = "d273954e8a16002b86c807d0bcb2a65c" %} package: name: {{ name|lower }} version: {{ version }} build: - number: 1 - # skip Python 3 builds due to test failures in vendored libs - skip: True # [py3k] + number: 0 source: url: http://downloads.sourceforge.net/project/{{ name|lower }}/{{ name|lower }}-{{ version }}.tar.gz md5: {{ hash }} patches: - - genemark-issue_disable-and-exclude-from-package.patch - - glimmer-issue_do-not-crash-if-nothing-found.patch - - use-glimmer-from-path-and-skip-it-in-test.patch + - genemark-issue_disable-and-exclude-from-package.patch + - skip-glimmer-in-test.patch + - remove-explicit-dependencies-from-setup-py.patch requirements: build: - - {{ compiler('c') }} + - {{ compiler('c') }} host: - perl - python diff --git a/recipes/quast/quast-download-manta b/recipes/quast/quast-download-manta deleted file mode 100644 index a6aed6ea15604..0000000000000 --- a/recipes/quast/quast-download-manta +++ /dev/null @@ -1,10 +0,0 @@ -#!/usr/bin/env python - -from quast_libs import qconfig -from quast_libs.log import get_logger -from quast_libs.ra_utils.misc import download_manta - -logger = get_logger(qconfig.LOGGER_DEFAULT_NAME) -logger.set_up_console_handler() - -download_manta(logger) diff --git a/recipes/quast/remove-explicit-dependencies-from-setup-py.patch b/recipes/quast/remove-explicit-dependencies-from-setup-py.patch new file mode 100644 index 0000000000000..c0e87e6a5231b --- /dev/null +++ b/recipes/quast/remove-explicit-dependencies-from-setup-py.patch @@ -0,0 +1,15 @@ +diff --git a/setup.py b/setup.py +index 27443ca5..3cfbf4e9 100755 +--- a/setup.py ++++ b/setup.py +@@ -246,10 +246,6 @@ The tool accepts multiple assemblies, thus is suitable for comparison.''', + include_package_data=True, + zip_safe=False, + scripts=['quast.py', 'metaquast.py', 'icarus.py', 'quast-lg.py'], +- install_requires=[ +- 'joblib', +- 'simplejson', +- ], + classifiers=[ + 'Environment :: Console', + 'Environment :: Web Environment', diff --git a/recipes/quast/skip-glimmer-in-test.patch b/recipes/quast/skip-glimmer-in-test.patch new file mode 100644 index 0000000000000..c03eed127d4fd --- /dev/null +++ b/recipes/quast/skip-glimmer-in-test.patch @@ -0,0 +1,13 @@ +diff --git a/quast_libs/options_parser.py b/quast_libs/options_parser.py +index d3b8bcf6..54581db8 100644 +--- a/quast_libs/options_parser.py ++++ b/quast_libs/options_parser.py +@@ -772,7 +772,7 @@ def parse_options(logger, quast_args): + if not is_metaquast: + qconfig.features = test_features + qconfig.operons = test_operons +- qconfig.glimmer = True ++ qconfig.glimmer = False + if not qconfig.large_genome: # special case -- large mode imposes eukaryote gene finding (GeneMark-ES) and our test data is too small for it. + qconfig.gene_finding = True + if qconfig.test_sv: diff --git a/recipes/quast/use-glimmer-from-path-and-skip-it-in-test.patch b/recipes/quast/use-glimmer-from-path-and-skip-it-in-test.patch deleted file mode 100644 index 9acfcc3472648..0000000000000 --- a/recipes/quast/use-glimmer-from-path-and-skip-it-in-test.patch +++ /dev/null @@ -1,136 +0,0 @@ -diff --git a/quast_libs/glimmer.py b/quast_libs/glimmer.py -index 101e5962..e7d181fd 100644 ---- a/quast_libs/glimmer.py -+++ b/quast_libs/glimmer.py -@@ -19,7 +19,7 @@ from quast_libs.genemark import add_genes_to_fasta - from quast_libs.genes_parser import Gene - - from quast_libs.log import get_logger --from quast_libs.qutils import is_python2 -+from quast_libs.qutils import compile_tool, get_path_to_program, run_parallel - - logger = get_logger(qconfig.LOGGER_DEFAULT_NAME) - -@@ -50,18 +50,16 @@ def parse_gff(gff_path): - gff_file.close() - - --def glimmerHMM(tool_dir, fasta_fpath, out_fpath, gene_lengths, err_path, tmp_dir, index): -+def glimmerHMM(tool_dir, tool_exec_fpath, fasta_fpath, out_fpath, gene_lengths, err_path, tmp_dir, index): - def run(contig_path, tmp_path): - with open(err_path, 'a') as err_file: - return_code = qutils.call_subprocess( -- [tool_exec, contig_path, '-d', trained_dir, '-g', '-o', tmp_path], -+ [tool_exec_fpath, contig_path, '-d', trained_dir, '-g', '-o', tmp_path], - stdout=err_file, - stderr=err_file, - indent=' ' + qutils.index_to_str(index) + ' ') - return return_code - -- tool_exec = os.path.join(tool_dir, 'glimmerhmm') -- - # Note: why arabidopsis? for no particular reason, really. - trained_dir = os.path.join(tool_dir, 'trained', 'arabidopsis') - -@@ -110,7 +108,7 @@ def glimmerHMM(tool_dir, fasta_fpath, out_fpath, gene_lengths, err_path, tmp_dir - return out_gff_path, genes, len(unique), total, full_cnt, partial_cnt - - --def predict_genes(index, contigs_fpath, gene_lengths, out_dirpath, tool_dirpath, tmp_dirpath): -+def predict_genes(index, contigs_fpath, gene_lengths, out_dirpath, tool_dirpath, tool_exec_fpath, tmp_dirpath): - assembly_label = qutils.label_from_fpath(contigs_fpath) - corr_assembly_label = qutils.label_from_fpath_for_fname(contigs_fpath) - -@@ -122,7 +120,7 @@ def predict_genes(index, contigs_fpath, gene_lengths, out_dirpath, tool_dirpath, - #out_gff_path, out_fasta_path, unique, total, cnt = glimmerHMM(tool_dir, - # fasta_path, out_path, gene_lengths, err_path) - -- out_gff_path, genes, unique, total, full_genes, partial_genes = glimmerHMM(tool_dirpath, -+ out_gff_path, genes, unique, total, full_genes, partial_genes = glimmerHMM(tool_dirpath, tool_exec_fpath, - contigs_fpath, out_fpath, gene_lengths, err_fpath, tmp_dirpath, index) - - if out_gff_path: -@@ -135,26 +133,10 @@ def predict_genes(index, contigs_fpath, gene_lengths, out_dirpath, tool_dirpath, - def compile_glimmer(logger, only_clean=False): - tool_dirpath = os.path.join(qconfig.LIBS_LOCATION, 'glimmer') - tool_src_dirpath = os.path.join(tool_dirpath, 'src') -- tool_exec_fpath = os.path.join(tool_dirpath, 'glimmerhmm') -- -- if only_clean: -- if os.path.isfile(tool_exec_fpath): -- os.remove(tool_exec_fpath) -- return True -- -- if not os.path.isfile(tool_exec_fpath): -- logger.main_info("Compiling GlimmerHMM...") -- return_code = qutils.call_subprocess( -- ['make', '-C', tool_src_dirpath], -- stdout=open(os.path.join(tool_src_dirpath, 'make.log'), 'w'), -- stderr=open(os.path.join(tool_src_dirpath, 'make.err'), 'w'), -- indent=' ') -- if return_code != 0 or not os.path.isfile(tool_exec_fpath): -- logger.error("Failed to compile GlimmerHMM (" + tool_src_dirpath + -- ")!\nTry to compile it manually or do not use --gene-finding " -- "option with --eukaryote.\nUse --debug option to see the command lines.") -- return None -- return tool_exec_fpath -+ -+ if not get_path_to_program('glimmerhmm', tool_dirpath): -+ compile_tool('GlimmerHMM', tool_src_dirpath, ['../glimmerhmm'], logger=logger, only_clean=only_clean) -+ return get_path_to_program('glimmerhmm', tool_dirpath) - - - def do(contigs_fpaths, gene_lengths, out_dirpath): -@@ -173,30 +155,22 @@ def do(contigs_fpaths, gene_lengths, out_dirpath): - os.makedirs(tmp_dirpath) - - n_jobs = min(len(contigs_fpaths), qconfig.max_threads) -- if is_python2(): -- from joblib2 import Parallel, delayed -- else: -- from joblib3 import Parallel, delayed -- if qconfig.memory_efficient: -- results = Parallel(n_jobs=n_jobs)(delayed(predict_genes)( -- index, contigs_fpath, gene_lengths, out_dirpath, tool_dirpath, tmp_dirpath) -- for index, contigs_fpath in enumerate(contigs_fpaths)) -- else: -- results = [predict_genes(index, contigs_fpath, gene_lengths, out_dirpath, tool_dirpath, tmp_dirpath) -- for index, contigs_fpath in enumerate(contigs_fpaths)] -+ parallel_args = [(index, contigs_fpath, gene_lengths, out_dirpath, tool_dirpath, tool_exec_fpath, tmp_dirpath) -+ for index, contigs_fpath in enumerate(contigs_fpaths)] -+ genes_list, unique, full_genes, partial_genes = run_parallel(predict_genes, parallel_args, n_jobs) - - genes_by_labels = dict() - # saving results - for i, contigs_fpath in enumerate(contigs_fpaths): - report = reporting.get(contigs_fpath) - label = qutils.label_from_fpath(contigs_fpath) -- genes_by_labels[label], unique, full_genes, partial_genes = results[i] -- if unique is not None: -- report.add_field(reporting.Fields.PREDICTED_GENES_UNIQUE, unique) -- if full_genes is not None: -- genes = ['%s + %s part' % (full_cnt, partial_cnt) for full_cnt, partial_cnt in zip(full_genes, partial_genes)] -+ genes_by_labels[label] = genes_list[i] -+ if unique[i] is not None: -+ report.add_field(reporting.Fields.PREDICTED_GENES_UNIQUE, unique[i]) -+ if full_genes[i] is not None: -+ genes = ['%s + %s part' % (full_cnt, partial_cnt) for full_cnt, partial_cnt in zip(full_genes[i], partial_genes[i])] - report.add_field(reporting.Fields.PREDICTED_GENES, genes) -- if unique is None and full_genes is None: -+ if unique[i] is None and full_genes[i] is None: - logger.error( - 'Failed running Glimmer for %s. ' % label + ('Run with the --debug option' - ' to see the command line.' if not qconfig.debug else '')) -diff --git a/quast_libs/options_parser.py b/quast_libs/options_parser.py -index e6bb46ec..c56ceffb 100644 ---- a/quast_libs/options_parser.py -+++ b/quast_libs/options_parser.py -@@ -749,7 +749,7 @@ def parse_options(logger, quast_args): - if not is_metaquast: - qconfig.features = test_features - qconfig.operons = test_operons -- qconfig.glimmer = True -+ qconfig.glimmer = False - if not qconfig.large_genome: # special case -- large mode imposes eukaryote gene finding (GeneMark-ES) and our test data is too small for it. - qconfig.gene_finding = True - if qconfig.test_sv: diff --git a/recipes/quicktree/meta.yaml b/recipes/quicktree/meta.yaml index 8e72994f67da3..7a2f12b0623f2 100644 --- a/recipes/quicktree/meta.yaml +++ b/recipes/quicktree/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "2.2" %} +{% set version = "2.4" %} package: name: quicktree @@ -6,10 +6,10 @@ package: source: url: https://github.com/khowe/quicktree/archive/v{{ version }}.tar.gz - sha256: e44d9147a81888d6bfed5e538367ecd4e5d373ae882d5eb9649e5e33f54f1bd6 + sha256: 9d9743d2cfe93659fd4ec3c098f0fcfa38f4bfe61d6596e2568221101b90b812 build: - number: 1 + number: 0 requirements: build: diff --git a/recipes/r-biodb/meta.yaml b/recipes/r-biodb/meta.yaml index 7f1ae3ed1e893..a1715fa14623e 100644 --- a/recipes/r-biodb/meta.yaml +++ b/recipes/r-biodb/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "1.1.2" %} +{% set version = "1.2.0a" %} package: name: r-biodb @@ -6,10 +6,10 @@ package: source: url: 'https://github.com/pkrog/biodb/archive/v{{ version }}.tar.gz' - sha256: c02df7ab69a611f90044a46f7e33e2e423653b0d7fb8ec56ba97c806471f61e0 + sha256: 709b941fb1bb738400228aaab31876d255df32bb634139023f7984624880c318 build: - number: 1 + number: 0 rpaths: - lib/R/lib/ - lib/ @@ -17,7 +17,6 @@ build: requirements: build: - {{ compiler('cxx') }} - host: - r-base - r-codetools @@ -29,10 +28,8 @@ requirements: - r-bitops - r-rcurl - r-r.utils - run: - r-base - # - libgfortran # [osx] - r-rcpp - r-xml - r-stringr diff --git a/recipes/r-deconstructsigs/meta.yaml b/recipes/r-deconstructsigs/meta.yaml index 26c9e889222fe..bfb6545d58797 100644 --- a/recipes/r-deconstructsigs/meta.yaml +++ b/recipes/r-deconstructsigs/meta.yaml @@ -1,4 +1,4 @@ -{% set version = '1.8.0' %} +{% set version = '1.8.0.1' %} {% set posix = 'm2-' if win else '' %} {% set native = 'm2w64-' if win else '' %} @@ -8,16 +8,15 @@ package: version: {{ version|replace("-", "_") }} source: - url: - - {{ cran_mirror }}/src/contrib/deconstructSigs_{{ version }}.tar.gz - - {{ cran_mirror }}/src/contrib/Archive/deconstructSigs/deconstructSigs_{{ version }}.tar.gz - sha256: 2ab8f6c0fd674bd270035ba2112f1a79d63de1155ba9698c4169c92196059d04 + # Last release version is missing fixes for hg38, pull from GitHub + # https://github.com/raerose01/deconstructSigs/issues/27 + url: https://github.com/raerose01/deconstructSigs/archive/ca3c2f9.tar.gz + # - https://cran.r-project.org/src/contrib/deconstructSigs_{{ version }}.tar.gz + # - https://cran.r-project.org/src/contrib/Archive/deconstructSigs/deconstructSigs_{{ version }}.tar.gz + sha256: 0e31aed3e4428e0026b33e663deee71d9bba81db56a1306e0a81666aa4a0e39d build: - merge_build_host: True # [win] - - number: 2 - + number: 0 rpaths: - lib/R/lib/ - lib/ @@ -28,15 +27,14 @@ requirements: host: - r-base - - 'bioconductor-bsgenome >=1.48.0,<1.50.0' - - 'bioconductor-bsgenome.hsapiens.ucsc.hg19 >=1.4.0,<1.6.0' + - bioconductor-bsgenome + - bioconductor-bsgenome.hsapiens.ucsc.hg19 - bioconductor-genomeinfodb - r-reshape2 - run: - r-base - - 'bioconductor-bsgenome >=1.48.0,<1.50.0' - - 'bioconductor-bsgenome.hsapiens.ucsc.hg19 >=1.4.0,<1.6.0' + - bioconductor-bsgenome + - bioconductor-bsgenome.hsapiens.ucsc.hg19 - bioconductor-genomeinfodb - r-reshape2 diff --git a/recipes/r-fgwas/build.sh b/recipes/r-fgwas/build.sh new file mode 100644 index 0000000000000..a9133622102d9 --- /dev/null +++ b/recipes/r-fgwas/build.sh @@ -0,0 +1,4 @@ +#!/bin/bash + +export DISABLE_AUTOBREW=1 +R CMD INSTALL pkg diff --git a/recipes/r-fgwas/meta.yaml b/recipes/r-fgwas/meta.yaml new file mode 100644 index 0000000000000..68a3479334bb5 --- /dev/null +++ b/recipes/r-fgwas/meta.yaml @@ -0,0 +1,51 @@ +{% set name = "fGWAS" %} +{% set version = "0.3.6" %} +{% set sha256 = "736b715c89007dd25a2a3028715fdfdc827140b46f4fdc4643d6c23b0c6075f7" %} + +package: + name: r-{{ name|lower }} + version: {{ version }} + +source: + url: https://github.com/wzhy2000/{{ name }}/archive/v{{ version }}.tar.gz + sha256: {{ sha256 }} + +build: + number: 0 + # This is required to make R link correctly on Linux. + rpaths: + - lib/R/lib/ + - lib/ + +requirements: + host: + - r-base + - r-minpack.lm + - bioconductor-snpstats + - r-mvtnorm + - r-devtools + - parallel + run: + - r-base + - r-minpack.lm + - bioconductor-snpstats + - r-mvtnorm + - r-devtools + - parallel + +test: + commands: + - $R -e "library('fGWAS')" + +about: + home: https://github.com/wzhy2000/fGWAS + license: GNU GPL + summary: "GWAS tools for longitudinal genetic traits based on fGWAS statistical model." + license_family: LGPL + license_file: pkg/LICENSE + +extra: + identifiers: + - doi:10.1016/j.jgg.2018.06.006 + recipe-maintainers: + - npavlovikj diff --git a/recipes/r-ggbiplot/build.sh b/recipes/r-ggbiplot/build.sh new file mode 100644 index 0000000000000..e3921285a046d --- /dev/null +++ b/recipes/r-ggbiplot/build.sh @@ -0,0 +1,2 @@ +#!/bin/bash +R CMD INSTALL --build . diff --git a/recipes/r-ggbiplot/meta.yaml b/recipes/r-ggbiplot/meta.yaml new file mode 100644 index 0000000000000..f9e92b54741de --- /dev/null +++ b/recipes/r-ggbiplot/meta.yaml @@ -0,0 +1,37 @@ +package: + name: 'r-ggbiplot' + version: '0.55' +source: + url: + - 'https://github.com/likelet/ggbiplot/archive/v0.55.tar.gz' + sha256: f4be01b2ddbe05846efe67f7182905489de356af017b9e2a09f96625c2d648f2 +build: + number: 1 + rpaths: + - lib/R/lib/ + - lib/ +requirements: + build: + - {{ compiler('c') }} + host: + - r-base + - r-devtools + - r-ggplot2 + - r-plyr + - r-scales + - r-gridbase + run: + - r-base + - r-devtools + - r-ggplot2 + - r-plyr + - r-scales + - r-gridbase +test: + commands: + - '$R -e "library(ggbiplot)"' +about: + date: '2011-10-23' + summary: 'A biplot based on ggplot2' + home: 'http://github.com/vqv/ggbiplot' + license: 'GPL-2' diff --git a/recipes/r-gkmsvm/meta.yaml b/recipes/r-gkmsvm/meta.yaml index 2c6bf9963a30d..6ceccf3d2350e 100644 --- a/recipes/r-gkmsvm/meta.yaml +++ b/recipes/r-gkmsvm/meta.yaml @@ -9,16 +9,12 @@ package: source: url: - - {{ cran_mirror }}/src/contrib/gkmSVM_{{ version }}.tar.gz - - {{ cran_mirror }}/src/contrib/Archive/gkmSVM/gkmSVM_{{ version }}.tar.gz + - https://cran.r-project.org/src/contrib/gkmSVM_{{ version }}.tar.gz + - https://cran.r-project.org/src/contrib/Archive/gkmSVM/gkmSVM_{{ version }}.tar.gz sha256: e36b4a25f7dcb00cddf206bd22972bb61950eef27b3b5233f954b9edde9aaa11 build: - merge_build_host: True # [win] - number: 0 - skip: true # [win32] - rpaths: - lib/R/lib/ - lib/ diff --git a/recipes/r-gpca/build.sh b/recipes/r-gpca/build.sh new file mode 100644 index 0000000000000..aeaad348da1d2 --- /dev/null +++ b/recipes/r-gpca/build.sh @@ -0,0 +1,11 @@ +#!/bin/bash + +if [[ $target_platform =~ linux.* ]] || [[ $target_platform == win-32 ]] || [[ $target_platform == win-64 ]] || [[ $target_platform == osx-64 ]]; then + export DISABLE_AUTOBREW=1 + mv DESCRIPTION DESCRIPTION.old + grep -v '^Priority: ' DESCRIPTION.old > DESCRIPTION + $R CMD INSTALL --build . +else + mkdir -p $PREFIX/lib/R/library/gPCA + mv * $PREFIX/lib/R/library/gPCA +fi diff --git a/recipes/r-gpca/meta.yaml b/recipes/r-gpca/meta.yaml new file mode 100644 index 0000000000000..4f1052c026a31 --- /dev/null +++ b/recipes/r-gpca/meta.yaml @@ -0,0 +1,48 @@ +{% set version = '1.0' %} + +{% set posix = 'm2-' if win else '' %} +{% set native = 'm2w64-' if win else '' %} + +package: + name: r-gpca + version: {{ version|replace("-", "_") }} + +source: + url: + - {{ cran_mirror }}/src/contrib/gPCA_{{ version }}.tar.gz + - {{ cran_mirror }}/src/contrib/Archive/gPCA/gPCA_{{ version }}.tar.gz + sha256: 7ce6c5f90758f9c208bc192ee1a7a423cb1f3de456ad9534bfdff646440b8bfa + +build: + merge_build_host: True # [win] + + number: 0 + + rpaths: + - lib/R/lib/ + - lib/ + +requirements: + build: + - {{posix}}zip # [win] + + host: + - r-base + + run: + - r-base + +test: + commands: + + - $R -e "library('gPCA')" # [not win] + - "\"%R%\" -e \"library('gPCA')\"" # [win] + +about: + home: https://CRAN.R-project.org/package=gPCA + license: GPL (>= 2) + summary: This package implements guided principal components analysis for the detection of + batch effects in high-throughput data. + license_family: GPL3 + + diff --git a/recipes/r-nabor/build.sh b/recipes/r-nabor/build.sh new file mode 100644 index 0000000000000..32bc29aa16362 --- /dev/null +++ b/recipes/r-nabor/build.sh @@ -0,0 +1,6 @@ +#!/bin/bash + +mv DESCRIPTION DESCRIPTION.old +grep -v '^Priority: ' DESCRIPTION.old > DESCRIPTION + +$R CMD INSTALL --build . diff --git a/recipes/r-nabor/meta.yaml b/recipes/r-nabor/meta.yaml new file mode 100644 index 0000000000000..01871c21f2d91 --- /dev/null +++ b/recipes/r-nabor/meta.yaml @@ -0,0 +1,38 @@ +{% set version = '0.5.0' %} + +package: + name: r-nabor + version: {{ version|replace("-", "_") }} + +source: + url: + - https://cran.r-project.org/src/contrib/nabor_{{ version }}.tar.gz + sha256: 47938dcc987279281c13abfd667660bf1b3b76af116136a27eb066ee1a4b43da + +build: + number: 0 + rpaths: + - lib/R/lib/ + - lib/ + +requirements: + host: + - r-base + - r-rcpp + - r-rcppeigen + - r-bh + + run: + - r-base + - r-rcpp + - r-rcppeigen + - r-bh + +test: + commands: + - $R -e "library('nabor')" + +about: + home: https://CRAN.R-project.org/package=nabor + license: BSD + summary: An R wrapper for 'libnabo', an exact or approximate k nearest neighbour library which is optimised for low dimensional spaces (e.g. 3D) \ No newline at end of file diff --git a/recipes/r-pctgcdata/build.sh b/recipes/r-pctgcdata/build.sh new file mode 100644 index 0000000000000..83a121c6db85e --- /dev/null +++ b/recipes/r-pctgcdata/build.sh @@ -0,0 +1,11 @@ +#!/bin/bash + +if [[ $target_platform =~ linux.* ]] || [[ $target_platform == win-32 ]] || [[ $target_platform == win-64 ]] || [[ $target_platform == osx-64 ]]; then + export DISABLE_AUTOBREW=1 + mv DESCRIPTION DESCRIPTION.old + grep -v '^Priority: ' DESCRIPTION.old > DESCRIPTION + $R CMD INSTALL --build . +else + mkdir -p $PREFIX/lib/R/library/pctGCdata + mv * $PREFIX/lib/R/library/pctGCdata +fi diff --git a/recipes/r-pctgcdata/meta.yaml b/recipes/r-pctgcdata/meta.yaml new file mode 100644 index 0000000000000..c6cfbf766a2ca --- /dev/null +++ b/recipes/r-pctgcdata/meta.yaml @@ -0,0 +1,30 @@ +package: + name: r-pctgcdata + version: 0.2.0 + +source: + url: https://github.com/mskcc/pctGCdata/archive/v0.2.0.tar.gz + sha256: e217f8adfae848f0b12095f8d72cfb3044b7eb87e81849b6ff931b178b185fff + +build: + number: 0 + rpaths: + - lib/R/lib/ + - lib/ + +requirements: + host: + - r-base + run: + - r-base + +test: + commands: + - $R -e "library('pctGCdata')" + +about: + home: https://github.com/mskcc/pctGCdata + license: GPL (>= 2) + summary: Provides GC percentage of a 1 kilobase window at a genomic position for different + builds of human and mouse genomes. + license_family: GPL3 diff --git a/recipes/r-polysat/build.sh b/recipes/r-polysat/build.sh new file mode 100644 index 0000000000000..6864ae6daf614 --- /dev/null +++ b/recipes/r-polysat/build.sh @@ -0,0 +1,8 @@ +#!/bin/bash + +# R refuses to build packages that mark themselves as Priority: Recommended +mv DESCRIPTION DESCRIPTION.old +grep -v '^Priority: ' DESCRIPTION.old > DESCRIPTION + +$R CMD INSTALL --build . + diff --git a/recipes/r-polysat/meta.yaml b/recipes/r-polysat/meta.yaml new file mode 100644 index 0000000000000..a93ffa89b8373 --- /dev/null +++ b/recipes/r-polysat/meta.yaml @@ -0,0 +1,42 @@ +{% set version = '1.7-3' %} + +package: + name: r-polysat + version: {{ version|replace("-", "_") }} + +source: + url: https://cran.r-project.org/src/contrib/polysat_{{ version }}.tar.gz + sha256: df7ae3ecf034678870a778a53d732674165bf909bae15ea7fa0ddbbb6566bf94 + +build: + number: 0 + + # This is required to make R link correctly on Linux. + rpaths: + - lib/R/lib/ + - lib/ + +requirements: + build: + - {{ compiler('c') }} + + host: + - libgfortran-ng # work around bug in r-base with Rcpp + - r-base + - r-rcpp + + run: + - libgfortran-ng # work around bug in r-base with Rcpp + - r-base + - r-rcpp + +test: + commands: + - $R -e "library('polysat')" + +about: + home: https://cran.r-project.org/web/packages/polysat/index.html + license: GPL (>= 2) + summary: 'A collection of tools to handle microsatellite data of any ploidy (and samples of + mixed ploidy) where allele copy number is not known in partially heterozygous genotypes.' + diff --git a/recipes/r-poppr/build.sh b/recipes/r-poppr/build.sh new file mode 100644 index 0000000000000..6864ae6daf614 --- /dev/null +++ b/recipes/r-poppr/build.sh @@ -0,0 +1,8 @@ +#!/bin/bash + +# R refuses to build packages that mark themselves as Priority: Recommended +mv DESCRIPTION DESCRIPTION.old +grep -v '^Priority: ' DESCRIPTION.old > DESCRIPTION + +$R CMD INSTALL --build . + diff --git a/recipes/r-poppr/meta.yaml b/recipes/r-poppr/meta.yaml new file mode 100644 index 0000000000000..c2f57ddefcf01 --- /dev/null +++ b/recipes/r-poppr/meta.yaml @@ -0,0 +1,71 @@ +{% set version = '2.8.1' %} + +package: + name: r-poppr + version: {{ version|replace("-", "_") }} + +source: + url: https://github.com/grunwaldlab/poppr/archive/v.{{ version }}.tar.gz + sha256: 5f9db5a7e4e83f7a7b08df5b5439de94887c39e78f0004dd8d54deb3800f6343 + +build: + number: 0 + rpaths: + - lib/R/lib/ + - lib/ + +requirements: + + build: + - {{ compiler('c') }} + + host: + - r-base + - r-boot + - r-adegenet + - r-ade4 + - r-ape + - r-cowplot + - r-dplyr + - r-ggplot2 + - r-igraph + - r-knitr + - r-magrittr + - r-pegas + - r-phangorn + - r-polysat + - r-rlang + - r-rmarkdown + - r-shiny + - r-testthat + - r-vegan + + run: + - r-base + - r-boot + - r-adegenet + - r-ade4 + - r-ape + - r-cowplot + - r-dplyr + - r-ggplot2 + - r-igraph + - r-knitr + - r-magrittr + - r-pegas + - r-phangorn + - r-polysat + - r-rlang + - r-rmarkdown + - r-shiny + - r-testthat + - r-vegan + +test: + commands: + - $R -e "library('poppr')" + +about: + home: https://github.com/grunwaldlab/poppr + license: GPL (>= 2) + summary: An R package for genetic analysis of populations with mixed (clonal/sexual) reproduction diff --git a/recipes/r-sequenza/build.sh b/recipes/r-sequenza/build.sh new file mode 100644 index 0000000000000..f0425abeb802b --- /dev/null +++ b/recipes/r-sequenza/build.sh @@ -0,0 +1,11 @@ +#!/bin/bash + +if [[ $target_platform =~ linux.* ]] || [[ $target_platform == win-32 ]] || [[ $target_platform == win-64 ]] || [[ $target_platform == osx-64 ]]; then + export DISABLE_AUTOBREW=1 + mv DESCRIPTION DESCRIPTION.old + grep -v '^Priority: ' DESCRIPTION.old > DESCRIPTION + $R CMD INSTALL --build . +else + mkdir -p $PREFIX/lib/R/library/sequenza + mv * $PREFIX/lib/R/library/sequenza +fi diff --git a/recipes/r-sequenza/meta.yaml b/recipes/r-sequenza/meta.yaml new file mode 100644 index 0000000000000..bd6db484f6ad7 --- /dev/null +++ b/recipes/r-sequenza/meta.yaml @@ -0,0 +1,52 @@ +{% set version = '2.1.2' %} + +{% set posix = 'm2-' if win else '' %} +{% set native = 'm2w64-' if win else '' %} + +package: + name: r-sequenza + version: {{ version|replace("-", "_") }} + +source: + url: + - {{ cran_mirror }}/src/contrib/sequenza_{{ version }}.tar.gz + - {{ cran_mirror }}/src/contrib/Archive/sequenza/sequenza_{{ version }}.tar.gz + sha256: ae074c880dfa3b3e9d3ebead6bd8cbf493b1c1ebd96c5a23e621af8d4d926a38 + +build: + merge_build_host: True # [win] + number: 0 + + rpaths: + - lib/R/lib/ + - lib/ + +requirements: + host: + - bioconductor-copynumber + - r-base + - r-squash + + run: + - bioconductor-copynumber + - r-base + - r-squash + +test: + commands: + - $R -e "library('sequenza')" # [not win] + - "\"%R%\" -e \"library('sequenza')\"" # [win] + +about: + home: http://cbs.dtu.dk/biotools/sequenza/ + + license: GPL-3 + summary: Tools to analyze genomic sequencing data from paired normal-tumor samples, including + cellularity and ploidy estimation; mutation and copy number (allele-specific and + total copy number) detection, quantification and visualization. + license_family: GPL3 + license_file: {{ environ["PREFIX"] }}/lib/R/share/licenses/GPL-3 + +extra: + identifiers: + - doi:10.1093/annonc/mdu479 diff --git a/recipes/r-seurat-scripts/build.sh b/recipes/r-seurat-scripts/build.sh index 5a686f3d003bb..260e8703bc0e9 100644 --- a/recipes/r-seurat-scripts/build.sh +++ b/recipes/r-seurat-scripts/build.sh @@ -1,3 +1,4 @@ mkdir -p $PREFIX/bin cp *.R $PREFIX/bin cp *.sh $PREFIX/bin +cp *.bats $PREFIX/bin diff --git a/recipes/r-seurat-scripts/meta.yaml b/recipes/r-seurat-scripts/meta.yaml index d172b5ce6c797..dd5ffd3ed6546 100644 --- a/recipes/r-seurat-scripts/meta.yaml +++ b/recipes/r-seurat-scripts/meta.yaml @@ -1,4 +1,4 @@ -{% set version = '0.0.1' %} +{% set version = "0.0.2" %} package: name: r-seurat-scripts @@ -6,7 +6,7 @@ package: source: url: https://github.com/ebi-gene-expression-group/r-seurat-scripts/archive/v{{ version }}.tar.gz - sha256: 580770b74194b41656e39af542af01250326f41a311038249b84dede8a57f76c + sha256: 492cd8bab4a1af6d4bdcba43122e3e22eb502137281d6e307f49f43bfc27ded2 build: number: 0 @@ -14,9 +14,11 @@ build: noarch: generic requirements: + host: + - r-base 3.4.1 run: - - r-base - - r-seurat>=2.3.1 + - r-base 3.4.1 + - r-seurat 2.3.1 - r-optparse - r-workflowscriptscommon diff --git a/recipes/r-spieceasi/meta.yaml b/recipes/r-spieceasi/meta.yaml index 811106c5e9a6f..cab5af20a4828 100644 --- a/recipes/r-spieceasi/meta.yaml +++ b/recipes/r-spieceasi/meta.yaml @@ -1,15 +1,15 @@ -{% set version = '0.1.4' %} +{% set version = '1.0.2' %} package: name: r-spieceasi version: {{ version|replace("-", "_") }} source: - url: https://github.com/zdk123/SpiecEasi/archive/v0.1.4.tar.gz - sha256: 75c6dbc37616938f1263a0eacfcf97febfc8e9e2abb7e11a496131a791297422 + url: https://github.com/zdk123/SpiecEasi/archive/v1.0.2.tar.gz + sha256: ff8930a01a211ebcdf719336f26d385e92a7515db0cf6a07e50923b9e8dd8e37 build: - number: 1 + number: 0 rpaths: - lib/R/lib/ - lib/ diff --git a/recipes/racon/meta.yaml b/recipes/racon/meta.yaml index 0aeebe5a89b3c..581c881583c8b 100644 --- a/recipes/racon/meta.yaml +++ b/recipes/racon/meta.yaml @@ -6,11 +6,13 @@ package: version: {{ version }} build: - number: 4 + number: 5 source: url: https://github.com/isovic/racon/releases/download/{{ version }}/racon-v{{ version }}.tar.gz sha256: 7ce3b1ce6abdb6c6a63d50755b1fc55d5a4d2ab8f86a1df81890d4a7842d9b75 + patches: + - racon_wrapper.patch requirements: build: diff --git a/recipes/racon/racon_wrapper.patch b/recipes/racon/racon_wrapper.patch new file mode 100644 index 0000000000000..36a799eca23b8 --- /dev/null +++ b/recipes/racon/racon_wrapper.patch @@ -0,0 +1,13 @@ +--- CMakeLists.txt 2018-05-23 03:59:14.000000000 -0500 ++++ CMakeLists.txt.new 2018-10-19 15:29:39.782104577 -0500 +@@ -57,8 +57,8 @@ + endif(racon_build_tests) + + if (racon_build_wrapper) +- set(racon_path ${PROJECT_BINARY_DIR}/bin/racon) +- set(rampler_path ${PROJECT_BINARY_DIR}/vendor/rampler/bin/rampler) ++ set(racon_path $ENV{PREFIX}/bin/racon) ++ set(rampler_path $ENV{PREFIX}/bin/rampler) + configure_file(${PROJECT_SOURCE_DIR}/scripts/racon_wrapper.py + ${PROJECT_BINARY_DIR}/${CMAKE_FILES_DIRECTORY}/racon_wrapper) + file(COPY ${PROJECT_BINARY_DIR}/${CMAKE_FILES_DIRECTORY}/racon_wrapper diff --git a/recipes/rapid/meta.yaml b/recipes/rapid/meta.yaml index cb10ed8a80e26..b5c1342434210 100644 --- a/recipes/rapid/meta.yaml +++ b/recipes/rapid/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "0.4" %} +{% set version = "0.7" %} package: name: rapid @@ -6,9 +6,9 @@ package: source: url: https://github.com/SchulzLab/RAPID/archive/v{{ version }}.tar.gz - sha256: f7c862a1a6707042359ed92a26a1ba69b1eeb76600add1daccc3d41fe21ffdea + sha256: 922df6a7dbcd04d72121408e06a491c3946d7fc38a4c980789b311a565b1c59f build: - number: 1 + number: 0 requirements: build: @@ -17,7 +17,7 @@ requirements: - r-ggplot2 ==2.2.1 - r-rcolorbrewer >=1.1 - r-scales ==0.5.0 - - r-knitr ==1.16 + - r-knitr ==1.20 - r-rmarkdown >=1.3 - r-reshape2 >=1.4 - bioconductor-deseq2 >=1.18 @@ -32,7 +32,7 @@ requirements: - r-ggplot2 ==2.2.1 - r-rcolorbrewer >=1.1 - r-scales ==0.5.0 - - r-knitr ==1.16 + - r-knitr ==1.20 - r-rmarkdown >=1.3 - r-reshape2 >=1.4 - bioconductor-deseq2 >=1.18 diff --git a/recipes/raxml/meta.yaml b/recipes/raxml/meta.yaml index d11fac26b5319..ea603007a0d40 100644 --- a/recipes/raxml/meta.yaml +++ b/recipes/raxml/meta.yaml @@ -1,13 +1,13 @@ package: name: raxml - version: "8.2.10" + version: "8.2.12" build: - number: 1 + number: 0 source: - url: https://github.com/stamatak/standard-RAxML/archive/v8.2.10.tar.gz - md5: fdba3bc814b6676f3abdb4837629472c + url: https://github.com/stamatak/standard-RAxML/archive/v8.2.12.tar.gz + sha256: 338f81b52b54e16090e193daf36c1d4baa9b902705cfdc7f4497e3e09718533b requirements: build: diff --git a/recipes/rcorrector/meta.yaml b/recipes/rcorrector/meta.yaml index f89ef82213233..8c46ceca276fb 100644 --- a/recipes/rcorrector/meta.yaml +++ b/recipes/rcorrector/meta.yaml @@ -1,13 +1,13 @@ package: name: rcorrector - version: 1.0.3 + version: 1.0.3.1 source: - url: https://github.com/mourisl/Rcorrector/archive/v1.0.3.tar.gz - md5: e64ab705c5b46eba46bce404332db607 + url: https://github.com/mourisl/Rcorrector/archive/v1.0.3.1.tar.gz + sha256: 6e22cb650ee1a41a757646f1e76fca99172db120e2bc20030aa022f7eebd29f4 build: - number: 2 + number: 0 requirements: build: diff --git a/recipes/rebaler/meta.yaml b/recipes/rebaler/meta.yaml index 246c5195feadb..96816dc09e455 100644 --- a/recipes/rebaler/meta.yaml +++ b/recipes/rebaler/meta.yaml @@ -1,5 +1,5 @@ -{% set version = "0.1.1" %} -{% set sha256 = "9bc389102f5af0f3240fb6cf8876a06c0f48476193f9f96a9b4a589b404831f4" %} +{% set version = "0.1.2" %} +{% set sha256 = "68d84f3fa5b29eb5b5178fdd09b9f02cf2f86a4b96894a3c805c63bbc6249286" %} package: name: rebaler @@ -7,11 +7,10 @@ package: source: url: https://github.com/rrwick/Rebaler/archive/v{{ version }}.tar.gz - fn: rebaler_{{ version }}.tar.gz sha256: '{{ sha256 }}' build: - number: 2 + number: 0 skip: true # [py27] entry_points: - rebaler = rebaler.rebaler:main diff --git a/recipes/rgi/3.1.2/build.sh b/recipes/rgi/3.1.2/build.sh deleted file mode 100644 index d70aa15af118c..0000000000000 --- a/recipes/rgi/3.1.2/build.sh +++ /dev/null @@ -1,11 +0,0 @@ -#!/bin/bash - -if [ "$(uname)" == "Darwin" ]; then - echo "Platform: Mac" - -elif [ "$(expr substr $(uname -s) 1 5)" == "Linux" ]; then - echo "Platform: Linux" -fi - -# install setup -$PYTHON setup.py install \ No newline at end of file diff --git a/recipes/rgi/3.1.2/meta.yaml b/recipes/rgi/3.1.2/meta.yaml deleted file mode 100644 index a0bb75ba2a3dd..0000000000000 --- a/recipes/rgi/3.1.2/meta.yaml +++ /dev/null @@ -1,50 +0,0 @@ -{% set name = "rgi" %} -{% set version = "3.1.2" %} -{% set md5 = "272faf3ee1a3b7061f60f2c9c1c3eba7" %} -{% set commit = "8bd84b2ee5c11233992a2a8e0fb3084c76d4402c" %} - -package: - name: {{ name }} - version: {{ version }} - -source: - url: https://github.com/arpcard/rgi_conda_dev/archive/{{ commit }}.tar.gz - md5: {{ md5 }} - -build: - skip: True # [py3k] - number: 3 - -# We pin on gcc version to avoid gcc-5 dual ABI issues depending on boost. -requirements: - build: - - {{ compiler('c') }} - host: - - python - - biopython - - six >=1.7.0 - - zlib - run: - - python - - blast - - biopython - - six >=1.7.0 - - zlib - - prodigal - - diamond >=0.8.24.86 - -test: - commands: - - rgi -h - - rgi_jsontab -h - - rgi_clean -h - - rgi_load -h - - rgi_jsonformat -h - - rgi --software_version - - rgi --data_version - -about: - home: https://card.mcmaster.ca - license: https://card.mcmaster.ca/about - summary: 'This tool provides a preliminary annotation of your DNA sequence(s) based upon the data available in The Comprehensive Antibiotic Resistance Database (CARD). Hits to genes tagged with Antibiotic Resistance ontology terms will be highlighted. As CARD expands to include more pathogens, genomes, plasmids, and ontology terms this tool will grow increasingly powerful in providing first-pass detection of antibiotic resistance associated genes. See license at CARD website' - diff --git a/recipes/rgi/3.2.0/build.sh b/recipes/rgi/3.2.0/build.sh deleted file mode 100644 index d70aa15af118c..0000000000000 --- a/recipes/rgi/3.2.0/build.sh +++ /dev/null @@ -1,11 +0,0 @@ -#!/bin/bash - -if [ "$(uname)" == "Darwin" ]; then - echo "Platform: Mac" - -elif [ "$(expr substr $(uname -s) 1 5)" == "Linux" ]; then - echo "Platform: Linux" -fi - -# install setup -$PYTHON setup.py install \ No newline at end of file diff --git a/recipes/rgi/3.2.0/meta.yaml b/recipes/rgi/3.2.0/meta.yaml deleted file mode 100644 index 7af37f9affbd0..0000000000000 --- a/recipes/rgi/3.2.0/meta.yaml +++ /dev/null @@ -1,50 +0,0 @@ -{% set name = "rgi" %} -{% set version = "3.2.0" %} -{% set md5 = "ce60483042769072c7237427e5688ec7" %} -{% set commit = "42773177cfe0a83db9e46019c46368880a058873" %} - -package: - name: {{ name }} - version: {{ version }} - -source: - url: https://github.com/arpcard/rgi_conda_dev/archive/{{ commit }}.tar.gz - md5: {{ md5 }} - -build: - skip: True # [py3k] - number: 3 - -# We pin on gcc version to avoid gcc-5 dual ABI issues depending on boost. -requirements: - build: - - {{ compiler('c') }} - host: - - python - - biopython - - six >=1.7.0 - - zlib - run: - - python - - blast - - biopython - - six >=1.7.0 - - zlib - - prodigal - - diamond >=0.8.24.86 - -test: - commands: - - rgi -h - - rgi_jsontab -h - - rgi_clean -h - - rgi_load -h - - rgi_jsonformat -h - - rgi --software_version - - rgi --data_version - -about: - home: https://card.mcmaster.ca - license: https://card.mcmaster.ca/about - summary: 'This tool provides a preliminary annotation of your DNA sequence(s) based upon the data available in The Comprehensive Antibiotic Resistance Database (CARD). Hits to genes tagged with Antibiotic Resistance ontology terms will be highlighted. As CARD expands to include more pathogens, genomes, plasmids, and ontology terms this tool will grow increasingly powerful in providing first-pass detection of antibiotic resistance associated genes. See license at CARD website' - diff --git a/recipes/rgi/3.2.1/build.sh b/recipes/rgi/3.2.1/build.sh deleted file mode 100644 index 55ea547a2d0c6..0000000000000 --- a/recipes/rgi/3.2.1/build.sh +++ /dev/null @@ -1,3 +0,0 @@ -#!/bin/bash - -$PYTHON setup.py install \ No newline at end of file diff --git a/recipes/rgi/3.2.1/meta.yaml b/recipes/rgi/3.2.1/meta.yaml deleted file mode 100644 index e9f37b6809c96..0000000000000 --- a/recipes/rgi/3.2.1/meta.yaml +++ /dev/null @@ -1,54 +0,0 @@ -{% set name = "rgi" %} -{% set source_url = "https://github.com/arpcard/rgi_conda_dev.git" %} -{% set version = "3.2.1" %} -{% set commit = "8fa15c513f24417ba442f6bd71d3d09f80aad618" %} - -package: - name: {{ name }} - version: {{ version }} - -source: - git_url: {{ source_url }} - git_rev: {{ commit }} - -build: - skip: True # [py3k] - number: 4 - -requirements: - build: - - {{ compiler('c') }} - host: - - python - - biopython - - six >=1.7.0 - - zlib - run: - - python - - blast - - biopython - - six >=1.7.0 - - zlib - - prodigal - - diamond >=0.8.24.86 - -test: - commands: - - rgi -h - - rgi_jsontab -h - - rgi_clean -h - - rgi_load -h - - rgi_jsonformat -h - - rgi --software_version - - rgi --data_version - -about: - home: https://card.mcmaster.ca - license: https://card.mcmaster.ca/about - summary: 'This tool provides a preliminary annotation of your DNA sequence(s) based upon the data available in The Comprehensive Antibiotic Resistance Database (CARD). Hits to genes tagged with Antibiotic Resistance ontology terms will be highlighted. As CARD expands to include more pathogens, genomes, plasmids, and ontology terms this tool will grow increasingly powerful in providing first-pass detection of antibiotic resistance associated genes. See license at CARD website' - -extra: - skip-lints: - - uses_git_url - - missing_hash - diff --git a/recipes/rgi/build.sh b/recipes/rgi/build.sh deleted file mode 100644 index 1cd853e993d97..0000000000000 --- a/recipes/rgi/build.sh +++ /dev/null @@ -1,5 +0,0 @@ -#!/bin/bash - -tar xf rgi-4.0.3.tar.gz -cd rgi-4.0.3 -$PYTHON setup.py install --single-version-externally-managed --record record.txt diff --git a/recipes/rgi/meta.yaml b/recipes/rgi/meta.yaml index bdfd4de5f6515..e5b09d5fb0143 100644 --- a/recipes/rgi/meta.yaml +++ b/recipes/rgi/meta.yaml @@ -1,19 +1,19 @@ {% set name = "rgi" %} -{% set version = "4.0.3" %} -{% set sha256 = "d82c92b2152089046fa0096f279714a068d31108030cb89c7a9fde6f9ee824b5" %} +{% set version = "4.2.2" %} +{% set sha256 = "ab4a5614e359884129064ec318d8dda2516052b26aa38cfd480245d24e0c96e7" %} package: name: {{ name }} version: {{ version }} source: - url: https://card.mcmaster.ca/download/1/software-v{{ version }}.tar.gz + url: https://github.com/arpcard/rgi/archive/{{ version }}.tar.gz sha256: {{ sha256 }} - build: - skip: True # [win] - number: 3 + skip: True # [win or py27] + number: 0 + script: python setup.py install --single-version-externally-managed --record=record.txt requirements: build: @@ -27,13 +27,20 @@ requirements: run: # RGI requires these exact versions of blast prodigal and diamond, or else --alignment_mode DIAMOND fails - python - - filetype - blast ==2.6.0 - - biopython - six >=1.7.0 - zlib - prodigal ==2.6.3 - diamond ==0.8.36 + - biopython >=1.60 + - filetype >=1.0.0 + - pytest >=3.0.0 + - mock >=2.0.0 + - pandas >=0.15.0 + - matplotlib >=2.1.2 + - seaborn >=0.8.1 + - pyfaidx >=0.5.4.1 + - pyahocorasick >=1.1.7 test: commands: @@ -44,11 +51,10 @@ test: - rgi clean -h - rgi galaxy -h - about: home: https://card.mcmaster.ca license: https://card.mcmaster.ca/about - license_file: rgi-{{ version }}/LICENSE + license_file: LICENSE summary: 'This tool provides a preliminary annotation of your DNA sequence(s) based upon the data available in The Comprehensive Antibiotic Resistance Database (CARD). Hits to genes tagged with Antibiotic Resistance ontology terms will be highlighted. As CARD expands to include more pathogens, genomes, plasmids, and ontology terms this tool will grow increasingly powerful in providing first-pass detection of antibiotic resistance associated genes. See license at CARD website' extra: diff --git a/recipes/riborex/build.sh b/recipes/riborex/build.sh deleted file mode 100644 index af6547bf3c22e..0000000000000 --- a/recipes/riborex/build.sh +++ /dev/null @@ -1,2 +0,0 @@ -#!/bin/bash -$R CMD INSTALL --build . diff --git a/recipes/rnaquast/build.sh b/recipes/rnaquast/build.sh new file mode 100644 index 0000000000000..8736b04c39060 --- /dev/null +++ b/recipes/rnaquast/build.sh @@ -0,0 +1,9 @@ +#!/bin/bash + +OUTDIR=$PREFIX/share/$PKG_NAME-$PKG_VERSION-$PKG_BUILDNUM +mkdir -p $OUTDIR +mkdir -p $PREFIX/bin +chmod a+x *.py +cp -rp * "$OUTDIR/" +cd $PREFIX/bin +ln -s "../${OUTDIR#$PREFIX}"/*.py . diff --git a/recipes/rnaquast/meta.yaml b/recipes/rnaquast/meta.yaml new file mode 100644 index 0000000000000..99b0d3acc1f4b --- /dev/null +++ b/recipes/rnaquast/meta.yaml @@ -0,0 +1,40 @@ +{% set name = "rnaQUAST" %} +{% set version = "1.5.1" %} +{% set sha256 = "f603f847bce0346292d2d74c756d32f69c6bffad282d5fff36479d3a901d1f1e" %} + +package: + name: {{ name | lower }} + version: {{ version }} + +source: + url: http://cab.spbu.ru/files/{{ name | lower }}/release{{ version }}/{{ name }}-{{ version }}.tar.gz + sha256: {{ sha256 }} + +build: + number: 0 + skip: True # [osx] + +requirements: + run: + - blast + - blat + - busco >=2 + - emboss + - gmap + - python <3 + - gffutils + - joblib + - matplotlib + - ucsc-pslsort + - star + - tophat + - samtools + +test: + commands: + - rnaQUAST.py --test + +about: + summary: rnaQUAST is a tool for evaluating RNA-Seq assemblies using reference genome and gene database. In addition, rnaQUAST is also capable of estimating gene database coverage by raw reads and de novo quality assessment using third-party software. + home: http://cab.spbu.ru/software/rnaquast/ + license: GPLv2 diff --git a/recipes/rnastructure/build.sh b/recipes/rnastructure/build.sh new file mode 100644 index 0000000000000..8238b87f2b362 --- /dev/null +++ b/recipes/rnastructure/build.sh @@ -0,0 +1,11 @@ +#!/bin/sh +make all + +mkdir -p $PREFIX/bin +mv ./exe/* $PREFIX/bin/ + +# Some of the tools inside the package require the information in /data_tables +# This makes them accessible from a relative path to the binaries. + +mkdir -p $PREFIX/share/${PKG_NAME}/data_tables +mv ./data_tables/* $PREFIX/share/${PKG_NAME}/data_tables/ diff --git a/recipes/rnastructure/meta.yaml b/recipes/rnastructure/meta.yaml new file mode 100644 index 0000000000000..fcbb0db7bbdd7 --- /dev/null +++ b/recipes/rnastructure/meta.yaml @@ -0,0 +1,44 @@ +about: + home: http://rna.urmc.rochester.edu/RNAstructure.html + license: GPLv2 + license_family: GPL + license_file: gpl.txt + summary: 'RNAstructure is a complete package for RNA and DNA secondary structure prediction + and analysis. It includes algorithms for secondary structure prediction, including + facility to predict base pairing probabilities. It also can be used to predict + bimolecular structures and can predict the equilibrium binding affinity of an + oligonucleotide to a structured RNA target. This is useful for siRNA design. + It can also predict secondary structures common to two, unaligned sequences, + which is much more accurate than single sequence secondary structure prediction. + Finally, RNAstructure can take a number of different types of experiment mapping + data to constrain or restrain structure prediction. These include chemical mapping, + enzymatic mapping, NMR, and SHAPE data.' + +build: + number: 0 + skip: True # [osx] + +package: + name: rnastructure + version: '6.1' + +requirements: + build: + - {{ compiler('c') }} + - {{ compiler('cxx') }} + run: + +source: + sha256: b9a5468a53a6546bcc060d7befc9466a6688f1d1c2611707630d991c69193ed5 + url: http://rna.urmc.rochester.edu/Releases/6.1/RNAstructureSource.tgz + + +# In version 6.0, several commands are returning exit code 1 when called with +# the -h option. Therefore, changed the modules that are tested. +test: + commands: + - bifold -h + +extra: + identifiers: + - biotools:rnastructure diff --git a/recipes/scanpy-scripts/build.sh b/recipes/scanpy-scripts/build.sh new file mode 100644 index 0000000000000..6cf47a0224eba --- /dev/null +++ b/recipes/scanpy-scripts/build.sh @@ -0,0 +1,5 @@ +#!/usr/bin/env bash + +mkdir -p $PREFIX/bin +cp *.py $PREFIX/bin +cp *.sh $PREFIX/bin diff --git a/recipes/scanpy-scripts/meta.yaml b/recipes/scanpy-scripts/meta.yaml new file mode 100644 index 0000000000000..985f849167008 --- /dev/null +++ b/recipes/scanpy-scripts/meta.yaml @@ -0,0 +1,48 @@ +{% set version = '0.0.2' %} + +package: + name: scanpy-scripts + version: {{ version }} + +source: + url: https://github.com/ebi-gene-expression-group/scanpy-scripts/archive/v{{ version }}.tar.gz + sha256: 4d9d3193857e5f801540236db547aa91db6c1db47c43943915f130c4fa8a31b2 + +build: + number: 0 + noarch: generic + +requirements: + host: + - python>=3.6 + run: + - python>=3.6 + - pandas>=0.21 + - matplotlib>=3.0.0 + - scanpy>=1.3.2 + +test: + commands: + - scanpy-read-10x.py --help + - scanpy-filter-cells.py --help + - scanpy-filter-genes.py --help + - scanpy-normalise-data.py --help + - scanpy-find-variable-genes.py --help + - scanpy-scale-data.py --help + - scanpy-run-pca.py --help + - scanpy-neighbours.py --help + - scanpy-run-umap.py --help + - scanpy-run-tsne.py --help + - scanpy-find-cluster.py --help + - scanpy-find-markers.py --help + - which scanpy-scripts-post-install-tests.sh + +about: + home: https://github.com/ebi-gene-expression-group/scanpy-scripts + dev_url: https://github.com/ebi-gene-expression-group/scanpy-scripts + license: GPL-3 + summary: A set of wrappers for individual components of the scanpy package. + Functions in python packages are hard to call when building workflows + outside of python, so this package adds a set of simple wrappers with + robust argument parsing. + license_family: GPL diff --git a/recipes/scanpy-scripts/post-link.sh b/recipes/scanpy-scripts/post-link.sh new file mode 100644 index 0000000000000..a689d8ad9d1db --- /dev/null +++ b/recipes/scanpy-scripts/post-link.sh @@ -0,0 +1,4 @@ +#!/usr/bin/env bash + +echo 'Post install test script "scanpy-scripts-post-install-tests.sh" requires' +echo 'conda package "bats-core".' diff --git a/recipes/scanpy/meta.yaml b/recipes/scanpy/meta.yaml index e1dcc6a04787f..f83583a57261a 100644 --- a/recipes/scanpy/meta.yaml +++ b/recipes/scanpy/meta.yaml @@ -1,5 +1,5 @@ {% set name = "scanpy" %} -{% set version = "1.3.1" %} +{% set version = "1.3.2" %} package: name: {{ name|lower }} @@ -9,7 +9,7 @@ build: skip: True # [not py36] source: url: https://github.com/theislab/scanpy/archive/{{ version }}.tar.gz - sha256: ae29eb6e0998cb8eb613f72800a97265362c95bbe3cd4019d4127e006eef6453 + sha256: 24266a2c7ef6673e8619ad132e91f55f3c15c005b4a7682395a1d36d1c7ff038 requirements: host: diff --git a/recipes/seer/build.sh b/recipes/seer/build.sh new file mode 100644 index 0000000000000..f48db84e37b70 --- /dev/null +++ b/recipes/seer/build.sh @@ -0,0 +1,54 @@ +#!/bin/bash + +# build gzstream for static linking +pushd gzstream +make clean +make CXX="$CXX $CXXFLAGS" CPPFLAGS="$CPPFLAGS -I. -I$PREFIX/include" AR="$AR cr" +popd + +# build boost program options for static linking +# see +# https://github.com/conda-forge/boost-cpp-feedstock/blob/master/recipe/build.sh +# https://github.com/boostorg/program_options/blob/develop/.travis.yml +pushd boost +python2 tools/boostdep/depinst/depinst.py program_options --include example + +CXXFLAGS="${CXXFLAGS} -fPIC" +INCLUDE_PATH="${PREFIX}/include" +LIBRARY_PATH="${PREFIX}/lib" +LINKFLAGS="${LINKFLAGS} -L${LIBRARY_PATH}" + +cat < tools/build/src/site-config.jam +using gcc : custom : ${CXX} ; +EOF + +BOOST_BUILT="${SRC_DIR}/boost_built" +mkdir $BOOST_BUILT +./bootstrap.sh --prefix="${BOOST_BUILT}" --with-libraries=program_options --with-toolset=gcc +./b2 -q \ + variant=release \ + address-model="${ARCH}" \ + architecture=x86 \ + debug-symbols=off \ + threading=multi \ + runtime-link=shared \ + link=static,shared \ + toolset=gcc-custom \ + include="${INCLUDE_PATH}" \ + cxxflags="${CXXFLAGS}" \ + linkflags="${LINKFLAGS}" \ + --layout=system \ + -j"${CPU_COUNT}" \ + install +popd + +# build seer, statically linking boost manually +pushd src +make CXXFLAGS="$CXXFLAGS" \ + SEER_LDLIBS="-L../gzstream -L${BOOST_BUILT}/lib -L/usr/local/hdf5/lib -lhdf5 -lgzstream -lz -larmadillo -Wl,-Bstatic -lboost_program_options -Wl,-Bdynamic -lopenblas -llapack -lpthread" \ + MAP_LDLIBS="-L${BOOST_BUILT}/lib -Wl,-Bstatic -lboost_program_options -Wl,-Bdynamic -lpthread" \ + COMBINE_LDLIBS="-L${BOOST_BUILT}/lib -L../gzstream -L/lib -lgzstream -lz -Wl,-Bstatic -lboost_program_options -Wl,-Bdynamic" \ + FILTER_LDLIBS="-L${BOOST_BUILT}/lib -Wl,-Bstatic -lboost_program_options -Wl,-Bdynamic" \ + CPPFLAGS="-I${BOOST_BUILT}/include -I../gzstream -I../dlib -I/usr/local/hdf5/include -D DLIB_NO_GUI_SUPPORT=1 -D DLIB_USE_BLAS=1 -D DLIB_USE_LAPACK=1 -DARMA_DONT_USE_WRAPPER -DARMA_USE_HDF5=1" +make install BINDIR="${PREFIX}/bin" +popd diff --git a/recipes/seer/conda_build_config.yaml b/recipes/seer/conda_build_config.yaml new file mode 100644 index 0000000000000..11a99874d8009 --- /dev/null +++ b/recipes/seer/conda_build_config.yaml @@ -0,0 +1,4 @@ +c_compiler: + - gcc # [linux] +cxx_compiler: + - gxx # [linux] diff --git a/recipes/seer/meta.yaml b/recipes/seer/meta.yaml new file mode 100644 index 0000000000000..ed90983c72e72 --- /dev/null +++ b/recipes/seer/meta.yaml @@ -0,0 +1,46 @@ +{% set name = "seer" %} +{% set version = "1.1.4" %} + +package: + name: {{ name|lower}} + version: {{ version }} + +source: + url: https://github.com/johnlees/{{ name|lower }}/releases/download/v{{ version }}/{{ name|lower }}_v{{ version }}_submodules.tar.gz + sha256: db35dc61374ebd593093f0dbf07305a8d97e41307562c3858608c28f3829a41e + +build: + skip: True # [osx] + number: 0 + +requirements: + build: + - {{ compiler('cxx') }} + - python <3 + host: + - zlib + - armadillo + - hdf5 + - pthread-stubs + run: + - armadillo + - hdf5 + - pthread-stubs + +test: + commands: + - seer --version | grep "1.1.4" + - kmds --version | grep "1.1.4" + - combineKmers -h 2>&1 | grep "combine kmer counts" + - filter_seer --version | grep "1.1.2" + +about: + home: https://github.com/johnlees/seer + license: GPL-2 + license_family: GPL + license_file: LICENSE + summary: sequence element (kmer) enrichment analysis + +extra: + identifiers: + - doi:10.1038/ncomms12797 diff --git a/recipes/selene-sdk/meta.yaml b/recipes/selene-sdk/meta.yaml index fb851c0a249d9..c1f61092c6ee2 100644 --- a/recipes/selene-sdk/meta.yaml +++ b/recipes/selene-sdk/meta.yaml @@ -4,7 +4,7 @@ package: source: url: https://github.com/FunctionLab/selene/archive/0.1.3.tar.gz - sha256: e0a3a2096ffd13b037b3f74e7548bf93074aeb65ddfa0ccca41183dab6c902ac + sha256: d3fa90449c674204bd3dd06978680a85522745d705029a1ab8cb4597b31a3fa8 build: number: 0 diff --git a/recipes/seq-seq-pan/1.0.0/build.sh b/recipes/seq-seq-pan/1.0.0/build.sh new file mode 100755 index 0000000000000..b3dabae16b6a1 --- /dev/null +++ b/recipes/seq-seq-pan/1.0.0/build.sh @@ -0,0 +1,16 @@ +#!/bin/bash + +mkdir -p $PREFIX/bin +mkdir -p $PREFIX/opt/seq-seq-pan/ + + +sed -i "s|\${BASH_SOURCE%/\*}|$PREFIX/opt/seq-seq-pan|g" seq-seq-pan +sed -i "s|\${BASH_SOURCE%/\*}|$PREFIX/opt/seq-seq-pan|g" seq-seq-pan-consensus +sed -i "s|\${BASH_SOURCE%/\*}|$PREFIX/opt/seq-seq-pan|g" seq-seq-pan-wga +sed -i "s|\${BASH_SOURCE%/\*}|$PREFIX/opt/seq-seq-pan|g" seq-seq-pan-genomedescription + +cp -r * $PREFIX/opt/seq-seq-pan/ +ln -s $PREFIX/opt/seq-seq-pan/seq-seq-pan $PREFIX/bin +ln -s $PREFIX/opt/seq-seq-pan/seq-seq-pan-consensus $PREFIX/bin +ln -s $PREFIX/opt/seq-seq-pan/seq-seq-pan-wga $PREFIX/bin +ln -s $PREFIX/opt/seq-seq-pan/seq-seq-pan-genomedescription $PREFIX/bin diff --git a/recipes/seq-seq-pan/1.0.0/meta.yaml b/recipes/seq-seq-pan/1.0.0/meta.yaml new file mode 100644 index 0000000000000..e5597545f04e8 --- /dev/null +++ b/recipes/seq-seq-pan/1.0.0/meta.yaml @@ -0,0 +1,36 @@ +{% set version = "1.0.0" %} + +package: + name: seq-seq-pan + version: {{ version }} + +source: + url: https://gitlab.com/chrjan/seq-seq-pan/repository/v{{ version }}/archive.tar.gz + md5: 7a0c00d8de984f7129c7bcbe4fa26892 + +build: + number: 2 + skip: True # [osx or py27] + +requirements: + run: + - python + - biopython ==1.69 + - blat ==35 + - snakemake ==4.3 + - openjdk + - argparse + - progressivemauve ==snapshot-2015-02-13 + +test: + commands: + - seq-seq-pan -h > /dev/null + - seq-seq-pan-wga --no-hooks --config workdir=$PREFIX/opt/seq-seq-pan/example/minimal genomefile=genome_list.txt outfilename=ssp_example -n > /dev/null + - java -jar $PREFIX/opt/seq-seq-pan/java/XMFAConsensus/XMFAconsensus_majorityvote.jar -h > /dev/null + - seq-seq-pan-consensus -h > /dev/null + - seq-seq-pan-genomedescription -h >/dev/null + +about: + home: https://gitlab.com/chrjan/seq-seq-pan + license: FreeBSDLicense + summary: seq-seq-pan is a workflow for the SEQuential alignment of SEQuences to build a PAN-genome data structure and a whole-genome-alignment. diff --git a/recipes/seq-seq-pan/meta.yaml b/recipes/seq-seq-pan/meta.yaml index e5597545f04e8..5c275c617a20a 100644 --- a/recipes/seq-seq-pan/meta.yaml +++ b/recipes/seq-seq-pan/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "1.0.0" %} +{% set version = "1.0.1" %} package: name: seq-seq-pan @@ -6,10 +6,10 @@ package: source: url: https://gitlab.com/chrjan/seq-seq-pan/repository/v{{ version }}/archive.tar.gz - md5: 7a0c00d8de984f7129c7bcbe4fa26892 + md5: e053bc23c84493c29926aafafd77c966 build: - number: 2 + number: 1 skip: True # [osx or py27] requirements: @@ -20,7 +20,7 @@ requirements: - snakemake ==4.3 - openjdk - argparse - - progressivemauve ==snapshot-2015-02-13 + - mauvealigner ==1.2.0 test: commands: diff --git a/recipes/seqcluster/meta.yaml b/recipes/seqcluster/meta.yaml index 2bb1de814ebce..cda3ee3863386 100644 --- a/recipes/seqcluster/meta.yaml +++ b/recipes/seqcluster/meta.yaml @@ -1,4 +1,4 @@ -{% set tag="4635e11" %} +{% set tag="3546d68" %} about: home: https://github.com/lpantano/seqclsuter @@ -7,11 +7,11 @@ about: package: name: seqcluster - version: '1.2.4a6' + version: '1.2.4a12' source: url: https://github.com/lpantano/seqcluster/archive/{{ tag }}.tar.gz - sha256: a890ffe044a547397124a939055f815a81497e737ce2f9495f9b7885391ea255 + sha256: 8eb075ac73e29f7d323841f4c2e79becb624205eb8c5d3d508c68d97d0272cdb build: number: 0 skip: True # [not py27] @@ -29,6 +29,7 @@ requirements: - pybedtools - progressbar - biopython + - mirtop test: commands: diff --git a/recipes/seqkit/meta.yaml b/recipes/seqkit/meta.yaml index 863aaac9160b6..83fa55e0c9a37 100644 --- a/recipes/seqkit/meta.yaml +++ b/recipes/seqkit/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "0.9.0" %} +{% set version = "0.9.1" %} package: name: seqkit @@ -15,13 +15,13 @@ build: source: url: https://github.com/shenwei356/seqkit/releases/download/v{{ version }}/seqkit_darwin_amd64.tar.gz # [osx] - md5: acd7ca0ca77f86ff2c8a4a3e4619fe8b # [osx] + md5: 8607754ac2207cbf861da78c9ade6e6b # [osx] url: https://github.com/shenwei356/seqkit/releases/download/v{{ version }}/seqkit_linux_386.tar.gz # [linux] - md5: 0050428874333cecbc8dc0fa59559ac6 # [linux] + md5: 65a73a13e408159a3b635f6cf59a40cd # [linux] url: https://github.com/shenwei356/seqkit/releases/download/v{{ version }}/seqkit_linux_amd64.tar.gz # [linux64] - md5: 56ba55ad95998a58d2d6dcafbf6a60b7 # [linux64] + md5: fcc7e59b42f9afa18ade7c331fa9b7c2 # [linux64] test: commands: diff --git a/recipes/seqyclean/meta.yaml b/recipes/seqyclean/meta.yaml index 2e01b038eb00f..12b7622385f64 100644 --- a/recipes/seqyclean/meta.yaml +++ b/recipes/seqyclean/meta.yaml @@ -1,6 +1,6 @@ {% set name = "SeqyClean" %} -{% set version = "1.10.07" %} -{% set sha256 = "520550c042f1575d2d68fd6070207e02025fa5f78d1373f853283ca4efc05edc" %} +{% set version = "1.10.09" %} +{% set sha256 = "9fd357f677c37711ca11ebd645c5d6f49c87be087c8f512924d475e8a11029df" %} package: name: {{ name|lower }} @@ -11,7 +11,7 @@ source: sha256: {{ sha256 }} build: - number: 1 + number: 0 requirements: build: diff --git a/recipes/sevenbridges-python/meta.yaml b/recipes/sevenbridges-python/meta.yaml index 758d416ebc210..c2b33ed6b4b76 100644 --- a/recipes/sevenbridges-python/meta.yaml +++ b/recipes/sevenbridges-python/meta.yaml @@ -1,5 +1,5 @@ -{% set version = "0.15.2" %} -{% set sha256 = "0bad5cd47d91f86efb8cbba8d2f77a3c5a3d4a3c023db32f06f2fa6e11d64c59" %} +{% set version = "0.16.0" %} +{% set sha256 = "3f194f032dd76e30f8ffe3bec5110bbc853d45f90090419f2816e3df9710f9ec" %} package: name: sevenbridges-python diff --git a/recipes/shovill/meta.yaml b/recipes/shovill/meta.yaml index f1d278c7532c5..a4d17a25aaa94 100644 --- a/recipes/shovill/meta.yaml +++ b/recipes/shovill/meta.yaml @@ -1,16 +1,16 @@ {% set name = "shovill" %} -{% set version = "1.0.1" %} -{% set sha256 = "3985a1381a009d2335645627c14301395ab82f0ad6a7f48f7e1abab3303cfec9" %} +{% set version = "1.0.4" %} +{% set sha256 = "6eaa6c596190f47b83e1acce0ca1afc9d0d133762b028f83ca8d2ca1533b5389" %} package: - name: {{ name }} + name: shovill version: {{ version }} build: number: 0 source: - url: https://github.com/tseemann/{{ name }}/archive/v{{ version }}.tar.gz + url: https://github.com/tseemann/shovill/archive/v{{ version }}.tar.gz sha256: {{ sha256 }} requirements: @@ -20,7 +20,7 @@ requirements: - perl-findbin - lighter >=1.1 - bwa >=0.7.17 - - mash >=2 + - mash >=2.1 - flash >=1.2 - pilon >=1.22 - seqtk >=1.3 diff --git a/recipes/sickle/meta.yaml b/recipes/sickle/meta.yaml index 4198189faab66..fe0dcc5998699 100644 --- a/recipes/sickle/meta.yaml +++ b/recipes/sickle/meta.yaml @@ -1,8 +1,8 @@ -{% set version = "0.6.3" %} -{% set sha256 = "e2b6c684fd16ce3e6b556ccdb6ace2a084c60eceb9583993c76461c9206808fe" %} +{% set version = "0.6.4" %} +{% set sha256 = "b0aaa41d97a0c355aa6099b4dfa46c03f0bf828e6171960a15d68bd0548215ec" %} build: - number: 2 + number: 0 skip: true # [osx] script: $PYTHON setup.py install --single-version-externally-managed --record=record.txt @@ -11,7 +11,6 @@ package: version: '{{version}}' source: - fn: Sickle-{{version}}.tar.gz url: https://pypi.python.org/packages/source/S/Sickle/Sickle-{{version}}.tar.gz sha256: '{{sha256}}' @@ -25,7 +24,6 @@ requirements: run: - python - - libgcc #[linux] - requests >=1.1.0 - lxml >=3.2.3 diff --git a/recipes/ska/build.sh b/recipes/ska/build.sh new file mode 100644 index 0000000000000..515b60f6c5636 --- /dev/null +++ b/recipes/ska/build.sh @@ -0,0 +1,6 @@ +#!/bin/bash + +make CXX="$CXX" CXXFLAGS="$CXXFLAGS" LDFLAGS="-L$PREFIX/lib -lz" + +install -d ${PREFIX}/bin +install bin/ska ${PREFIX}/bin diff --git a/recipes/ska/conda_build_config.yaml b/recipes/ska/conda_build_config.yaml new file mode 100644 index 0000000000000..a864705eed8d4 --- /dev/null +++ b/recipes/ska/conda_build_config.yaml @@ -0,0 +1,6 @@ +c_compiler: + - gcc # [linux] + - clang # [osx] +cxx_compiler: + - gxx # [linux] + - clangxx # [osx] diff --git a/recipes/ska/meta.yaml b/recipes/ska/meta.yaml new file mode 100644 index 0000000000000..44f6556566f7f --- /dev/null +++ b/recipes/ska/meta.yaml @@ -0,0 +1,30 @@ +{% set name = "ska" %} +{% set version = "1.0" %} + +package: + name: {{ name|lower}} + version: {{ version }} + +source: + url: https://github.com/simonrharris/{{ name|upper }}/archive/v{{ version }}.tar.gz + sha256: fc6110c22c756158b190f50dc11d596265f9b0d09c28725b2b23ed22e2e4fbff + +build: + number: 0 + +requirements: + build: + - {{ compiler('cxx') }} + host: + - zlib + +test: + commands: + - ska version + +about: + home: https://github.com/simonrharris/SKA + license: GPL-3 + license_family: GPL + license_file: LICENSE + summary: SKA (Split Kmer Analysis) diff --git a/recipes/skesa/meta.yaml b/recipes/skesa/meta.yaml index e05e2517056fe..4f397bac8eab7 100644 --- a/recipes/skesa/meta.yaml +++ b/recipes/skesa/meta.yaml @@ -1,5 +1,5 @@ {% set name="skesa" %} -{% set version="2.2" %} +{% set version="2.3.0" %} package: name: {{ name }} @@ -7,10 +7,10 @@ package: source: url: https://github.com/ncbi/SKESA/archive/v{{ version }}.tar.gz - sha256: 77aaf4a5b355a3968be5383b672c6eef4561133a5a26b524632dc93b15b5ea66 + sha256: 13832e41b69a94d9f64dee7685b4d05f2e94f807ad819afa8d4cd78cee54879d build: - number: 2 + number: 0 requirements: build: diff --git a/recipes/slicedimage/meta.yaml b/recipes/slicedimage/meta.yaml index 3316217fcf681..531d48d69ad5d 100644 --- a/recipes/slicedimage/meta.yaml +++ b/recipes/slicedimage/meta.yaml @@ -1,4 +1,4 @@ -{% set SLICEDIMAGE_VERSION = "0.1.0" %} +{% set SLICEDIMAGE_VERSION = "1.0.1" %} package: name: slicedimage @@ -6,7 +6,7 @@ package: source: url: https://github.com/spacetx/slicedimage/archive/{{ SLICEDIMAGE_VERSION }}.zip - sha1: 30f28e730671b13688d0dc791d0be5601c558b86 + sha1: 1caf9f448380e81309b8f67044342dc6fc94c1dd build: noarch: python diff --git a/recipes/smoove/meta.yaml b/recipes/smoove/meta.yaml index 472732c80742a..414bbd0c588e8 100644 --- a/recipes/smoove/meta.yaml +++ b/recipes/smoove/meta.yaml @@ -1,5 +1,5 @@ -{% set version = "0.1.9" %} -{% set sha256 = "87648344c966e198b828e0b350383982bacbff27932673ad7c342e6d73115ca6" %} +{% set version = "0.2.1" %} +{% set sha256 = "6fbdc3b2d33c20630f84ff7e5fe3e1d46ec14337d737d502c22c9a531c270319" %} package: name: smoove @@ -10,9 +10,9 @@ source: sha256: '{{ sha256 }}' build: - number: 3 + number: 0 binary_relocation: false - skip: true # [not linux] + skip: true # [not linux] requirements: run: @@ -24,6 +24,8 @@ requirements: - mosdepth - bcftools - htslib + - duphold + - tabix test: commands: diff --git a/recipes/sniffles/meta.yaml b/recipes/sniffles/meta.yaml index eb6712da55429..697d29034c1a9 100644 --- a/recipes/sniffles/meta.yaml +++ b/recipes/sniffles/meta.yaml @@ -1,5 +1,5 @@ -{% set version = "1.0.8" %} -{% set sha256 = "59bab786c3d60c58d94e7cef4a292b418315aea6dfadf4a1c234de8f5e6180f2" %} +{% set version = "1.0.10" %} +{% set sha256 = "d88d7b689a1666f671ab8a1e8bd5367861150896dc037caa82962cad74f02532" %} package: name: sniffles diff --git a/recipes/snippy/meta.yaml b/recipes/snippy/meta.yaml index d470f91710bb8..a5137146fd51e 100644 --- a/recipes/snippy/meta.yaml +++ b/recipes/snippy/meta.yaml @@ -1,6 +1,6 @@ {% set name = "snippy" %} -{% set version = "4.2.3" %} -{% set sha256 = "32ebe700835ce1df0895a5a377edf08babd83c5e811cbfcea50657701a61c2e4" %} +{% set version = "4.3.3" %} +{% set sha256 = "eaee16f915f67180b334c4d7aa3a8588081ec004036651621b1d579f853d0bcd" %} package: name: '{{ name }}' diff --git a/recipes/snp-dists/meta.yaml b/recipes/snp-dists/meta.yaml index 118731ed61b88..2c9922437b51a 100644 --- a/recipes/snp-dists/meta.yaml +++ b/recipes/snp-dists/meta.yaml @@ -1,16 +1,16 @@ {% set name = "snp-dists" %} -{% set version = "0.6" %} +{% set version = "0.6.2" %} package: name: {{ name }} version: {{ version }} build: - number: 1 + number: 0 source: url: https://github.com/tseemann/{{ name }}/archive/v{{ version }}.tar.gz - sha256: 7e412de31e60bfe7ea51f67e92dba9e6cac5d1d12326522015b26407ddaca483 + sha256: 4a012a1aa6e837cadadfdda15fa5ce824a299378212d0f8b0cb93a1f7693c43a requirements: build: diff --git a/recipes/snp-sites/meta.yaml b/recipes/snp-sites/meta.yaml index 785bf46618827..0b460833c41f0 100644 --- a/recipes/snp-sites/meta.yaml +++ b/recipes/snp-sites/meta.yaml @@ -1,5 +1,5 @@ -{% set version = "2.4.0" %} -{% set sha256 = "4ccbf6016b37ba1aae67ee8dd265537098eb9a7965186deb0b862efd7c416ae6" %} +{% set version = "2.4.1" %} +{% set sha256 = "9f37bf30bcbdb52b6c8b201410a9e232b33a105f3197765f51b1b434ae851de3" %} package: @@ -7,7 +7,7 @@ package: version: '{{version}}' build: - number: 3 + number: 0 source: url: https://github.com/sanger-pathogens/snp-sites/archive/v{{version}}.tar.gz diff --git a/recipes/solvebio/meta.yaml b/recipes/solvebio/meta.yaml index 344e5208e20d3..8ceb25933c2d7 100644 --- a/recipes/solvebio/meta.yaml +++ b/recipes/solvebio/meta.yaml @@ -1,5 +1,5 @@ -{% set version = "2.6.1" %} -{% set sha256 = "c12a4fb60bc2387c83657e77827060b552be5138d9cf23edb920cba622c90278" %} +{% set version = "2.7.0" %} +{% set sha256 = "b248098c107e4cda4c8c0f4ad0b900c7c058c4f48088623b144215a1c268a01e" %} package: name: solvebio diff --git a/recipes/sompy/LICENSE b/recipes/sompy/LICENSE new file mode 100644 index 0000000000000..3662046ce8f75 --- /dev/null +++ b/recipes/sompy/LICENSE @@ -0,0 +1,21 @@ +The MIT License (MIT) + +Copyright (c) 2016 Yota Ishikawa + +Permission is hereby granted, free of charge, to any person obtaining a copy +of this software and associated documentation files (the "Software"), to deal +in the Software without restriction, including without limitation the rights +to use, copy, modify, merge, publish, distribute, sublicense, and/or sell +copies of the Software, and to permit persons to whom the Software is +furnished to do so, subject to the following conditions: + +The above copyright notice and this permission notice shall be included in all +copies or substantial portions of the Software. + +THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR +IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, +FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE +AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER +LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, +OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE +SOFTWARE. diff --git a/recipes/sompy/meta.yaml b/recipes/sompy/meta.yaml new file mode 100644 index 0000000000000..bd83fd3fdc883 --- /dev/null +++ b/recipes/sompy/meta.yaml @@ -0,0 +1,40 @@ +{% set name = "sompy" %} +{% set version = "0.1.1" %} + +package: + name: "{{ name|lower }}" + version: "{{ version }}" + +source: + url: https://pypi.io/packages/source/{{ name[0] }}/{{ name }}/{{ name }}-{{ version }}.tar.gz + sha256: 846626a39e27cca171a81f4388cb30a32cdcd3bedf170c91227cf5a958aaabec + +build: + number: 0 + skip: True # [py3k] + script: "{{ PYTHON }} -m pip install . --no-deps --ignore-installed -vvv " + +requirements: + host: + - numpy + - pip + - python + run: + - numpy + - python + - matplotlib + +test: + imports: + - sompy + +about: + home: https://github.com/ttlg/sompy + license: MIT + license_family: MIT + license_file: '{{ environ["RECIPE_DIR"] }}/LICENSE' + summary: "Numpy based SOM Library." + +extra: + recipe-maintainers: + - npavlovikj diff --git a/recipes/sonicparanoid/build.sh b/recipes/sonicparanoid/build.sh new file mode 100644 index 0000000000000..f9fb4ea80ce91 --- /dev/null +++ b/recipes/sonicparanoid/build.sh @@ -0,0 +1 @@ +python setup.py install --single-version-externally-managed --record=record.txt # Python command to install the script. diff --git a/recipes/sonicparanoid/meta.yaml b/recipes/sonicparanoid/meta.yaml new file mode 100644 index 0000000000000..5c2731e82ce84 --- /dev/null +++ b/recipes/sonicparanoid/meta.yaml @@ -0,0 +1,54 @@ +{% set name = "sonicparanoid" %} +{% set version = "1.0.14" %} +{% set commit = "71606dae6146" %} + +build: + number: 0 + +package: + name: "{{ name|lower }}" + version: "{{ version }}" + +source: + url: https://bitbucket.org/salvocos/sonicparanoid/get/{{ commit }}.zip + sha256: 7ec5737d5cbebbf58e4f970dae5de1075da7a549a66f9b2cf22192acb95b9353 + +requirements: + build: + - {{ compiler("cxx") }} + host: + - make + - python >=3.5 + - numpy + - cython + - mmseqs2 ==6.f5a1c + run: + - mmseqs2 ==6.f5a1c + - make + - python >=3.5 + - pip >=9.0.1 + - cython >=0.27.0 + - setuptools >=24.2.0 + - biopython >=1.67 + - pandas >=0.22.0 + - numpy >=1.13.0 + - sh >=1.12.14 + +test: + commands: + - "sonicparanoid" + - "sonicparanoid-get-mmseqs2 --help" + - "sonicparanoid-set-mmseqs2 --help" + - "sonicparanoid-get-test-data --help" + - "sonicparanoid-extract --help" + +about: + home: "http://iwasakilab.bs.s.u-tokyo.ac.jp/sonicparanoid/" + license: "GNU General Public License v3" + license_family: "GPL3" + license_file: "LICENSE.md" + summary: "SonicParanoid: fast, easy and accurate orthology inference" + +extra: + identifiers: + - https://doi.org/10.1093/bioinformatics/bty631 diff --git a/recipes/spades/3.9.1/build.sh b/recipes/spades/3.9.1/build.sh new file mode 100644 index 0000000000000..4629620a7735b --- /dev/null +++ b/recipes/spades/3.9.1/build.sh @@ -0,0 +1,8 @@ +#!/bin/bash +outdir=$PREFIX/share/$PKG_NAME-$PKG_VERSION-$PKG_BUILDNUM +mkdir -p $outdir +mkdir -p $PREFIX/bin + +cp -r bin $outdir +cp -r share $outdir +ln -s $outdir/bin/* $PREFIX/bin diff --git a/recipes/spades/3.9.1/meta.yaml b/recipes/spades/3.9.1/meta.yaml new file mode 100644 index 0000000000000..fef352bdc551d --- /dev/null +++ b/recipes/spades/3.9.1/meta.yaml @@ -0,0 +1,31 @@ +package: + name: spades + version: '3.9.1' + +source: + url: http://spades.bioinf.spbau.ru/release3.9.1/SPAdes-3.9.1-Linux.tar.gz # [linux] + md5: 095f4f7dd0e6496156df5d7c9419a70f # [linux] + url: http://spades.bioinf.spbau.ru/release3.9.1/SPAdes-3.9.1-Darwin.tar.gz # [osx] + md5: d41d8cd98f00b204e9800998ecf8427e # [osx] + +build: + number: 0 + skip: True # [py36] + +requirements: + run: + - python + +test: + commands: + - spades.py --test && rm -rf spades_test + +about: + home: http://bioinf.spbau.ru/en/spades + license: GPLv2 + summary: SPAdes (St. Petersburg genome assembler) is intended for both standard isolates and single-cell MDA bacteria assemblies. + +extra: + identifiers: + - biotools:Spades + - doi:10.1089/cmb.2012.0021 diff --git a/recipes/squid/meta.yaml b/recipes/squid/meta.yaml index 0c76f99af710f..9931bba290d90 100644 --- a/recipes/squid/meta.yaml +++ b/recipes/squid/meta.yaml @@ -1,4 +1,4 @@ -{% set version="1.4" %} +{% set version="1.5" %} package: name: squid @@ -9,7 +9,7 @@ build: source: url: https://github.com/Kingsford-Group/squid/archive/v{{ version }}.tar.gz - md5: 0786119db2ce764dc55fdb407e5ddd7b + sha256: fb7b6e6985d5940b8e7caa22708a4da16b55504c9ef1d36f3deb85dd372ba4a6 requirements: build: diff --git a/recipes/stacks/2.2/build.sh b/recipes/stacks/2.2/build.sh index b1019e926dc8e..e12933bd0370c 100644 --- a/recipes/stacks/2.2/build.sh +++ b/recipes/stacks/2.2/build.sh @@ -11,8 +11,17 @@ fi export CXXFLAGS="${CXXFLAGS} -std=c++11" -./configure --prefix=$PREFIX --enable-bam +./configure --prefix="$PREFIX" --enable-bam make make install # copy missing scripts -cp -p scripts/{convert_stacks.pl,extract_interpop_chars.pl} $PREFIX/bin/ +cp -p scripts/{convert_stacks.pl,extract_interpop_chars.pl} "$PREFIX/bin/" + +# after installation the exe_dir is set to the absolute binary path +# this is not necessary and leads to an error if there are characters +# like @ included (Galaxy) +for i in ref_map.pl denovo_map.pl +do + sed -i -e 's/\(my $exe_path\s\+= \).*/\1"";/' "$PREFIX/bin/$i" +done + diff --git a/recipes/stacks/2.2/meta.yaml b/recipes/stacks/2.2/meta.yaml index 50e22a4b9ee80..69ba4f7effd61 100644 --- a/recipes/stacks/2.2/meta.yaml +++ b/recipes/stacks/2.2/meta.yaml @@ -6,7 +6,7 @@ package: version: {{ version }} build: - number: 0 + number: 1 source: sha256: {{ hash }} diff --git a/recipes/starfish/meta.yaml b/recipes/starfish/meta.yaml index 770b2fea4bd90..806748b87dec9 100644 --- a/recipes/starfish/meta.yaml +++ b/recipes/starfish/meta.yaml @@ -1,4 +1,4 @@ -{% set STARFISH_VERSION = "0.0.23" %} +{% set STARFISH_VERSION = "0.0.27" %} package: name: starfish @@ -6,11 +6,11 @@ package: source: url: https://github.com/spacetx/starfish/archive/{{ STARFISH_VERSION }}.zip - sha1: 4be8318928c9576f8998f965c413b953be64b32a + sha256: 0502319556f699e82758fb7cf128f8ec7d2b3ca1356b9386e9e8ab55caf0e1da build: noarch: python - number: 2 + number: 0 requirements: host: diff --git a/recipes/stream/meta.yaml b/recipes/stream/meta.yaml index c1efa47e2122f..0957f2327e890 100644 --- a/recipes/stream/meta.yaml +++ b/recipes/stream/meta.yaml @@ -1,10 +1,10 @@ package: name: stream - version: 0.2.5 + version: 0.2.6 source: url: https://github.com/pinellolab/STREAM/archive/stream_python3.zip - sha256: 34bd222292c6725fddbfce6f5484b7fbcbf2fb2b26be6056ad70e3851968112c + sha256: cbc8333f6d6bb6580abeae7717391d877bc374fcf11c8ad20a8bb2749b79c8d2 build: number: 0 diff --git a/recipes/stringmlst/meta.yaml b/recipes/stringmlst/meta.yaml index c758dc52c1a0c..cf4ab92328f22 100644 --- a/recipes/stringmlst/meta.yaml +++ b/recipes/stringmlst/meta.yaml @@ -1,6 +1,6 @@ {% set name = "stringmlst" %} -{% set version = "0.5.1a" %} -{% set hash = "f446201bc63b09eef61dbfb0c0d3ba285b39b466008643a08baf9c57784c0ee8" %} +{% set version = "0.5.1" %} +{% set hash = "76635872bc0ddf77ba83baeefc6f80df46c6eb6da490e5e97aa0795abee24eff" %} package: name: {{ name|lower }} @@ -11,7 +11,7 @@ source: sha256: {{ hash }} build: - number: 1 + number: 0 skip: True # [py27] requirements: diff --git a/recipes/survivor/meta.yaml b/recipes/survivor/meta.yaml index 8b3eb551425cc..05e55efc0b24e 100644 --- a/recipes/survivor/meta.yaml +++ b/recipes/survivor/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "1.0.3" %} +{% set version = "1.0.5" %} package: name: survivor @@ -9,8 +9,9 @@ build: skip: True # [osx] source: - url: https://github.com/fritzsedlazeck/SURVIVOR/archive/{{ version }}.tar.gz - md5: 70b45ce03b2deb6c5f918ec1a801f074 + url: https://github.com/fritzsedlazeck/SURVIVOR/archive/v{{ version }}.tar.gz + sha256: bca466ffd2c063ce91aeed4468545414d7d6fcfcf16903b78a6ed9c61404419c + requirements: build: diff --git a/recipes/svdb/meta.yaml b/recipes/svdb/meta.yaml index 2b10c79402146..bec9fb5138eb6 100644 --- a/recipes/svdb/meta.yaml +++ b/recipes/svdb/meta.yaml @@ -1,5 +1,5 @@ -{% set version = "1.1.2" %} -{% set sha256 = "3df55ce5e744d589b3c6bf70fb613ed774b6c9c160b6fd0bb231a908d3ab2b7b" %} +{% set version = "1.3.0" %} +{% set sha256 = "6959dce87a61571951ff99d7ab631360384ad6c094ab71ce0a6085ec92e247b0" %} package: name: svdb @@ -28,7 +28,6 @@ requirements: - cython - numpy - scipy - - scikit-learn test: commands: diff --git a/recipes/svdb/svdb.patch b/recipes/svdb/svdb.patch deleted file mode 100644 index 2d209c90d57e7..0000000000000 --- a/recipes/svdb/svdb.patch +++ /dev/null @@ -1,12 +0,0 @@ -diff --git setup.py setup.py -index 41bb654..63fe733 100644 ---- a/setup.py -+++ b/setup.py -@@ -23,6 +23,6 @@ setup( - version = '1.0.7', - ext_modules = ext_modules, - packages = ['svdb'], -- install_requires = ['numpy', 'scikit-learn==0.15.2', 'scipy'], -+ install_requires = ['numpy', 'scikit-learn', 'scipy'], - entry_points = {'console_scripts': ['svdb = svdb.__main__:main']}, - ) diff --git a/recipes/tadarida-d/build.sh b/recipes/tadarida-d/build.sh index c0333d3f5518e..6e8748f60bbfe 100644 --- a/recipes/tadarida-d/build.sh +++ b/recipes/tadarida-d/build.sh @@ -1,6 +1,9 @@ #!/bin/bash -export LD_LIBRARY_PATH="$PREFIX/lib:$LD_LIBRARY_P‌​ATH" +export LD_LIBRARY_PATH="$PREFIX/lib:$LD_LIBRARY_PATH" +export CFLAGS="-I$PREFIX/include" +export LDFLAGS="-L$PREFIX/lib" +export CPATH=${PREFIX}/include + make -mkdir -p "$PREFIX/bin" -cp tadaridaD "$PREFIX/bin" \ No newline at end of file +cp tadaridaD ${PREFIX}/bin diff --git a/recipes/tadarida-d/meta.yaml b/recipes/tadarida-d/meta.yaml index 4572e7a902680..3a47e9b308857 100644 --- a/recipes/tadarida-d/meta.yaml +++ b/recipes/tadarida-d/meta.yaml @@ -1,6 +1,6 @@ {% set name = "Tadarida-D" %} {% set version = "1.03" %} -{% set md5 = "80503794772f6323dd4d303a8ff37e86" %} +{% set sha256 = "f19c8af60ac7eb3286a2441c60714e2f8a0c86c4ff02651bbccf4e12a9022795" %} package: name: {{ name|lower }} @@ -8,22 +8,23 @@ package: source: url: https://github.com/ThimotheeV/{{ name }}/archive/v{{ version }}.tar.gz - md5: {{ md5 }} + sha256: {{ sha256 }} build: - number: 2 + number: 3 skip: True # [osx] requirements: build: - {{ compiler('c') }} + - {{ compiler('cxx') }} host: - - qt + - qt <5 - fftw - libsndfile - zlib run: - - qt + - qt <5 - fftw - libsndfile - zlib @@ -40,6 +41,7 @@ test: about: home: https://github.com/YvesBas/Tadarida-D - license: GNU LESSER GENERAL PUBLIC LICENSE Version 3, 29 June 2007 + license: LGPL-3.0 + license_family: LGPL license_file: licence.txt summary: Tadarida-D (Toolbox for Animal Detection on Acoustic Recordings - Detection and Feature extraction part) for Galaxy use. diff --git a/recipes/taxonkit/meta.yaml b/recipes/taxonkit/meta.yaml index 129d87aecce5d..414b9757cd915 100644 --- a/recipes/taxonkit/meta.yaml +++ b/recipes/taxonkit/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "0.2.4" %} +{% set version = "0.3.0" %} package: name: taxonkit @@ -6,7 +6,7 @@ package: about: home: https://github.com/shenwei356/taxonkit - summary: A Cross-platform and Efficient NCBI Taxonomy Toolkit + summary: A cross-platform and Efficient NCBI Taxonomy Toolkit license: MIT build: @@ -15,13 +15,13 @@ build: source: url: https://github.com/shenwei356/taxonkit/releases/download/v{{ version }}/taxonkit_darwin_amd64.tar.gz # [osx] - md5: e5046d0094ec897a3a4d80c50a0e51c8 # [osx] + md5: 60fb08695513e4fc28d65e47ed9d6f1e # [osx] url: https://github.com/shenwei356/taxonkit/releases/download/v{{ version }}/taxonkit_linux_386.tar.gz # [linux] - md5: e052945be1245f40412acd7fbf8f7ac2 # [linux] + md5: 9006f9bb6e2c6db7809fcbcedc891cb8 # [linux] url: https://github.com/shenwei356/taxonkit/releases/download/v{{ version }}/taxonkit_linux_amd64.tar.gz # [linux64] - md5: 7707375ad257cb5ea7822ed9a1502263 # [linux64] + md5: 997d2c6816133b3526a28647f4bc2d6d # [linux64] test: diff --git a/recipes/telseq/meta.yaml b/recipes/telseq/meta.yaml index e99fbaf5d9672..141254d03e77b 100644 --- a/recipes/telseq/meta.yaml +++ b/recipes/telseq/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "0.0.1" %} +{% set version = "0.0.2" %} package: name: telseq @@ -6,10 +6,10 @@ package: source: url: https://github.com/zd1/telseq/archive/v{{ version }}.tar.gz - sha256: 43152ade94bf7fd41ab30f43021fd2022f2f5b5db982880c28bac13e580923fa + sha256: aac2477f0d01390d1603afe09cadf0f7ba0fb8864c579289dcbe363ca9bbfa1a build: - number: 1 + number: 0 requirements: build: diff --git a/recipes/tiptoft/meta.yaml b/recipes/tiptoft/meta.yaml new file mode 100644 index 0000000000000..dcd837c5c9563 --- /dev/null +++ b/recipes/tiptoft/meta.yaml @@ -0,0 +1,44 @@ +{% set name = "tiptoft" %} +{% set version = "0.1.4" %} +{% set hash_value = "167b7194599d6eea7b2c0fa596d0a224991cba867aa4fd067e5677b0e6bfbabf" %} + +package: + name: '{{ name|lower }}' + version: '{{ version }}' + +source: + url: https://files.pythonhosted.org/packages/e3/78/f8771c111c68508507fe83f15b4d7c1811ae31262918b0860a9526f8c7ab/tiptoft-0.1.4.tar.gz + sha256: {{ hash_value }} + +build: + number: 0 + skip: True # [py27] + script: python setup.py install --single-version-externally-managed --record=record.txt + +requirements: + host: + - python + - setuptools + - cython + run: + - python + - cython + - biopython >=1.68 + - pyfastaq >=3.12.0 + +test: + commands: + - tiptoft --help + +about: + home: https://github.com/andrewjpage/tiptoft + license: GPL3 + license_family: GPL3 + license_file: LICENSE + summary: Predict plasmids from uncorrected long read data. + doc_url: https://github.com/andrewjpage/tiptoft + dev_url: https://github.com/andrewjpage/tiptoft + +extra: + recipe-maintainers: + - andrewjpage diff --git a/recipes/transit/meta.yaml b/recipes/transit/meta.yaml new file mode 100644 index 0000000000000..72cb441034d2e --- /dev/null +++ b/recipes/transit/meta.yaml @@ -0,0 +1,47 @@ +{% set name = "transit" %} +{% set version = "2.3.1" %} + +package: + name: {{ name|lower }} + version: {{ version }} + +source: + url: https://github.com/mad-lab/{{ name }}/archive/v{{ version }}.tar.gz + sha256: ca2dd3543789acf5f4f7327ddac0a27b7ddb2ff7966959a148a84382ccddb486 + +build: + number: 0 + skip: true # [not py27] + script: "python setup.py install --single-version-externally-managed --record=record.txt" + +requirements: + build: + - python + - numpy >=1.15 + - scipy >=1.1 + - matplotlib >=2.2 + - pillow >=5.0 + - statsmodels >=0.9 + run: + - python + - numpy >=1.15 + - scipy >=1.1 + - matplotlib >=2.2 + - pillow >=5.0 + - statsmodels >=0.9 + +test: + commands: + - transit + +about: + home: http://github.com/mad-lab/transit + license: GPL-3 + license_family: GPL + summary: 'TRANSIT' + description: | + TRANSIT is a software that can be used to analyze Tn-Seq datasets. + It includes various statistical calculations of essentiality of + genes or genomic regions (including conditional essentiality + between 2 conditions). + dev_url: https://github.com/simongog/sdsl-lite diff --git a/recipes/treebest/build.sh b/recipes/treebest/build.sh index 8c92e6753199c..2dcd77421b91a 100644 --- a/recipes/treebest/build.sh +++ b/recipes/treebest/build.sh @@ -1,6 +1,9 @@ #!/bin/sh set -e +# https://github.com/conda-forge/bison-feedstock/issues/7 +export M4="${PREFIX}/bin/m4" + make mkdir -p "$PREFIX/bin" cp treebest "$PREFIX/bin/" diff --git a/recipes/treebest/meta.yaml b/recipes/treebest/meta.yaml index cf3f276369fe4..e5857d49270f3 100644 --- a/recipes/treebest/meta.yaml +++ b/recipes/treebest/meta.yaml @@ -1,13 +1,13 @@ package: name: treebest - version: "1.9.2_ep78" + version: "1.9.2.post0" source: - url: https://github.com/Ensembl/treebest/archive/ensembl_production_78.tar.gz - sha256: 1bdb036e88afb366555d0edf15ae935dcb7fe33acdd3b1c3ee01a06093ac0bca + url: https://github.com/Ensembl/treebest/archive/c9d3a2e35276c825577ec945b229e975c32078d8.tar.gz + sha256: 49573c63f98ef3a124cc09d8d363badcb90c9224a22719bdfc78274971a17461 build: - number: 2 + number: 0 requirements: build: @@ -17,7 +17,6 @@ requirements: host: - bison - flex - run: test: @@ -25,5 +24,6 @@ test: - treebest 2>&1 | grep 'Usage:' about: + home: http://treesoft.sourceforge.net/treebest.shtml license: GPLv2 summary: A tool for hierarchically clustering on a sparse graph diff --git a/recipes/trumicount/meta.yaml b/recipes/trumicount/meta.yaml index 4eebcb2ef8903..afbf61c44dc86 100644 --- a/recipes/trumicount/meta.yaml +++ b/recipes/trumicount/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "0.9.10" %} +{% set version = "0.9.11" %} package: name: "trumicount" @@ -6,7 +6,7 @@ package: source: url: https://github.com/Cibiv/trumicount/archive/v{{ version }}.tar.gz - sha256: 42a5d5293d4132cbf11f0192de48d7d9af80e880f79cfa8791d1256497f421d9 + sha256: 090cf25e4ffefcb413ee46775f4a5f330b6c036c9e9c9be32c0f30157226e4f9 build: number: 1 @@ -23,7 +23,7 @@ requirements: - r-base - r-docopt - r-data.table - - r-gwpcr >=0.9.9 + - r-gwpcr >=0.9.10 test: commands: diff --git a/recipes/twopaco/Makefile.patch b/recipes/twopaco/Makefile.patch new file mode 100644 index 0000000000000..1228423107c9d --- /dev/null +++ b/recipes/twopaco/Makefile.patch @@ -0,0 +1,41 @@ +--- src/graphconstructor/CMakeLists.txt 2017-05-18 15:47:50.000000000 -0500 ++++ src/graphconstructor/CMakeLists.txt.new 2018-10-25 02:12:19.481052545 -0500 +@@ -6,6 +6,10 @@ + list(APPEND "CMAKE_CXX_FLAGS" "-std=c++0x") + endif() + ++SET ( CMAKE_CXX_FLAGS "-std=c++0x" CACHE STRING "compile flags" FORCE) ++SET ( TBB_LIB_DIR ${PREFIX}/lib CACHE STRING "tbb lib dir" FORCE) ++SET ( TBB_INCLUDE_DIR ${PREFIX}/include/ CACHE STRING "tbb include dir" FORCE) ++ + add_executable(twopaco ../common/dnachar.cpp constructor.cpp concurrentbitvector.cpp compressedstring.cpp ../common/streamfastaparser.cpp test.cpp vertexenumerator.cpp ../common/spooky/SpookyV2.cpp common.cpp) + link_directories(${TBB_LIB_DIR}) + include_directories(${twopaco_SOURCE_DIR} ${TBB_INCLUDE_DIR} "../common") +@@ -13,4 +17,4 @@ + + set(CPACK_PACKAGE_VERSION_MAJOR "0") + set(CPACK_PACKAGE_VERSION_MINOR "9") +-set(CPACK_PACKAGE_VERSION_PATCH "2") +\ No newline at end of file ++set(CPACK_PACKAGE_VERSION_PATCH "2") +--- src/graphdump/CMakeLists.txt 2017-05-18 15:47:50.000000000 -0500 ++++ src/graphdump/CMakeLists.txt.new 2018-10-25 02:12:51.652054161 -0500 +@@ -6,12 +6,15 @@ + list(APPEND "CMAKE_CXX_FLAGS" "-std=c++0x") + endif() + ++SET ( CMAKE_CXX_FLAGS "-std=c++0x" CACHE STRING "compile flags" FORCE) ++SET ( TBB_LIB_DIR ${PREFIX}/lib CACHE STRING "tbb lib dir" FORCE) ++SET ( TBB_INCLUDE_DIR ${PREFIX}/include/ CACHE STRING "tbb include dir" FORCE) ++ + add_executable(graphdump graphdump.cpp ../common/dnachar.cpp ../common/streamfastaparser.cpp) + link_directories(${TBB_LIB_DIR}) + include_directories(${twopaco_SOURCE_DIR} ${TBB_INCLUDE_DIR} "../common") + target_link_libraries(graphdump "tbb") + +- + set(CPACK_PACKAGE_VERSION_MAJOR "0") + set(CPACK_PACKAGE_VERSION_MINOR "9") +-set(CPACK_PACKAGE_VERSION_PATCH "2") +\ No newline at end of file ++set(CPACK_PACKAGE_VERSION_PATCH "2") diff --git a/recipes/twopaco/build.sh b/recipes/twopaco/build.sh index b0787d82324e0..fea267413165d 100644 --- a/recipes/twopaco/build.sh +++ b/recipes/twopaco/build.sh @@ -1,10 +1,17 @@ #!/bin/bash -mkdir -p "$PREFIX/bin" +export CFLAGS="-I${PREFIX}/include" +export CXXFLAGS="-I{$PREFIX}/include" +export LDFLAGS="-L${PREFIX}/lib" +export LD_LIBRARY_PATH="${PREFIX}/lib:${LD_LIBRARY_PATH}" +export CPATH=${PREFIX}/include +export C_INCLUDE_PATH=$PREFIX/include mkdir build cd build -cmake ../src + +cmake ../src make -cp graphconstructor/twopaco $PREFIX/bin/ -cp graphdump/graphdump $PREFIX/bin/ + +cp graphconstructor/twopaco ${PREFIX}/bin/ +cp graphdump/graphdump ${PREFIX}/bin/ diff --git a/recipes/twopaco/meta.yaml b/recipes/twopaco/meta.yaml index 3909c6871b082..a7e4c52f6d22e 100644 --- a/recipes/twopaco/meta.yaml +++ b/recipes/twopaco/meta.yaml @@ -1,27 +1,28 @@ -{% set name = "twopaco" %} +{% set name = "TwoPaCo" %} {% set version = "0.9.2" %} -{% set hash = "0493807d4ad232067058904c69a1e968682f97d62e81aa452b5fc7b64d06b044" %} +{% set sha256 = "0493807d4ad232067058904c69a1e968682f97d62e81aa452b5fc7b64d06b044" %} package: name: {{ name|lower }} version: {{ version }} source: - url: https://github.com/medvedevgroup/TwoPaCo/archive/v{{ version }}.tar.gz - sha256: {{ hash }} + url: https://github.com/medvedevgroup/{{ name }}/archive/v{{ version }}.tar.gz + sha256: {{ sha256 }} + patches: + - Makefile.patch build: - number: 1 + number: 2 skip: True # [osx] requirements: build: - {{ compiler('c') }} + - {{ compiler('cxx') }} - cmake - - tbb - - run: - - tbb + host: + - tbb-devel test: commands: @@ -30,5 +31,6 @@ test: about: home: https://github.com/medvedevgroup/TwoPaCo - license: BSD-3-Clause - summary: 'A fast constructor of the compressed de Bruijn graph from many genomes' + license: Custom OSS + license_file: LICENSE.txt + summary: 'A fast constructor of the compressed de Bruijn graph from many genomes.' diff --git a/recipes/umi_tools/meta.yaml b/recipes/umi_tools/meta.yaml index 56156bfe265de..02d4ccbb8332b 100644 --- a/recipes/umi_tools/meta.yaml +++ b/recipes/umi_tools/meta.yaml @@ -11,20 +11,21 @@ source: sha256: {{ sha256hash }} build: - number: 1 + number: 2 + script: "{{ PYTHON }} -m pip install . --no-deps --ignore-installed --no-cache-dir -vvv" + entry_points: + - umi_tools = umi_tools.umi_tools:main requirements: build: - {{ compiler('c') }} host: - python + - pip - matplotlib - scipy - regex - - freetype - - certifi ==2016.9.26 - setuptools >=1.1 - - cython >=0.19 - numpy >=1.7 - pandas >=0.12.0 - pysam >=0.8.4 @@ -34,9 +35,6 @@ requirements: - matplotlib - scipy - regex - - freetype - - certifi ==2016.9.26 - - cython >=0.19 - numpy >=1.7 - pandas >=0.12.0 - pysam >=0.8.4 @@ -49,5 +47,7 @@ test: about: home: https://github.com/CGATOxford/UMI-tools license: MIT License + license_family: MIT summary: 'Tools for dealing with Unique Molecular Identifiers (UMIs) / Random Molecular Tags (RMTs)' + dev_url: https://github.com/CGATOxford/UMI-tools diff --git a/recipes/umis/meta.yaml b/recipes/umis/meta.yaml index 7df363e666b54..afc2ed6207f99 100644 --- a/recipes/umis/meta.yaml +++ b/recipes/umis/meta.yaml @@ -1,13 +1,13 @@ package: name: umis - version: '1.0.0' + version: '1.0.1' build: - number: 1 + number: 0 source: - url: https://github.com/vals/umis/archive/b02a113.tar.gz - sha256: 44593b48c1c30784739b5adea92f8b6891c67bdc4bf314ee12b5eed434d706e1 + url: https://github.com/vals/umis/archive/7bbca5a.tar.gz + sha256: 5b773cc2ae1634c37665b011cd4681f3d4a4df169059859596a810939d54f1da requirements: build: @@ -15,17 +15,11 @@ requirements: host: - python - setuptools - - pandas - - click - - pysam - - regex - cython - - toolz - - scipy run: - python - pandas - - click + - "click>=7.0" - pysam - regex - cython diff --git a/recipes/validators/meta.yaml b/recipes/validators/meta.yaml index bf51186a55118..92fc3dc2b3f98 100644 --- a/recipes/validators/meta.yaml +++ b/recipes/validators/meta.yaml @@ -1,5 +1,5 @@ -{% set version = "0.12.1" %} -{% set sha256 = "79855e18710be5d8ba5e0c16086d76f230af11df2b8341b64995b42153c7f204" %} +{% set version = "0.12.2" %} +{% set sha256 = "172ac45f7d1944ce4beca3c5c53ca7c83e9759e39fd3fedc1cf28e2130268706" %} package: name: validators @@ -7,12 +7,12 @@ package: source: url: https://pypi.python.org/packages/source/v/validators/validators-{{version}}.tar.gz - sha256: 79855e18710be5d8ba5e0c16086d76f230af11df2b8341b64995b42153c7f204 + sha256: 172ac45f7d1944ce4beca3c5c53ca7c83e9759e39fd3fedc1cf28e2130268706 build: noarch: python script: python -m pip install --no-deps --ignore-installed . - number: 2 + number: 0 requirements: host: diff --git a/recipes/vardict-java/meta.yaml b/recipes/vardict-java/meta.yaml index b36a71370fb60..730ab1c3042c0 100644 --- a/recipes/vardict-java/meta.yaml +++ b/recipes/vardict-java/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "1.5.6" %} +{% set version = "1.5.7" %} package: name: vardict-java @@ -6,7 +6,7 @@ package: source: url: https://github.com/AstraZeneca-NGS/VarDictJava/releases/download/v{{ version }}/VarDict-{{ version }}.zip - sha256: fae85843c723f5ffae278f687bfbfc85a9241432387857ab59d4540ba772a5b7 + sha256: 597fa238f6812123b715c0d324a2827910ff68e7a16e6c9e045d4e192e199fe6 build: number: 0 diff --git a/recipes/vardict/meta.yaml b/recipes/vardict/meta.yaml index 60f16f891c590..b1cd9d5568e10 100644 --- a/recipes/vardict/meta.yaml +++ b/recipes/vardict/meta.yaml @@ -1,6 +1,6 @@ -{% set version = "2018.09.21" %} -{% set revision = "2e4380f" %} -{% set sha256 = "82c06f078f32485c565a55c90d65169c03dabade2a1ae2576a5ff50113bed7df" %} +{% set version = "2018.10.18" %} +{% set revision = "780af2c" %} +{% set sha256 = "d2777b461c7566fed326a45d4d6df70367426e438787d8b194318ed7d48fcfcf" %} package: name: vardict @@ -15,13 +15,16 @@ build: number: 0 requirements: + host: + - perl + - r-base run: - perl - r-base test: commands: - - vardict -h + - vardict -H about: home: https://github.com/AstraZeneca-NGS/VarDict diff --git a/recipes/vcf-annotator/build.sh b/recipes/vcf-annotator/build.sh new file mode 100644 index 0000000000000..4633cacf51b67 --- /dev/null +++ b/recipes/vcf-annotator/build.sh @@ -0,0 +1,5 @@ +#!/bin/bash + +mkdir -p $PREFIX/bin +chmod 755 vcf-annotator.py +cp -f vcf-annotator.py $PREFIX/bin/vcf-annotator diff --git a/recipes/vcf-annotator/meta.yaml b/recipes/vcf-annotator/meta.yaml new file mode 100644 index 0000000000000..961b1c4fbd38a --- /dev/null +++ b/recipes/vcf-annotator/meta.yaml @@ -0,0 +1,38 @@ +{% set name="vcf-annotator" %} +{% set version = "0.5" %} +{% set sha256 = "48e9a0103b4c390bb59e357da9b0316843e5c543d9a9e1488e054982d462c6ca" %} + +package: + name: {{ name }} + version: {{ version }} + +source: + url: https://github.com/rpetit3/vcf-annotator/archive/v{{ version }}.tar.gz + sha256: {{ sha256 }} + +build: + number: 0 + skip: True # [py27] + +requirements: + host: + - python + - pip + - biopython + - pyvcf + run: + - python + - biopython + - pyvcf + +test: + commands: + - vcf-annotator + - vcf-annotator --version + - vcf-annotator -h + +about: + home: https://github.com/rpetit3/vcf-annotator + license: MIT + license_file: LICENSE + summary: Use the reference GenBank file to add biological annotations to the variant calls in a VCF. diff --git a/recipes/vcf2db/meta.yaml b/recipes/vcf2db/meta.yaml index 4ae4ac3a45fd2..8e4021e5af4a8 100644 --- a/recipes/vcf2db/meta.yaml +++ b/recipes/vcf2db/meta.yaml @@ -1,14 +1,14 @@ package: name: vcf2db - version: '2018.05.23' + version: '2018.10.26' build: - number: 2 + number: 0 skip: True # [not py27] source: - url: https://github.com/quinlan-lab/vcf2db/archive/231f830.tar.gz - sha256: a6f53089f1e92f7c92e9691c4f0810403f1d1666995e3adab75362f38da93683 + url: https://github.com/quinlan-lab/vcf2db/archive/03a31a6.tar.gz + sha256: e85c41dceb031c5c2348ddb71bc45425a5eb9d3fd4513aa19e54223695eed007 requirements: host: diff --git a/recipes/vcfanno/meta.yaml b/recipes/vcfanno/meta.yaml index bb9d9a2d6502a..ab4cbfb6075b7 100644 --- a/recipes/vcfanno/meta.yaml +++ b/recipes/vcfanno/meta.yaml @@ -1,4 +1,4 @@ -{% set version = '0.3.0' %} +{% set version = '0.3.1' %} package: name: vcfanno @@ -6,9 +6,9 @@ package: source: url: https://github.com/brentp/vcfanno/releases/download/v{{ version }}/vcfanno_osx # [osx] - sha256: 4b1644276b4cb90dc9fdd09671ad9d507c928ba9e2a6d21b680eec6c494f7361 # [osx] + sha256: 8cba0a23dc0f93ca74e2d5c5cc10d7f2f86aa13b84e4bca88e25e172742bbec6 # [osx] url: https://github.com/brentp/vcfanno/releases/download/v{{ version }}/vcfanno_linux64 # [linux] - sha256: fb0371563730061b6ab6ac3fe61ff74ae3b9a164db45fbc942907f440e893e78 # [linux] + sha256: 4df3bdac4809a3aca698819a2d56c58d1f4c117a3b8069bb9f7a9cbefe1df397 # [linux] build: number: 0 diff --git a/recipes/vcfsamplecompare/build.sh b/recipes/vcfsamplecompare/build.sh new file mode 100644 index 0000000000000..f1c6288dfafa3 --- /dev/null +++ b/recipes/vcfsamplecompare/build.sh @@ -0,0 +1,7 @@ +#!/bin/bash + +set -e + +perl Makefile.PL INSTALLDIRS=site +make +make install diff --git a/recipes/vcfsamplecompare/meta.yaml b/recipes/vcfsamplecompare/meta.yaml new file mode 100644 index 0000000000000..25634c01300d0 --- /dev/null +++ b/recipes/vcfsamplecompare/meta.yaml @@ -0,0 +1,44 @@ +{% set name = "vcfsamplecompare" %} +{% set realname = "vcfSampleCompare" %} +{% set version = "v2.006" %} +about: + home: https://github.com/hepcat72/{{ realname }} + license: GNU + license_file: LICENSE + summary: This script sorts and (optionally) filters the rows/variants of a VCF + file (containing data for 2 or more samples) based on the differences in the + variant data between samples or sample groups. Degree of "difference" is + determined by either the best possible degree of separation of sample groups + by genotype calls or the difference in average allelic frequency of each + sample or sample group (with a gap size threshold). The pair of samples or + sample groups used to represent the difference for a variant row is the one + leading to the greatest difference in consistent genotype or average allelic + frequencies (i.e. observation ratios, e.g. AO/DP) of the same variant state. + If sample groups are not specified, the pair of samples leading to the + greatest difference is greedily discovered and chosen to represent the + variant/row. + +build: + number: 0 +package: + name: {{ name }} + version: {{ version }} +requirements: + build: + - make + host: + - perl + run: + - perl + +source: + url: https://github.com/hepcat72/{{ realname }}/archive/{{ version }}.tar.gz + sha256: 97c576f10043f00bc0b003f62106ae77e65588aa7652a8364fc09c8ce8f59207 + +test: + commands: + - {{ realname }}.pl --version + +extra: + identifiers: + - doi:10.5281/zenodo.1453403 diff --git a/recipes/vsearch/meta.yaml b/recipes/vsearch/meta.yaml index 6c6f39b808c32..e1eab98ff2aca 100644 --- a/recipes/vsearch/meta.yaml +++ b/recipes/vsearch/meta.yaml @@ -1,5 +1,5 @@ -{% set version = "2.8.5" %} -{% set sha256 = "15f0ca42ba237a51f3b74ffdac9783b74f19a24d6120dded999b1d0da72f12ce" %} +{% set version = "2.9.1" %} +{% set sha256 = "4c66e1f8399dcd9f64266eb8449c2b3a17a4b2afc6645a420d60c783039339d7" %} package: name: vsearch diff --git a/recipes/w4mclassfilter/0.98.8/meta.yaml b/recipes/w4mclassfilter/0.98.8/meta.yaml new file mode 100644 index 0000000000000..d40427b82e414 --- /dev/null +++ b/recipes/w4mclassfilter/0.98.8/meta.yaml @@ -0,0 +1,36 @@ +{% set version = "0.98.8" %} +{% set md5 = "68f6b051aee6181c39f3f4bce01112ba" %} + +package: + name: w4mclassfilter + version: {{ version }} + +source: + url: https://github.com/HegemanLab/w4mclassfilter/releases/download/v{{ version }}/w4mclassfilter_{{ version }}.tar.gz + md5: {{ md5 }} + +build: + number: 1 + rpaths: + - lib/R/lib/ + - lib/ + script: + - $R CMD INSTALL --build . + +requirements: + build: + - r-base + run: + - r-base + +test: + commands: + - '$R -e "library(w4mclassfilter)"' + +about: + home: https://github.com/HegemanLab/w4mclassfilter + license: MIT + summary: 'Filter Workflow4Metabolomics dataMatrix, sampleMetadata, and + variableMetadata files by sample-class, imputing zero for NA values and + eliminating zero-variance rows and columns from the data-matrix. + MIT Licence allows redistribution.' diff --git a/recipes/w4mclassfilter/meta.yaml b/recipes/w4mclassfilter/meta.yaml index d40427b82e414..35964e568f05e 100644 --- a/recipes/w4mclassfilter/meta.yaml +++ b/recipes/w4mclassfilter/meta.yaml @@ -1,5 +1,5 @@ -{% set version = "0.98.8" %} -{% set md5 = "68f6b051aee6181c39f3f4bce01112ba" %} +{% set version = "0.98.9" %} +{% set md5 = "b92f3f5cbdabb55a2f38fe7340ee3a3a" %} package: name: w4mclassfilter @@ -10,7 +10,7 @@ source: md5: {{ md5 }} build: - number: 1 + number: 0 rpaths: - lib/R/lib/ - lib/ diff --git a/recipes/wisecondorX/meta.yaml b/recipes/wisecondorX/meta.yaml index 6df37c2e55f46..fc5b315823f60 100644 --- a/recipes/wisecondorX/meta.yaml +++ b/recipes/wisecondorX/meta.yaml @@ -1,15 +1,15 @@ -{% set version="0.2.1" %} +{% set version="1.0.1" %} package: name: wisecondorx version: {{ version }} source: url: https://github.com/CenterForMedicalGeneticsGhent/wisecondorX/archive/v{{ version }}.tar.gz - sha256: 048f95292d6854c6ac2335333ff9ac7d0cf86e2bdee12647e9a4642aa21046c4 + sha256: ab0fdca7cd93d0cead9139a2a84f8cfeaaaad2752b086db342fcb47acb02e15b build: number: 0 - noarch: python # [not py27] + noarch: python # requirements: host: @@ -36,8 +36,6 @@ test: - WisecondorX gender --help - WisecondorX newref --help - WisecondorX predict --help - - fix_convert_npz.py --help - about: home: https://github.com/CenterForMedicalGeneticsGhent/wisecondorX license: Attribution-NonCommercial-ShareAlike CC BY-NC-SA diff --git a/recipes/womtool/meta.yaml b/recipes/womtool/meta.yaml index ccabb8e0056f7..485c60aadd265 100644 --- a/recipes/womtool/meta.yaml +++ b/recipes/womtool/meta.yaml @@ -1,5 +1,5 @@ {% set name="womtool" %} -{% set version="31" %} +{% set version="36" %} about: home: https://cromwell.readthedocs.io/en/develop/WOMtool/ license: "BSD" @@ -9,10 +9,10 @@ package: version: {{ version }} build: noarch: python - number: 1 + number: 0 source: url: https://github.com/broadinstitute/cromwell/archive/{{ version }}.tar.gz - sha256: df599e197ef58aeac5c10ee9e2bf65e98b59356e9b1cfc824438447651b60d74 + sha256: 6e668caa2568510312ede7a3f75f4880937a2542c2697e44f43d50e04f9ca581 requirements: host: - openjdk >=8 diff --git a/recipes/wtdbg/meta.yaml b/recipes/wtdbg/meta.yaml index 2cbc6898c2dde..96c89e3a2305d 100644 --- a/recipes/wtdbg/meta.yaml +++ b/recipes/wtdbg/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "2.0" %} +{% set version = "2.1" %} package: name: wtdbg @@ -6,7 +6,7 @@ package: source: url: https://github.com/ruanjue/wtdbg2/archive/{{ version }}.tar.gz - sha256: 09506fc0a1fcde9646e4f087edb008e74f718db36e815f72db8babebe5b56e28 + sha256: dc72191038c2ee6d220fcee52deffbcd6cb377f581a7b994eec97b3e5402cae2 build: number: 0 diff --git a/recipes/wtforms-alchemy/meta.yaml b/recipes/wtforms-alchemy/meta.yaml index e0332a8714790..6a3c3dba76b8c 100644 --- a/recipes/wtforms-alchemy/meta.yaml +++ b/recipes/wtforms-alchemy/meta.yaml @@ -1,14 +1,14 @@ build: - number: 1 + number: 0 skip: True # [osx] package: name: wtforms-alchemy - version: "0.15.0" + version: "0.16.7" source: - url: https://pypi.python.org/packages/source/W/WTForms-Alchemy/WTForms-Alchemy-0.15.0.tar.gz - md5: 2b38bd46d005ef833a8e164ef7e9d45d + url: https://pypi.python.org/packages/source/W/WTForms-Alchemy/WTForms-Alchemy-0.16.7.tar.gz + sha256: 518e6d725f3b860b0b271e78dc4242cc42cd051b42f9a9a8092b5be968cf3f0e requirements: host: diff --git a/recipes/xatlas/meta.yaml b/recipes/xatlas/meta.yaml index 7653bdca054c7..d1c36682a251e 100644 --- a/recipes/xatlas/meta.yaml +++ b/recipes/xatlas/meta.yaml @@ -1,4 +1,4 @@ -{% set version = "0.1" %} +{% set version = "0.2.1" %} {% set name = "xatlas" %} package: @@ -6,12 +6,12 @@ package: version: {{ version }} build: - number: 2 + number: 0 skip: True # [osx] source: url: https://github.com/jfarek/{{ name }}/archive/v{{ version }}.tar.gz - sha256: 6f709edb70ea565b80e3ef14110631e3f3b835748540fd5d87af9a56fa2a5511 + sha256: 261df7e069d1184f6cd92cc48e097b1e62b68e54b3f1fec45a3392f14e1b619a requirements: build: diff --git a/scripts/travis-run.sh b/scripts/travis-run.sh index 5a602e7bd08a8..4778e5eda989e 100644 --- a/scripts/travis-run.sh +++ b/scripts/travis-run.sh @@ -2,12 +2,12 @@ set -euo pipefail # Set some defaults set +u -[[ -z $DOCKER_ARG ]] && DOCKER_ARG="" -[[ -z $TRAVIS ]] && TRAVIS="false" -[[ -z $BIOCONDA_UTILS_LINT_ARGS ]] && BIOCONDA_UTILS_LINT_ARGS="" -[[ -z $RANGE_ARG ]] && RANGE_ARG="--git-range master HEAD" -[[ -z $DISABLE_BIOCONDA_UTILS_BUILD_GIT_RANGE_CHECK ]] && DISABLE_BIOCONDA_UTILS_BUILD_GIT_RANGE_CHECK="false" -[[ -z $SKIP_LINTING ]] && SKIP_LINTING=false +DOCKER_ARG=${DOCKER_ARG:-""} +TRAVIS=${TRAVIS:-"false"} +BIOCONDA_UTILS_LINT_ARGS=${BIOCONDA_UTILS_LINT_ARGS:-""} +RANGE_ARG=${RANGE_ARG:-"--git-range master HEAD"} +DISABLE_BIOCONDA_UTILS_BUILD_GIT_RANGE_CHECK=${DISABLE_BIOCONDA_UTILS_BUILD_GIT_RANGE_CHECK:-"false"} +SKIP_LINTING=${SKIP_LINTING:-"false"} set -u