You signed in with another tab or window. Reload to refresh your session.You signed out in another tab or window. Reload to refresh your session.You switched accounts on another tab or window. Reload to refresh your session.Dismiss alert
With PySam 0.8.3, pysam.faidx returns a string like 'TCACACACACACACACACACACACACACACACAG'. In newer PySam, this is instead 'CHR1:6159227-6159260TCACACACACACACACACACACACACACACACAG'. This breaks starting coordinate correction.
With PySam >=0.10.0, all loci report that they do not appear to be the starting sequence for a kmer.
The text was updated successfully, but these errors were encountered: